Skip to main content
Plants logoLink to Plants
. 2024 Aug 27;13(17):2391. doi: 10.3390/plants13172391

Molecular Insights into the Role of Sterols in Microtuber Development of Potato Solanum tuberosum L.

Lisset Herrera-Isidron 1,*,, Eliana Valencia-Lozano 2,, Braulio Uribe-Lopez 1, John Paul Délano-Frier 2, Aarón Barraza 3, José Luis Cabrera-Ponce 2,*
Editor: Igor A Yakovlev
PMCID: PMC11397162  PMID: 39273873

Abstract

Potato tubers are reproductive and storage organs, enabling their survival. Unraveling the molecular mechanisms that regulate tuberization is crucial for understanding how potatorespond to environmental stress situations and for potato breeding. Previously, we did a transcriptomic analysis of potato microtuberization without light. This showed that important cellular processes like ribosomal proteins, cell cycle, carbon metabolism, oxidative stress, fatty acids, and phytosterols (PS) biosynthesis were closely connected in a protein–protein interaction (PPI) network. Research on PS function during potato tuberization has been scarce. PS plays a critical role in regulating membrane permeability and fluidity, and they are biosynthetic precursors of brassinosteroids (BRs) in plants, which are critical in regulating gene expression, cell division, differentiation, and reproductive biology. Within a PPI network, we found a module of 15 genes involved in the PS biosynthetic process. Darkness, as expected, activated the mevalonate (MVA) pathway. There was a tight interaction between three coding gene products for HMGR3, MVD2, and FPS1, and the gene products that synthetize PS, including CAS1, SMO1, BETAHSD, CPI1, CYP51, FACKEL, HYDRA1, SMT2, SMO2, STE1, and SSR1. Quantitative real-time polymerase chain reaction (qRT-PCR) confirmed the expression analysis of ten specific genes involved in the biosynthesis of PS. This manuscript discusses the potential role of genes involved in PS biosynthesis during microtuber development.

Keywords: potato, Solanum tuberosum, microtubers (MTs), sterol biosynthesis, transcriptome sequencing, qRT-PCR, darkness, cytokinin

1. Introduction

Plant sterols, called phytosterols (PS), are integral components of the plant cell membranes. They are mainly found in the plasma membrane and in lower amounts in tonoplasts, mitochondria, and outer membranes of chloroplasts. PS forms lipid microdomains, providing fluidity, permeability, and transport across the membranes [1,2,3]. They are involved in signal transduction [4], auxin and ethylene signaling, the auxin efflux carrier system [5], regulation of cellulose biosynthesis [6,7], cell wall development [8], cyclin CycD3 activation [9], endocytosis, and cytoskeleton maintenance [10]. They are also essential in early embryo development [11,12,13], vascular patterning [14], stem elongation [15], plastid development [16], tillering [17], modulation of flowering, and potato tuberization [18,19].

Sitosterol is the most prevalent PS in Arabidopsis thaliana seedlings, followed by campesterol, stigmasterol, and more than 20 other minor PS, many of which are metabolic intermediates [12]. Sitosterol and stigmasterol are significant components of the plasma membrane (PM), which are critical for membrane fluidity and permeability [20,21]. Campesterol acts as a precursor for many brassinosteroids (BRs), which promote the growth of stems by increasing their length and encouraging cell division [20,21].

The initial genetic evidence supporting the involvement of PS in plant growth and development came from three Arabidopsis mutants that had impaired PS production: C-14 reductase (fk) [12,13], cephalopod/sterol methyl transferase 1 (cph/smt1) [1,22], and sterol C-8,7 isomerase (hyd1) [5]. It was found that all three enzymes act upstream of the BRs DWARF (DWF) pathway and have the inability to save the mutants by providing BRs, which led to the concept that PS are involved in new signaling pathways [23].

Overexpression of StHMGR1, StHMGR3, StHMGR1/StFPS1, and StHMGR3/StFPS1 in potatoresulted in changes in the expression of PS biosynthesis genes, which are the primary end-products of cytosolic and plastidial isoprenoids (PS, SGAs, chlorophylls, and carotenoids). Additionally, this overexpression affected flowering, stem height, biomass, and tuber weight [18]. Double mutant fps1/fps2 are embryo lethal [24]. The transcript levels of two distinct flowering locus (FT) paralogs, SELF-PRUNING StSP3D (associated with the transition to flowering) and StSP6A genes (associated with the induction of tuberization), were elevated in these lines, suggesting that both StHMGR and StFPS play a role in regulating the transitions of flowering and tuberization in potato [18].

Zhu et al. 2019 [25] have shown that exogenous epibrassinolide spraying in potato plants up-regulates the expression of the main regulators of tuberization, StCDF1 and StSP6A, 8- and 4-fold, respectively, and increased the number and fresh weight of potato tubers. Silencing the StBRI1 (BRASSINOSTEROIDS INSENSITIVE 1), the functional receptor in potato for BRs signaling, showed a decreased expression level of StSP6A and, consequently, a reduced number of tubers and yield [19].

Potato(Solanum tuberosum L.) contain bioactive lipids, including PS, in addition to carbohydrates, nutrients, and minerals [26,27,28]. PS are synthesized via the mevalonate (MVA) pathway, which occurs in the cytoplasm [29,30]. PS have been extensively studied due to their health-promoting effects. However, the primary focus in potato plants has been on steroidal glycoalkaloids (SGA), which are metabolites produced from PS and possess undesirable dietary qualities such as a bitter taste and toxicity [31].

We have previously reported a transcriptome analysis of potato microtuberization under darkness and osmotic stress conditions [32]. Further data analyses revealed, using a protein–protein interaction (PPI) network, that within the transcriptome analysis, a gene module of PS biosynthesis interacts with carbon metabolism, fatty acid biosynthesis, the cell cycle, and ribosomal proteins. To elucidate the molecular mechanisms involved during potato microtubers (MTs) development, we analyzed MVA-related PS biosynthesis and tuberigen regulatory genes, highlighting its regulation by cytokinin and darkness.

These findings provide novel approaches to enhance the quality of tubers by addressing the role of PSs’ response to environmental stress. This will be advantageous for breeding programs and genetic editing.

2. Results

2.1. Microtuber Development

Potato seedlings of the Solanum tuberosum cv. Alpha MTs variety were produced by culturing stolon explants in a growth medium consisting of MS media with 8% sucrose, 6 g/L of gelrite, 10 mg/L of 2-iP, and 0.3% w/v activated charcoal—the incubation period lasted for three weeks in darkness, according to Valencia-Lozano et al. (2022) [32] (Figure 1a,b). The MTs in Figure 1a were 4 mm in diameter, with a white to yellowish color, and developed in basal and upward in the stolon explants after three weeks in culture. Figure 1b shows mature MTs that are 7–9 mm in diameter and brown-colored after 2 months in culture. Figure 1c shows stolon control explants that were grown in MS medium that had 1% sucrose, 3 g/L of gelrite, 10 mg/L of 2-iP, and 0.3% w/v activated charcoal added to it. After three months in culture, we never observed microtuberization under these conditions.

Figure 1.

Figure 1

Potato Solanum tuberosum L. cv Alpha MTs development. (a) MTs development from stolon explants cultured in MR8-G6-2-iP medium after three weeks of incubation in darkness. The scale bar represents 1.0 cm. (b) Mature MTs development from stolon explants in MR8-G6-2-iP medium after two months of incubation in darkness. Scale bar represents 1.0 cm. (c) Stolon explants cultured in control conditions: MS medium, 1% sucrose, 3 g/L gelrite, 10 mg/L 2-iP, and 0.3% w/v activated charcoal in darkness. The scale bar represents 0.5 cm.

2.2. Identification of Up-Regulated Transcripts Involved in PS Biosynthesis

To obtain an overview of the potato gene expression profile during the tuberization period, cDNA samples from tubers were subjected to RNAseq and transcriptomic analyses. Sequencing of cDNA libraries generated a total of 397,834,274 reads. Of these, 4756 transcript genes were significantly (>2-fold-change and p < 0.05) and differentially expressed. A total of 2896 transcript genes were up-regulated, and 1860 transcript genes were down-regulated (Figure 2a) [32]. It is remarkable that from the 4756 differentially expressed genes, 21 transcript genes (19 up-regulated and 2 down-regulated) correspond to MVA-related and PS biosynthesis pathway genes (Figure 2b). Moreover, we proceeded to compare the MVA-related and PS biosynthesis pathway gene expression levels between MTs induced in dark conditions and grown plants in control conditions from the normalized reads to TPM (transcripts per million). The hierarchical bi-clustering analysis was used to confirm the DEG analysis and to obtain a better perspective of the analyzed data (Figure 3).

Figure 2.

Figure 2

Volcano plot of differentially expressed genes (DEGs) in potato MTs induced in dark conditions. (a) DEG complete data set (>2-fold change and p < 0.05). (b) DEG of MVA-related and PS biosynthesis pathway genes.

Figure 3.

Figure 3

Hierarchical clustering analysis (HCA) and heat map displaying the up-regulated genes involved in PS biosynthesis during potato MTs development in darkness; the up-regulation levels are shown in Log2.

To determine the interaction among the MVA-related and PS pathway gene products, a PPI network analysis was carried out with stringent parameters to ensure the robustness and confidence of the resulting protein interactions network. The confidence value was set at 0.800, which ensured a high degree of likelihood since, from the 19 DEGs of the MVA-related and PS biosynthesis genes, only 15 were kept in the resulting PPI network (Table 1). The modules of the PPI network found in this analysis are as follows: Ribosome biogenesis, cell cycle, carbon metabolism, starch biosynthesis, glycerophospholipid metabolic process, fatty acid metabolism, histone modification, reactive oxygen species (ROS), phenylpropanoid biosynthesis, PEBP family members, and PS and MVA biosynthesis pathways (Figure 4). Remarkably, the gene products of the MVA-related or PS biosynthesis pathway exhibited the highest degree of interaction, suggesting a tight regulation explicitly based on each biosynthetic pathway (Supplementary Data Table S1, Figure 5).

Table 1.

PS biosynthesis up-regulated genes identified in this work.

No ID String v.12 Arabidopsis Annotation
1 HMG3 HMGR3 Hydroxy-3-methylglutaryl-coenzyme A reductase 1-like
2 M1C7S0_SOLTU MVD2 Diphosphomevalonate decarboxylase-like
3 M1CX22_SOLTU FPS1 Farnesyl pyrophosphate synthase 1-like
4 M1CST0_SOLTU CAS1 Cycloartenol synthase
5 M1AYT4_SOLTU SMO1-1 Fatty acid hydroxylase domain-containing protein
6 M1AB90_SOLTU HSD1 3βHSD domain-containing protein
7 M1A0D5_SOLTU CPI1 Cycloeucalenol cycloisomerase
8 M1BCS3_SOLTU CYP51 Sterol 14-demethylase
9 M0ZSD2_SOLTU FACKEL Delta14-sterol reductase
10 SI1 HYD1 Cholestenol Delta-isomerase
11 M1BLQ0_SOLTU SMT2 24-methylenesterol C-methyltransferase
12 M0ZQ08_SOLTU SMO2 Fatty acid hydroxylase domain-containing protein
13 M1CI11_SOLTU STE1/DWF7 Delta7-sterol 5-desaturase
14 StSSR1 DWF1 Delta (24)-sterol reductase-like
15 M1BMW2_SOLTU DAS Delta-amyrin synthase

Figure 4.

Figure 4

PPI network of up-regulated genes derived from the STRING database v12.0 for potato S. tuberosum, based on transcriptomic-wide analysis with high confidence (0.800). Modules are highlighted and blue arrow indicates the PS biosynthetic module. The figure illustrates a full network, where edges represent both functional and physical protein associations.

Figure 5.

Figure 5

PPI network of up-regulated PS biosynthetic genes during potato tuberization, yielded in STRING database v12.0 with 0.800 confidence. Blue color represents genes involved in the MVA pathway, yellow represents PS biosynthetic genes, and green represents the products of each gene.

Finally, we selected the genes FSP1 and HMGR3 from the MVA-related pathway, CPI1, CYP51, FACKEL, SI1/HYD1, SMT1, and SMT2 from the PS biosynthesis pathway, and StSP6A and FD from the tuberigen regulatory pathway to determine whether the transcriptional behavior’s observed trend in the transcriptomic analysis is consistent with the expression levels assessed through quantitative PCR (qPCR) analysis. The qPCR analysis of the selected genes involved in the MVA-related PS biosynthesis and tuberigen regulation pathways showed an up-regulation trend, except for SMT1, which exhibited a down-regulation behavior, and altogether have been shown the same behavioral expression trend for both analytical approaches: transcriptomics and qPCR (Figure 6).

Figure 6.

Figure 6

Quantitative RT-qPCR analysis validation of the MVA-related (two genes) and PS biosynthesis (six genes) and tuberigen regulatory (two genes) pathway showed significant differential expression levels through transcriptomics analysis. Blue bars correspond to relative expression estimation through qPCR analysis. Orange bars correspond to the DEG estimated relative expression through transcriptomics analysis. Relative expression estimation levels are represented in Log2-fold change.

3. Discussion

PS are essential components of cellular membranes, signal transduction, regulation of plant ontogenesis, and stress tolerance. To understand the roles of PS in the potato microtuberization process under darkness, we performed data mining of the complete transcriptomics data set to focus on the MVA-related and PS biosynthesis pathway-related gene transcripts activity. Overall, 21 DEGs for MVA-related and PS biosynthetic pathway transcript genes were identified in the transcriptomics data set of MTs induced under dark conditions (Figure 2). A PPI analysis network of MVA-related and PS biosynthetic pathway genes with a high stringency threshold (0.800) value was performed, in which 15 of the 21 DEGs gene products were kept, 3 gene products (HMG1/HMGR3, MVD2, and FPS1) belonged to the MVA pathway and 12 gene products (CAS1, SMO1, 3BHSD/D2/HSD1, CPI1, CYP51, FACKEL, SI1/HYD1, SMT2, SMO2, STE1/DWF7, SSR1,bAS) highlighted a high degree of regulation in the PS biosynthesis in the microtuberization process under the darkness condition (Figure 4 and Figure 5, Table 1). Furthermore, the cytosolic MVA pathway is involved in the isoprenoids, PS (campesterol, stigmasterol, and sitosterol), and plant hormones biosynthesis (abscisic acid, BRs, cytokinins, gibberellic acid, and strigolactones) [33]. The PPI network analysis showed that Hydroxy-3-methylglutaryl CoA reductase (HMG1, M1CAE9_SOLTU 3, PGSC0003DMT400063296) interacts with MVD2 (M1C7S0_SOLTU, PGSC0003DMT400061600) and FPS1 (M1CX22_SOLTU, PGSC0003DMT400076602) (Figure 5). Moreover, this gene was up-regulated ~4-fold (2.013 Log2-scale) with respect to the control conditions (Figure 5 and Figure 2b). HMG1/HMGR3 catalyzes the conversion of HMG-CoA to MVA [34] and three HGMR genes have been characterized in the cultivated potato species [35]. It is worth noting that MVA biosynthesis is activated in darkness and is negatively regulated by light, as well as the transcriptional activities of HMG1/HMGR3, CAS1, and SMT1. However, HMG1/HMGR3 transcriptional activity is also induced in darkness, as we have shown in our microtuberization protocol and the respective transcriptomics data set obtained [32,36,37,38]. Moreover, HMG1 is directly involved in flowering regulation, fruit size regulation in early development, cellular development and proliferation, and defense response activation against pathogens [18,39,40,41]. Dwarf potato plants were produced by the overexpression of StHMGR3, with unbalanced PS levels (cycloartenol, sitosterol, and stigmasterol), and were rescued by the overexpression of StFPS1/StHMGR3. Potato plants were phenotypically normal, with delayed flowering, higher total biomass, and tuber weight [18].

MVD2 executes the initial step in the production of isoprene-containing compounds, including PS and terpenoids. It is also a rate-limiting enzyme in the MVA pathway that synthesizes isopentenyl diphosphate (IPP) from mevalonate 5-diphosphate, which is the universal precursor of isoprenoids (IPP) [42,43]. In turn, FPS1 interacts with CAS1 (M1CST0_SOLTU, PGSC0003DMT400073861) (Figure 4), which carries out the conversion of 2,3-oxidosqualene to cycloartenol, leading this compound to the main PS synthesis (campesterol, sitosterol, and stigmasterol) in higher plants [44]. Furthermore, CAS1 is directly involved in the regulation of chlorophyll synthesis, cell division cycle regulation, cellular proliferation, and the regulation of cellular growth, development, and differentiation [16].

CAS1 interacts with SMO1 (M1AYT4_SOLTU, PGSC0003DMT400033236) and HSD1/3BHSD/D2 (M1AB90_SOLTU, PGSC0003DMT400018853) (Figure 5). SMO1 carries out the production of 4a-carboxy-sterol and is directly involved in the embryogenesis process regulation, cellular differentiation, cell cycle division, and establishment of shoot apical meristem [45,46]. HSD1/3BHSD/D2 carries out the synthesis of 3-oxosteroid and is responsible for the allosteric regulation of this biosynthetic process [45].

SMO1 also interacts with CPI1 (M1A0D5_SOLTU, PGSC0003DMT400011907) (Figure 5). CPI1 is a key enzyme that catalyzes the breaking of the 9β,19-cyclopropane ring of the 4α-methyl-cyclopropylsterol cycloeucalenol, resulting in the formation of the Δ8-sterol obtusifoliol [47]. CPI is directly involved in the regulation of the cellular differentiation process, gametophyte formation, stomal differentiation and development [48], chlorophyll allocation, and root gravitropism [49].

In turn, CPI1 interacts with CYP51 (M1BCS3_SOLTU, PGSC0003DMT400042257) (Figure 4 and Figure 5). CYP51 is a member of the cytochrome P450 monooxygenases super-family and regulates an essential step in plant PS biosynthesis and has remained very well conserved throughout the evolution of eukaryotes [50,51]. CYP51 is directly involved in cell membrane formation and grain and fruit development [52], flowering process regulation, and pollen fertility [53]. Moreover, CYP51 interacts with FACKEL/FK (M0ZSD2_SOLTU, PGSC0003DMT400007043) and SI1/HYD1 (SI1, PGSC0003DMT400071184) (Figure 4 and Figure 5). FACKEL is directly involved in the regulation of embryo development [12,13], the cellular differentiation process, and regulates cytokinin and ethylene signaling [54]. CYP51 interacts with SI1/HYD1 (Figure 4 and Figure 5). SI1/HYD1 conducts the synthesis of 24-methylenelophenol, is directly involved in root and vascular growth [14], differentiation, patterning, and development [55], and drives the polar auxin transport machinery [5].

Furthermore, SI1/HYD1 interacts with SMT2 (M1BLQ0_SOLTU, PGSC0003DMT400047969) and SMO2 (M0ZQ08_SOLTU, PGSC0003DMT400005519) (Figure 4 and Figure 5).

SMT2 is an important regulatory branch point to yield 24-ethylidenlophenol and sitosterol [56] and regulates the concentration ratios among 24-methyl and 24-ethyl sterol [57,58], playing an important role in the regulation of cell growth [12], embryogenic development [13], and proliferation. Additionally, it is involved in responding to abiotic stress and has a direct impact on BRs synthesis [59].

SMO2 carries out the synthesis of Δ7-avenasterol and plays a crucial role in both the embryonic and postembryonic development processes and auxin homeostasis [60].

Also, SMO2 interacts with STE1/DWF7 (M1CI11_SOLTU, PGSC0003DMT400067881) (Figure 4 and Figure 5). STE1 mediates the synthesis of 5-dehydroepisterol and 5-dehydroavenasterol [61,62] and is directly involved in the regulation of cell proliferation and elongation and BR synthesis regulation [62].

Finally, STE1/DWF7 interacts with SSR1/DWF1 (SSR1/DWF1, PGSC0003DMT400054476) (Figure 4 and Figure 5). SSR1/DWF1 performs the synthesis of the precursor of the phytohormone brassinolide [63] and, in turn, regulates the brassinolide content, accumulation, and allocation, and regulates cellular proliferation, elongation, and differentiation [64,65].

From the data set analyzed, the DEG and qPCR transcriptional expression levels of the essential regulatory genes of the MVA-related and PS biosynthesis pathway, coupled with the PPI, all together converge in the regulatory model establishment of MTs development under a high content of sucrose/gelrite, 2-iP, and darkness conditions, as shown in Figure 7. We have found that a mix of sterols (sitosterol, stigmasterol, and campesterol) at 200 μM increases both the number and size of MTs. Furthermore, after three weeks of incubation in darkness, we observed an inhibition of MTs when we used an inhibitor of sterol biosynthesis, terbinafine, at 5 mg/L. Taken all together, sterols play a crucial role during the microtuberization process. In this model, we have analyzed the genes FACKEL, HYDRA1, SMT1, CYP51, and SMO1, which are expressed in the shoot apex meristem to differentiate a tuber. FACKEL, HYDRA1, SMT1, SMT2, SSR1, STE1, and SMO1 activate a further differentiation of the tuber internal tissues, leading to the development of cambium, xylem, phloem, and starch storage parenchyma. HYDRA1 and CPI1 promote the development of protoderm and ground meristems.

Figure 7.

Figure 7

Potato Solanum tuberosum L. MTs development is enhanced by the modulation of the MVA and PS biosynthesis pathways in osmotic stress, 2-iP supplementation, and darkness conditions.

4. Materials and Methods

4.1. Plant Material and MTs Induction

MTs induction was carried out according to Valencia-Lozano et al. (2022) [32]. In brief, potato S. tuberosum cv alpha stolon explants were cultured in the induction medium MR8-G6-2-iP (8% w/v sucrose, 6 g/L of gelrite, 10 mg/L of 2-iP, and 0.3% w/v activated charcoal). The control medium utilized was MR1-G3-2-iP (1% w/v sucrose, 3 g/L of gelrite, 10 mg/L of 2-iP, and 0.3% w/v activated charcoal). Containers were kept in darkness at 25 °C/17 °C for 15 days. The MTs were then collected, frozen in liquid nitrogen, and subsequently stored at −80 °C for preservation. The study employed five biological replicates for both the treatment and control groups.

4.2. Isolation of RNA, qPCR, and Transcriptome Sequencing

Total RNA was isolated using the Trizol reagent (Invitrogen, Carlsbad, CA, USA). The RNA concentration was measured by its absorbance at 260 nm, and the 260 nm/280 nm absorbance ratio was evaluated. The RNA integrity was verified through 2% (w/v) agarose gel electrophoresis. The cDNA samples were amplified with SYBR™ Green (ThermoFisher CAT: 4312704, Waltham, MA, USA) in Real-Time PCR Systems (CFX96 BioRad, Hercules, CA, USA).

The cDNA samples were sequenced using the Illumina HiSeq 4000 platform (Illumina, San Diego, CA, USA). The quality of the sequenced reads was checked with the FastQC v0.11.3 software package (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/; accessed on 15 March 2023), and the reads were processed to remove sequence adapters and low-quality bases using Trimmomatics (v0.39; accessed on 16 March 2023) [66].

4.3. Analysis of DEG and Interaction Analysis of PS Enzymes

The RNAseq reads were aligned to the S. tuberosum reference genome available in Phytozome v12.1. (https://phytozome.jgi.doe.gov/pz/portal.html; accessed on 15 March 2023) using the STAR aligner v.2.5.2b [67]. This process generated BAM (Binary Alignment/Map) files, and transcript read counts were obtained using the featureCounts program from the Subread v.1.5.2 package [68]. The DESeq2 v1.12.4 tool was used to estimate the differentially expressed genes [69], and the transcript ontology analysis study was conducted via Blast2GO. V6.0 (https://www.blast2go.com/; accessed on 8 April 2023).

A gene network was constructed using STRING [70] with a confidence score of 0.800, incorporating homologous genes from the S. tuberosum genome in the Sol Genomics Network. Gene identifiers (Id) were based on the UNIPROT [71] and NCBI databases [72]. Protein sequences in S. tuberosum that have a similarity of above 60% with A. thaliana were considered.

4.4. Transcriptional Analysis through qPCR of Genes Involved in PS Biosynthesis

The set of genes for qPCR analysis is outlined in Table 2. EF1 and SEC3 expression levels were used as references to determine the relative expression of target genes using the 2−∆∆CT method [73]. Five biological replicates were analyzed for each sample, with three technical replicates performed for each biological replicate during qPCR analysis.

Table 2.

Primer-set from PS biosynthetic process DEGs used to validate their expression levels.

ID String v.12 ID NCBI Forward Reverse
M1BCS3_SOLTU CYP51 XM_006348474.2 CATACAGGCAAGGCAGAGAA AGAGCAGCAATCAGAAGACC
M1C7G1_SOLTU FD XM_006361882.2 GAAAGCAGGCTTACACGAATG GAAGTAGAGCACCAGCTGAA
M0ZSD2_SOLTU FACKEL XM_006341108.2 AAGACGTGTGGGCTGAATAC TACGGTACGGTGAGGCTAAT
M1CX22_SOLTU FPS1 XM_006344841.2 GGAGGTGTACTCTGTGCTTAAA GATAGTCCTCGATTCAGCTTCC
SI1 SI1 NM_001288433.1 CACATGGTCCTTGAGGGATATT CTCGGCCTACGTATCTTGAATC
M1A996_SOLTU SMT1 XM_015310447.1 CTAAACCGTATTGGCGGAATTG GGGCATGACATGTAGCTTCTA
M1BLQ0_SOLTU SMT2 XM_006364446.2 CCCAATGGATTCTCTCACTCTC GCCCGTTTACCCTTAACCT
StSP6A StSP6A XM_006365395.2 GGGAAACCTTTGGCAATGAAG CCCAATTGCTGGAACAACAC
M1A0D5_SOLTU CPI1 XM_015309779.1 GCAACACCTAGTCTGTGGTTAG CACAACACCAAGGCACAAAG
HMG3 HMG1 XP_015159610.1 GCGACCTGTTAAGCCTCTATAC CAACCCAGTGGTTAGGTACAA

5. Conclusions

The MTs’ development was enhanced by osmotic stress, 2-iP supplementation, and darkness conditions, and the mechanism might be attributed to the orchestration of the MVA-related and PS biosynthesis genes pathways as follows: HMG1/HMGR3 and FPS1 (MVA-related pathway) activate the expression of the tuberigen StSP6A and the transcription factor FD, thereby causing potato tuber formation.

The MVA-related pathway is activated under darkness, providing MVA and IPP to balance the major plant PS (sitosterol, stigmasterol, and campesterol). PS biosynthetic gene modulations of FACKEL, SI1/HYD1, SMT1, CYP51, and SMO1 orchestrate and promote the establishment of the architecture of the apical meristem in the first developmental stages of tuber differentiation and in the vascular tissue’s development. SI1/HYDRA1 and CPI1 positively regulate the protoderm and the development, positively influencing the microtuberization enhancement process of potato.

Acknowledgments

We thank Eduardo Fidel Martínez-Paz and Alex Ricardo Bermúdez-Valle for their academic discussions during the writing of the manuscript.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants13172391/s1, Table S1: Number of interactions and combined score values calculated for interactions between up-regulated genes of PS biosynthesis pathway.

plants-13-02391-s001.zip (140.5KB, zip)

Author Contributions

L.H.-I. and E.V.-L.: Conceptualization, methodology, original draft preparation, and funding acquisition; B.U.-L.: performed experiments as bachelor student; A.B.: methodology, software, validation, and investigation; J.P.D.-F.: review and editing; J.L.C.-P.: conceptualization, formal analysis, investigation, data curation, writing—review and editing, and supervision. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

Funding Statement

This research was funded, in part, by SIP IPN projects 20242858 and 20242617.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Diener A.C., Li H., Zhou W., Whoriskey W.J., Nes W.D., Fink G.R. STEROL METHYLTRANSFERASE 1 Controls the Level of Cholesterol in Plants. Plant Cell. 2000;12:853–870. doi: 10.1105/tpc.12.6.853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Piironen V., Lindsay D.G., Miettinen T.A., Toivo J., Lampi A.-M. Plant Sterols: Biosynthesis, Biological Function and Their Importance to Human Nutrition. J. Sci. Food Agric. 2000;80:939–966. doi: 10.1002/(SICI)1097-0010(20000515)80:7<939::AID-JSFA644>3.0.CO;2-C. [DOI] [Google Scholar]
  • 3.Hartmann M. Plant Sterols and the Membrane Environment. Trends Plant Sci. 1998;3:170–175. doi: 10.1016/S1360-1385(98)01233-3. [DOI] [Google Scholar]
  • 4.Simons K., Toomre D. Lipid Rafts and Signal Transduction. Nat. Rev. Mol. Cell Biol. 2000;1:31–39. doi: 10.1038/35036052. [DOI] [PubMed] [Google Scholar]
  • 5.Souter M., Topping J., Pullen M., Friml J., Palme K., Hackett R., Grierson D., Lindsey K. Hydra Mutants of Arabidopsis Are Defective in Sterol Profiles and Auxin and Ethylene Signaling. Plant Cell. 2002;14:1017–1031. doi: 10.1105/tpc.001248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Peng L., Kawagoe Y., Hogan P., Delmer D. Sitosterol-β-Glucoside as Primer for Cellulose Synthesis in Plants. Science. 2002;295:147–150. doi: 10.1126/science.1064281. [DOI] [PubMed] [Google Scholar]
  • 7.Schrick K., DeBolt S., Bulone V. Deciphering the Molecular Functions of Sterols in Cellulose Biosynthesis. Front. Plant Sci. 2012;3:25882. doi: 10.3389/fpls.2012.00084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Schrick K., Fujioka S., Takatsuto S., Stierhof Y., Stransky H., Yoshida S., Jürgens G. A Link between Sterol Biosynthesis, the Cell Wall, and Cellulose in Arabidopsis. Plant J. 2004;38:227–243. doi: 10.1111/j.1365-313X.2004.02039.x. [DOI] [PubMed] [Google Scholar]
  • 9.Hu Y., Bao F., Li J. Promotive Effect of Brassinosteroids on Cell Division Involves a Distinct CycD3 -induction Pathway in Arabidopsis. Plant J. 2000;24:693–701. doi: 10.1046/j.1365-313x.2000.00915.x. [DOI] [PubMed] [Google Scholar]
  • 10.Carland F., Fujioka S., Nelson T. The Sterol Methyltransferases SMT1, SMT2, and SMT3 Influence Arabidopsis Development through Nonbrassinosteroid Products. Plant Physiol. 2010;153:741–756. doi: 10.1104/pp.109.152587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mayer U., Ruiz R.A.T., Berleth T., Miséra S., Jürgens G. Mutations Affecting Body Organization in the Arabidopsis Embryo. Nature. 1991;353:402–407. doi: 10.1038/353402a0. [DOI] [Google Scholar]
  • 12.Schrick K., Mayer U., Horrichs A., Kuhnt C., Bellini C., Dangl J., Schmidt J., Jürgens G. FACKEL Is a Sterol C-14 Reductase Required for Organized Cell Division and Expansion in Arabidopsis Embryogenesis. Genes Dev. 2000;14:1471–1484. doi: 10.1101/gad.14.12.1471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jang J.-C., Fujioka S., Tasaka M., Seto H., Takatsuto S., Ishii A., Aida M., Yoshida S., Sheen J. A Critical Role of Sterols in Embryonic Patterning and Meristem Programming Revealed by the Fackel Mutants of Arabidopsis thaliana. Genes Dev. 2000;14:1485–1497. doi: 10.1101/gad.14.12.1485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pullen M., Clark N., Zarinkamar F., Topping J., Lindsey K. Analysis of Vascular Development in the Hydra Sterol Biosynthetic Mutants of Arabidopsis. PLoS ONE. 2010;5:e12227. doi: 10.1371/journal.pone.0012227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Douglas T.J., Paleg L.G. Inhibition of Sterol Biosynthesis and Stem Elongation of Tobacco Seedlings Induced by Some Hypocholesterolemic Agents. J. Exp. Bot. 1981;32:59–68. doi: 10.1093/jxb/32.1.59. [DOI] [Google Scholar]
  • 16.Babiychuk E., Bouvier-Navé P., Compagnon V., Suzuki M., Muranaka T., Van Montagu M., Kushnir S., Schaller H. Allelic Mutant Series Reveal Distinct Functions for Arabidopsis Cycloartenol Synthase 1 in Cell Viability and Plastid Biogenesis. Proc. Natl. Acad. Sci. USA. 2008;105:3163–3168. doi: 10.1073/pnas.0712190105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hong Z., Ueguchi-Tanaka M., Fujioka S., Takatsuto S., Yoshida S., Hasegawa Y., Ashikari M., Kitano H., Matsuoka M. The Rice Brassinosteroid-Deficient Dwarf2 Mutant, Defective in the Rice Homolog of Arabidopsis DIMINUTO/DWARF1, Is Rescued by the Endogenously Accumulated Alternative Bioactive Brassinosteroid, Dolichosterone. Plant Cell. 2005;17:2243–2254. doi: 10.1105/tpc.105.030973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Moehninsi, Lange I., Lange B.M., Navarre D.A. Altering Potato Isoprenoid Metabolism Increases Biomass and Induces Early Flowering. J. Exp. Bot. 2020;71:4109–4124. doi: 10.1093/jxb/eraa185. [DOI] [PubMed] [Google Scholar]
  • 19.Huang S., Zheng C., Zhao Y., Li Q., Liu J., Deng R., Lei T., Wang S., Wang X. RNA Interference Knockdown of the Brassinosteroid Receptor BRI1 in Potato (Solanum tuberosum L.) Reveals Novel Functions for Brassinosteroid Signaling in Controlling Tuberization. Sci. Hortic. 2021;290:110516. doi: 10.1016/j.scienta.2021.110516. [DOI] [Google Scholar]
  • 20.Schuler I., Milon A., Nakatani Y., Ourisson G., Albrecht A.M., Benveniste P., Hartman M.A. Differential Effects of Plant Sterols on Water Permeability and on Acyl Chain Ordering of Soybean Phosphatidylcholine Bilayers. Proc. Natl. Acad. Sci. USA. 1991;88:6926–6930. doi: 10.1073/pnas.88.16.6926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Grandmougin-Ferjani A., Schuler-Muller I., Hartmann M.A. Sterol Modulation of the Plasma Membrane H+-ATPase Activity from Corn Roots Reconstituted into Soybean Lipids. Plant Physiol. 1997;113:163–174. doi: 10.1104/pp.113.1.163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Schrick K., Mayer U., Martin G., Bellini C., Kuhnt C., Schmidt J., Jürgens G. Interactions between Sterol Biosynthesis Genes in Embryonic Development of Arabidopsis. Plant J. 2002;31:61–73. doi: 10.1046/j.1365-313X.2002.01333.x. [DOI] [PubMed] [Google Scholar]
  • 23.Lindsey K., Pullen M.L., Topping J.F. Importance of Plant Sterols in Pattern Formation and Hormone Signalling. Trends Plant Sci. 2003;8:521–525. doi: 10.1016/j.tplants.2003.09.012. [DOI] [PubMed] [Google Scholar]
  • 24.Closa M., Vranová E., Bortolotti C., Bigler L., Arró M., Ferrer A., Gruissem W. The Arabidopsis thaliana FPP Synthase Isozymes Have Overlapping and Specific Functions in Isoprenoid Biosynthesis, and Complete Loss of FPP Synthase Activity Causes Early Developmental Arrest: Arabidopsis thaliana FPP Synthase Mutants. Plant J. 2010;63:512–525. doi: 10.1111/j.1365-313X.2010.04253.x. [DOI] [PubMed] [Google Scholar]
  • 25.Zhu W.J., Chen F., Li P.P., Chen Y.M., Chen M., Yang Q. Identification and Characterization of Brassinosteroid Biosynthesis and Signaling Pathway Genes in Solanum Tuberosum. Russ. J. Plant Physiol. 2019;66:628–636. doi: 10.1134/S1021443719040186. [DOI] [Google Scholar]
  • 26.Arnqvist L., Dutta P.C., Jonsson L., Sitbon F. Reduction of Cholesterol and Glycoalkaloid Levels in Transgenic Potato Plants by Overexpression of a Type 1 Sterol Methyltransferase cDNA. Plant Physiol. 2003;131:1792–1799. doi: 10.1104/pp.102.018788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kärenlampi S.O., White P.J. Advances in Potato Chemistry and Technology. Elsevier; Amsterdam, The Netherlands: Academic Press; Cambridge, MA, USA: 2009. Potato proteins, lipids, and minerals; pp. 99–125. [DOI] [Google Scholar]
  • 28.Nahar N., Westerberg E., Arif U., Huchelmann A., Olarte Guasca A., Beste L., Dalman K., Dutta P.C., Jonsson L., Sitbon F. Transcript Profiling of Two Potato Cultivars during Glycoalkaloid-Inducing Treatments Shows Differential Expression of Genes in Sterol and Glycoalkaloid Metabolism. Sci. Rep. 2017;7:43268. doi: 10.1038/srep43268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lichtenthaler H.K., Rohmer M., Schwender J. Two Independent Biochemical Pathways for Isopentenyl Diphosphate and Isoprenoid Biosynthesis in Higher Plants. Physiol. Plant. 1997;101:643–652. doi: 10.1111/j.1399-3054.1997.tb01049.x. [DOI] [Google Scholar]
  • 30.Krits P., Fogelman E., Ginzberg I. Potato Steroidal Glycoalkaloid Levels and the Expression of Key Isoprenoid Metabolic Genes. Planta. 2007;227:143–150. doi: 10.1007/s00425-007-0602-3. [DOI] [PubMed] [Google Scholar]
  • 31.Zhao D.-K., Zhao Y., Chen S.-Y., Kennelly E.J. Solanum Steroidal Glycoalkaloids: Structural Diversity, Biological Activities, and Biosynthesis. Nat. Prod. Rep. 2021;38:1423–1444. doi: 10.1039/D1NP00001B. [DOI] [PubMed] [Google Scholar]
  • 32.Valencia-Lozano E., Herrera-Isidrón L., Flores-López J.A., Recoder-Meléndez O.S., Barraza A., Cabrera-Ponce J.L. Solanum Tuberosum Microtuber Development under Darkness Unveiled through RNAseq Transcriptomic Analysis. Int. J. Mol. Sci. 2022;23:13835. doi: 10.3390/ijms232213835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gray J.C. Control of Isoprenoid Biosynthesis in Higher Plants. Adv. Bot. Res. 1988;14:25–91. doi: 10.1016/S0065-2296(08)60270-0. [DOI] [Google Scholar]
  • 34.Bach T.J., Boronat A., Campos N., Ferrer A., Vollack K.-U. Mevalonate Biosynthesis in Plants. Crit. Rev. Biochem. Mol. Biol. 1999;34:107–122. doi: 10.1080/10409239991209237. [DOI] [PubMed] [Google Scholar]
  • 35.Yang Z., Park H., Lacy G.H., Cramer C.L. Differential Activation of Potato 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Genes by Wounding and Pathogen Challenge. Plant Cell. 1991;3:397–405. doi: 10.1105/tpc.3.4.397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Learned R.M. Light Suppresses 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Gene Expression in Arabidopsis thaliana. Plant Physiol. 1996;110:645–655. doi: 10.1104/pp.110.2.645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kim Y.-J., Lee O.R., Oh J.Y., Jang M.-G., Yang D.-C. Functional Analysis of 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Encoding Genes in Triterpene Saponin-Producing Ginseng. Plant Physiol. 2014;165:373–387. doi: 10.1104/pp.113.222596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Valencia-Lozano E., Herrera-Isidrón L., Flores-López J.A., Recoder-Meléndez O.S., Uribe-López B., Barraza A., Cabrera-Ponce J.L. Exploring the Potential Role of Ribosomal Proteins to Enhance Potato Resilience in the Face of Changing Climatic Conditions. Genes. 2023;14:1463. doi: 10.3390/genes14071463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Choi D., Ward B.L., Bostock R.M. Differential Induction and Suppression of Potato 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Genes in Response to Phytophthora Infestans and to Its Elicitor Arachidonic Acid. Plant Cell. 1992;4:1333–1344. doi: 10.1105/tpc.4.10.1333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Korth K.L., Stermer B.A., Bhattacharyya M.K., Dixon R.A. HMG-CoA Reductase Gene Families That Differentially Accumulate Transcripts in Potato Tubers Are Developmentally Expressed in Floral Tissues. Plant Mol. Biol. 1997;33:545–551. doi: 10.1023/A:1005743011651. [DOI] [PubMed] [Google Scholar]
  • 41.Kobayashi T., Kato-Emori S., Tomita K., Ezura H. Detection of 3-Hydroxy-3-Methylglutaryl-Coenzyme A Reductase Protein Cm-HMGR during Fruit Development in Melon (Cucumis melo L.) Theor. Appl. Genet. 2002;104:779–785. doi: 10.1007/s00122-001-0838-4. [DOI] [PubMed] [Google Scholar]
  • 42.Cordier H., Karst F., Bergès T. Heterologous Expression in Saccharomyces Cerevisiae of an Arabidopsis thaliana cDNA Encoding Mevalonate Diphosphate Decarboxylase. Plant Mol. Biol. 1999;39:953–967. doi: 10.1023/A:1006181720100. [DOI] [PubMed] [Google Scholar]
  • 43.Cunillera N., Arró M., Delourme D., Karst F., Boronat A., Ferrer A. Arabidopsis thaliana Contains Two Differentially Expressed Farnesyl-Diphosphate Synthase Genes. J. Biol. Chem. 1996;271:7774–7780. doi: 10.1074/jbc.271.13.7774. [DOI] [PubMed] [Google Scholar]
  • 44.Corey E.J., Matsuda S.P., Bartel B. Isolation of an Arabidopsis thaliana Gene Encoding Cycloartenol Synthase by Functional Expression in a Yeast Mutant Lacking Lanosterol Synthase by the Use of a Chromatographic Screen. Proc. Natl. Acad. Sci. USA. 1993;90:11628–11632. doi: 10.1073/pnas.90.24.11628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Rondet S., Taton M., Rahier A. Identification, Characterization, and Partial Purification of 4α-Carboxysterol–C3-Dehydrogenase/ C4-Decarboxylase from Zea mays. Arch. Biochem. Biophys. 1999;366:249–260. doi: 10.1006/abbi.1999.1218. [DOI] [PubMed] [Google Scholar]
  • 46.Song J., Sun S., Ren H., Grison M., Boutté Y., Bai W., Men S. The SMO1 Family of Sterol 4α-Methyl Oxidases Is Essential for Auxin- and Cytokinin-Regulated Embryogenesis. Plant Physiol. 2019;181:578–594. doi: 10.1104/pp.19.00144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Lovato M.A., Hart E.A., Segura M.J.R., Giner J.-L., Matsuda S.P.T. Functional Cloning of an Arabidopsis thaliana cDNA Encoding Cycloeucalenol Cycloisomerase. J. Biol. Chem. 2000;275:13394–13397. doi: 10.1074/jbc.275.18.13394. [DOI] [PubMed] [Google Scholar]
  • 48.Qian P., Han B., Forestier E., Hu Z., Gao N., Lu W., Schaller H., Li J., Hou S. Sterols Are Required for Cell-fate Commitment and Maintenance of the Stomatal Lineage in A. rabidopsis. Plant J. 2013;74:1029–1044. doi: 10.1111/tpj.12190. [DOI] [PubMed] [Google Scholar]
  • 49.Men S., Boutté Y., Ikeda Y., Li X., Palme K., Stierhof Y.D., Hartmann M.A., Moritz T., Grebe M. Sterol-dependent endocytosis mediates post-cytokinetic acquisition of PIN2 auxin efflux carrier polarity. Nat. Cell Biol. 2008;10:237–244. doi: 10.1038/ncb1686. [DOI] [PubMed] [Google Scholar]
  • 50.Lamb D.C., Kelly D.E., Kelly S.L. Molecular Diversity of Sterol 14α-demethylase Substrates in Plants, Fungi and Humans. FEBS Letters. 1998;425:263–265. doi: 10.1016/S0014-5793(98)00247-6. [DOI] [PubMed] [Google Scholar]
  • 51.Kushiro M., Nakano T., Sato K., Yamagishi K., Asami T., Nakano A., Takatsuto S., Fujioka S., Ebizuka Y., Yoshida S. Obtusifoliol 14α-Demethylase (CYP51) Antisense Arabidopsis Shows Slow Growth and Long Life. Biochem. Biophys, Res. Commun. 2001;285:98–104. doi: 10.1006/bbrc.2001.5122. [DOI] [PubMed] [Google Scholar]
  • 52.Kim H.B., Schaller H., Goh C.-H., Kwon M., Choe S., An C.S., Durst F., Feldmann K.A., Feyereisen R. Arabidopsis Cyp51 Mutant Shows Postembryonic Seedling Lethality Associated with Lack of Membrane Integrity. Plant Physiol. 2005;138:2033–2047. doi: 10.1104/pp.105.061598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Jiao Z., Yin L., Zhang Q., Xu W., Jia Y., Xia K., Zhang M. The Putative Obtusifoliol 14α-demethylase OSCYP51H3 Affects Multiple Aspects of Rice Growth and Development. Physiol. Plant. 2022;174:e13764. doi: 10.1111/ppl.13764. [DOI] [PubMed] [Google Scholar]
  • 54.He J.-X., Fujioka S., Li T.-C., Kang S.G., Seto H., Takatsuto S., Yoshida S., Jang J.-C. Sterols Regulate Development and Gene Expression in Arabidopsis. Plant Physiol. 2003;131:1258–1269. doi: 10.1104/pp.014605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Topping J.F., May V.J., Muskett P.R., Lindsey K. Mutations in the HYDRA1 Gene of Arabidopsis Perturb Cell Shape and Disrupt Embryonic and Seedling Morphogenesis. Development. 1997;124:4415–4424. doi: 10.1242/dev.124.21.4415. [DOI] [PubMed] [Google Scholar]
  • 56.Bouvier-Navé P., Husselstein T., Benveniste P. Two Families of Sterol Methyltransferases Are Involved in the First and the Second Methylation Steps of Plant Sterol Biosynthesis. Eur. J. Biochem. 1998;256:88–96. doi: 10.1046/j.1432-1327.1998.2560088.x. [DOI] [PubMed] [Google Scholar]
  • 57.Schaeffer A., Bronner R., Benveniste P., Schaller H. The Ratio of Campesterol to Sitosterol That Modulates Growth in Arabidopsis Is Controlled by STEROL METHYLTRANSFERASE 2;1. Plant J. 2001;25:605–615. doi: 10.1046/j.1365-313x.2001.00994.x. [DOI] [PubMed] [Google Scholar]
  • 58.Schaller H. The Role of Sterols in Plant Growth and Development. Prog. Lipid Res. 2003;42:163–175. doi: 10.1016/S0163-7827(02)00047-4. [DOI] [PubMed] [Google Scholar]
  • 59.Neelakandan A.K., Song Z., Wang J., Richards M.H., Wu X., Valliyodan B., Nguyen H.T., Nes W.D. Cloning, Functional Expression and Phylogenetic Analysis of Plant Sterol 24C-Methyltransferases Involved in Sitosterol Biosynthesis. Phytochemistry. 2009;70:1982–1998. doi: 10.1016/j.phytochem.2009.09.003. [DOI] [PubMed] [Google Scholar]
  • 60.Zhang X., Sun S., Nie X., Boutté Y., Grison M., Li P., Kuang S., Men S. Sterol Methyl Oxidases Affect Embryo Development via Auxin-Associated Mechanisms. Plant Physiol. 2016;171:468–482. doi: 10.1104/pp.15.01814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Gachotte D., Husselstein T., Bard M., Lacroute F., Benveniste P. Isolation and Characterization of an Arabidopsis thaliana cDNA Encoding a Δ 7 -sterol-C-5-desaturase by Functional Complementation of a Defective Yeast Mutant. Plant J. 1996;9:391–398. doi: 10.1046/j.1365-313X.1996.09030391.x. [DOI] [PubMed] [Google Scholar]
  • 62.Choe S., Noguchi T., Fujioka S., Takatsuto S., Tissier C.P., Gregory B.D., Ross A.S., Tanaka A., Yoshida S., Tax F.E., et al. The Arabidopsis Dwf7/Ste1 Mutant Is Defective in the Δ 7 Sterol C-5 Desaturation Step Leading to Brassinosteroid Biosynthesis. Plant Cell. 1999;11:207–221. doi: 10.1105/tpc.11.2.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Sawai S., Ohyama K., Yasumoto S., Seki H., Sakuma T., Yamamoto T., Takebayashi Y., Kojima M., Sakakibara H., Aoki T., et al. Sterol Side Chain Reductase 2 Is a Key Enzyme in the Biosynthesis of Cholesterol, the Common Precursor of Toxic Steroidal Glycoalkaloids in Potato. Plant Cell. 2014;26:3763–3774. doi: 10.1105/tpc.114.130096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Klahre U., Noguchi T., Fujioka S., Takatsuto S., Yokota T., Nomura T., Yoshida S., Chua N.-H. The Arabidopsis DIMINUTO/DWARF1 Gene Encodes a Protein Involved in Steroid Synthesis. Plant Cell. 1998;10:1677–1690. doi: 10.1105/tpc.10.10.1677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Kauschmann A., Jessop A., Koncz C., Szekeres M., Willmitzer L., Altmann T. Genetic Evidence for an Essential Role of Brassinosteroids in Plant Development. Plant J. 1996;9:701–713. doi: 10.1046/j.1365-313X.1996.9050701.x. [DOI] [Google Scholar]
  • 66.Bolger A.M., Lohse M., Usadel B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Dobin A., Davis C.A., Schlesinger F., Drenkow J., Zaleski C., Jha S., Batut P., Chaisson M., Gingeras T.R. STAR: Ultrafast Universal RNA-Seq Aligner. Bioinformatics. 2013;29:15–21. doi: 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Liao Y., Smyth G.K., Shi W. featureCounts: An Efficient General Purpose Program for Assigning Sequence Reads to Genomic Features. Bioinformatics. 2014;30:923–930. doi: 10.1093/bioinformatics/btt656. [DOI] [PubMed] [Google Scholar]
  • 69.Love M.I., Huber W., Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Szklarczyk D., Franceschini A., Wyder S., Forslund K., Heller D., Huerta-Cepas J., Simonovic M., Roth A., Santos A., Tsafou K.P., et al. STRING V10: Protein–Protein Interaction Networks, Integrated over the Tree of Life. Nucleic Acids Res. 2015;43:D447–D452. doi: 10.1093/nar/gku1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.The UniProt Consortium. Bateman A., Martin M.-J., Orchard S., Magrane M., Agivetova R., Ahmad S., Alpi E., Bowler-Barnett E.H., Britto R., et al. UniProt: The Universal Protein Knowledgebase in 2021. Nucleic Acids Res. 2021;49:D480–D489. doi: 10.1093/nar/gkaa1100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Sherry S.T. dbSNP: The NCBI Database of Genetic Variation. Nucleic Acids Res. 2001;29:308–311. doi: 10.1093/nar/29.1.308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Livak K.J., Schmittgen T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

plants-13-02391-s001.zip (140.5KB, zip)

Data Availability Statement

Data are contained within the article and Supplementary Materials.


Articles from Plants are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES