Nasal Carriage, Antimicrobial Susceptibility Profile, and Enterotoxin Genes of Staphylococcus aureus Isolated from Children with Asthma

Abstract

Asthma is a chronic respiratory disease that affects children worldwide. Increasing evidence suggests that Staphylococcus aureus contributes to the pathology of asthma. The aim of this study was to evaluate the nasal carriage, antimicrobial susceptibility profile, and presence of enterotoxin genes from S. aureus isolated from children with asthma. Nasal swab samples were collected from 158 children, including 98 children with asthma and 60 healthy controls. S. aureus isolates were identified using phenotypic methods and the presence of the nuc gene. Antimicrobial susceptibility testing was performed using the Kirby-Bauer disc diffusion method. Polymerase chain reaction (PCR) confirmed the presence of the mecA gene and enterotoxin genes. The nuc gene was confirmed in 83 isolates, resulting in a nasal carriage of 52.5% (83/158). The nasal carriage of S. aureus was higher among asthma cases (72.4%), with a significant association of S. aureus nasal carriage observed among asthma cases (OR 0.201, 95% CI 0.063–0.645, p = 0.007). Methicillin-resistant S. aureus (MRSA) nasal carriage was 11.4%. The S. aureus isolates showed high resistance to cefoxitin (99%) and penicillin (92%) but were sensitive to gentamicin (25%). Furthermore, 67.5% of the isolates were multi-drug resistant. The staphylococcal enterotoxin c gene (sec) was the most prevalent enterotoxin (19.7%) among cases and controls. These findings highlight the need for improved antibiotic stewardship in paediatric medicine and implementation of infection control policies.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12088-024-01272-z.

Introduction

According to the World Health Organisation (WHO), approximately 334 million people have asthma worldwide, with more than 300,000 deaths recorded annually and the number of asthmatic patients is predicted to be 400 million by 2025 [1].

Staphylococcus aureus is a non-motile, Gram-positive bacterium that colonises the anterior nares. Although there is growing evidence that nasal S. aureus colonisation increases the risk and contributes to the pathogenesis of chronic respiratory diseases and allergies, the mechanisms by which it induces inflammation are not fully understood [2–5]. Staphylococcal enterotoxins have been associated with asthma, specifically with staphylococcal enterotoxin-specific IgE correlating with increased asthma severity [6, 7].

Current methods for detecting IgE antibodies against enterotoxins produced by S. aureus include immunoassays for the specific detection of staphylococcal enterotoxins using monoclonal and polyclonal antibodies [8–11] and PCR-based techniques [12, 13]. Furthermore, monoclonal antibodies have been used in developing immunochromatographic assays [14, 15] and fluoroimmunoassays [16, 17] for the simultaneous detection of staphylococcal enterotoxins.

These methods however have limitations; they may not be very sensitive [18], and they may not account for the non-IgE-mediated mechanisms of S. aureus-induced inflammation. [19, 20]. Therefore, a better understanding of other virulence mechanisms used by S. aureus to trigger inflammation and the factors that influence its pathogenicity is needed. Moreover, S. aureus infections continue to pose serious health challenges to public health, especially with the emergence of methicillin-resistant and multidrug-resistant S. aureus strains [21, 22].

This study was carried out to assess the nasal carriage of enterotoxin-producing S. aureus and its relationship with asthma in children. We also analysed the S. aureus isolates for their antimicrobial resistance profile and the presence of the mecA gene.

Methods

Study Area

This study was conducted at the Lagos State University Teaching Hospital (LASUTH), Ikeja, and the Lagos University Teaching Hospital (LUTH), Idi-araba, Lagos.

Ethical Approval and Consent

Ethical approval was obtained from the Covenant Health Research Committee (CHREC) and the Health Research Ethics of both study areas with approval numbers CHREC 154/2020, LREC/06/10/1488, and CMUL/HREC/12/20/802, respectively. Children and adolescents aged 5–17 years with physician-diagnosed asthma who attended weekly asthma clinics in study areas were recruited. Informed consent or assent was obtained from the participants.

Sample Collection

Samples were collected by wiping the interior of both nostrils with the same sterile cotton swab and placed in cryotubes containing universal bacterial transport media. Each vial was put on ice before transport to the laboratory and subsequent storage at − 40 °C.

Bacterial Culture and Phenotypic Identification

Each swab was inoculated into Mannitol Salt agar (MSA) and Blood agar plates and incubated at 37 °C for 24 h for the selective identification of S. aureus and haemolysis testing, followed by biochemical tests. Pure colonies were stored in nutrient broth and glycerol stocks at − 40 °C for further tests.

Molecular Identification of S. aureus by Detection of the nuc Gene

PCR was used to confirm presumptive staphylococcal isolates by detecting the S. aureus-specific nuclease gene (nuc) gene [23]. For the PCR reactions, a 12.5 µl reaction consisted of 2 µl of 25 ng DNA, 0.25 µl of 10 pmol forward and reverse primers, 3.75 µl Milli-Q water, and 6.25 µl of EasyTaq® PCR Supermix (Transgen Biotech, Beijing, China). The primers for the PCR reaction are provided in Table 1. A 7-µl aliquot of the PCR product was analysed by electrophoresis on a 1% agarose gel, and DNA bands were detected by UV transillumination. A 1 kb plus DNA ladder was used to estimate the band size.

Table 1.

Primer sequences and PCR regime for the genes detected in this study

Gene	Primer sequence (5′-3′)	Size of product (bp)	PCR regime
nuc	F: GCGATTGATGGTGATACGGTT R: AGCCAAGCCTTGACGAACTAAAGC	279	Primary denaturation: 94 °C for 5 min Secondary denaturation: 94 °C for 1 min Annealing: 55 °C for 45 s Extension: 72 °C for 1.5 min Final extension: 72 °C for 1 min 37 cycles [23]
mecA	F: AAAATCGATGGTAAAGGTTGGC R: AGTTCTGCAGTACCGGATTTGC	533	Primary denaturation: 95 °C for 5 min Secondary denaturation: 94 °C for 30 s Annealing: 55 °C for 30 s Extension: 72 °C for 1 min Final extension: 72 °C for 5 min 30 cycles [26]
sea	F: GGTTATCAATGTGCGGGTGG R: CGGCACTTTTTTCTCTTCGG	102	Primary denaturation: 94 °C for 5 min Secondary denaturation: 94 °C for 30 s Annealing: 55 °C for 45 s (modified after gradient PCR) Extension: 72 °C for 45 s Final extension: 72 °C for 10 min 35 cycles [28]
seb	F: GTATGGTGGTGTAACTGAGC R: CCAAATAGTGACGAGTTAGG	164
sec	F: AGATGAAGTAGTTGATGTGTATGG R: CACACTTTTAGAATCAACCG	491
sed	F: CCAATAATAGGAGAAAATAAAAG R: ATTGGTATTTTTTTTTTTCGTTC	278

Antibiotic Susceptibility Testing and Detection of the mecA Gene

The Kirby-Bauer disc diffusion method was used for antimicrobial susceptibility testing as previously described [24]. The presumptive staphylococcal isolates were resuscitated in nutrient broth, after which they were subcultured onto nutrient agar plates and incubated for 18 h at 37 °C. Pure colonies were inoculated into 5 ml normal saline, and the suspension was adjusted to 0.5 McFarland standard. The rest was then inoculated directly on Mueller–Hinton Agar plates and left to dry. After this, the individual antibiotic discs (Oxoid, UK) were placed on the agar plates and incubated for 24 h at 37 °C. Eight antibiotic discs were used for the test: Cefoxitin (30 µg), Erythromycin (30 µg), tetracycline (30 µg), Ceftazidime (30 µg), Oxacillin (1 µg), Gentamycin (30 µg), ciprofloxacin (30 µg), penicillin G (10 U), and sulfamethoxazole/trimethoprim (25 µg). The conventional clinical recommendations for the therapy of S. aureus infections guided the selection of these antibiotics. The results were interpreted according to the CLSI standards [25]. The mecA gene for methicillin resistance was detected by PCR [26], and primers are shown in Table 1.

Evaluation of the Multiple Antibiotic Resistance Index (MARI)

The Multiple antibiotic resistance index (MARI) was calculated to determine the resistance profile of S. aureus isolates using the formula MARI = a/b, where ‘a’ is the number of antibiotics that the S. aureus was resistant to and ‘b’ is the total number of antibiotics that were tested for [27].

Evaluation of S. aureus Virulence Factors

The virulence factors in S. aureus isolates include four staphylococcal enterotoxin genes (sea, seb, sec, and sed) and were detected by multiplex PCR as previously described [28], with some slight modifications (Table 1). For the PCR reaction, a 25 µl reaction consisted of 2 µl of 25 ng DNA, 0.5 µl of 10 pmol forward and reverse primers for sea-sed, 15.25 µl Milli-Q water, and 0.25 µl of 2500 U EasyTaq® polymerase (Transgen Biotech, Beijing, China), 2 µl of 2.5 mM dNTP, and 2.5 µl of PCR buffer. A 7-µl aliquot of the PCR product was analysed by electrophoresis on a 1.5% agarose gel, and DNA bands were detected by UV transillumination. A 100 bp DNA ladder was used to estimate the band size.

Antibiotic Resistance Relatedness

Antibiotic resistance relatedness of S. aureus strains from the anterior nares of children with asthma and healthy controls was assessed by the unweighted pair group method with arithmetic averages (UPGMA) to construct a phylo-dendrogram using the DendroUPGMA construction utility programme [29]. Binary data coded as ‘1’ for susceptibility and '0' for resistance to antibiotics were used to analyse antibiotic susceptibility variables. These data were subjected to similarity assessment. Furthermore, an analysis of associated virulence factors, including the mecA gene, enterotoxin production, and MARI, was performed in conjunction with the generated dendrogram.

Statistical Analysis

Statistical analyses were conducted using the Statistical Package for the Social Sciences (SPSS), version 21. The relationship between nasal carriage of S. aureus and asthma cases was investigated using logistic regression analysis. The odds ratios (OR) and the corresponding 95% confidence intervals (CI) were calculated using binary logistic regression. The results of the antibiotic susceptibility tests were analysed using the one population proportion test. Statistically significant differences were defined as those with a p < 0.05 difference.

Results

Nasal Carriage of S. aureus

The nasal carriage of S. aureus was 52.5%, with the nuc gene detected in 83 isolates (Fig. 1). Between cases and control, nasal carriage of S. aureus was 72.4% (71/98) and 20% (12/60), respectively. There was a significant association between S. aureus nasal carriage and asthma (OR 0.201, 95% CI 0.063–0.645, p = 0.007).

Fig. 1.

Agarose gel electrophoresis of the PCR product for the detection of the nuc gene of S. Aureus. Lane M-1 kb plus molecular marker, Lanes 1–8, 10–13, 15–18 positive, Lane 9, 14-negative, Lane 19-Blank

Antibiotic Resistance Pattern of S. aureus Isolates

All intermediate results from the antibiotic susceptibility testing were interpreted as resistant to determine the antimicrobial-resistant pattern. Of the 83 S. aureus isolates, 82 (99%) were resistant to Cefoxitin, 76 (92%) were resistant to penicillin and the least resistant to gentamicin (25%) (Table 2). The resistance patterns and p-values for all the tested antibiotics are shown in Table 2. The p-values for all the tested antibiotics were less than 0.05, signifying a significant difference between the proportion of resistant and sensitive S. aureus isolates. In addition, 60 (72.3%) multidrug-resistant isolates were identified from the cases (Table 3).

Table 2.

Antibiotic resistance pattern of S. aureus isolated from anterior nares of children with asthma and healthy controls

Antibiotic	N (%)	Standard error	p-value
Cefoxitin	82 (98.8)	0.035	< 0.001*
Gentamicin	21 (25.3)	0.091	0.001*
Penicillin	76 (91.6)	0.046	< 0.001*
Oxacillin	42 (50.6)	0.106	0.003*
Sulphamethoxazole/trimethoprim	29 (34.9)	0.094	0.002*
Tetracycline	28 (33.7)	0.093	0.002*
Erythromycin	78 (94)	0.043	< 0.001*
Ciprofloxacin	50 (60.2)	0.103	0.004*

*Represents significant p-value

Table 3.

Multidrug resistance patterns of S. aureus isolated from children with asthma and healthy controls

Number of antibiotic classes	Sample group
	Case Count (%), N = 71	Control Count (%), N = 12
3	34 (47.9)	2 (16.7)
4	13 (18.3)	0 (0.0)
5	11 (15.5)	0 (0.0)

The total prevalence of MRSA, as shown by the presence of the mecA gene, was 11.4% (18/158), as shown in Fig. 2.

Fig. 2.

Agarose gel electrophoresis of the mecA gene. Lane M-1 kb plus molecular marker, Lane 1- Blank, Lane 2, 4, 6,7, 9, 13-positive, Lane 3, 5, 8, 10–12-negative

Virulence Factors in S. aureus Isolates

Four staphylococcal enterotoxin genes were evaluated among the S. aureus isolates. The distribution of staphylococcal enterotoxins between the sample groups is shown in Fig. 3 and Table 4. The staphylococcal enterotoxin c gene (sec) was the most prevalent enterotoxin among cases and controls (19.7% and 33.3%). No statistically significant differences were observed between cases and healthy controls in the presence of the mecA gene (p = 0.225) and the staphylococcal enterotoxin genes (p = 0.53).

Fig. 3.

Multiplex PCR for the detection of staphylococcal enterotoxins in S. aureus isolates from nasal swab samples sea was identified in Lane 13 (102 bp), seb was identified in Lanes 1, 7, 12, 13, 15 (164 bp), sec was identified in Lanes 1, 5, 13, 18 (451 bp), sed was identified in Lane 1, 7, 12,13,15 (278 bp)

Table 4.

Prevalence of staphylococcal enterotoxin genes in S. aureus isolated from children with asthma and healthy controls

Staphylococcal enterotoxin gene	Sample group
	Case Count (%), N = 71	Control Count (%), N = 12
sea	2 (2.8)	0 (0)
seb	12 (16.9)	1 (8.3)
sec	14 (19.7)	4 (33.3)
sed	9 (12.7)	3 (25)

Antibiotic Resistance Relatedness

The antibiotic resistance pattern of S. aureus isolates using MARI, the mecA gene, and enterotoxin production was analysed (Fig. 4). We found nine distinct clusters (A–I). Clusters B–E had low MARI values (≤ 0.8), indicating resistance to six or fewer antibiotics. Clusters A and F–I had high MARI values (0.9–1), indicating resistance to seven or eight antibiotics. Most MRSA isolates were in clusters A, F–I. Only one isolate from a healthy control belonged to cluster F.

Fig. 4.

Antibiotic resistance relatedness of S. aureus isolated from nasal swabs of children with asthma and healthy controls (MARI-multi-antibiotic resistance index, Ent-enterotoxin gene)

Discussion

The findings of this study revealed that the overall nasal carriage of S. aureus among asthmatic children and healthy controls is 52.5%. Specifically, the nasal carriage of S. aureus among the asthma cases and healthy controls was 72.4% and 20%, respectively.

A 2020 study found that the nasal carriage rate of S. aureus among Spanish children was 19%, with a higher rate of 31.5% in children aged 4–19 years [4]. The results also showed that the carriage rate was higher in children with asthma and allergy. Other studies have also reported a nasal MRSA carriage rate of 2–6.1% in the general population [30–32]. However, this study found a higher rate of MRSA nasal carriage (11.4%) in children with asthma. Davis et al. [2] reported that children with asthma, who are more likely to visit and be admitted to hospitals, may be exposed to antibiotic-resistant S. aureus. Differences in antibiotic usage and stewardship practices between countries could also contribute to different prevalence rates. The higher prevalence of MRSA observed in our study is of concern, as these organisms spread and cause infections with fewer treatment options [33].

In our study, the S. aureus isolates showed high resistance to cefoxitin (99%) and penicillin (92%) but low resistance to gentamicin (25%). This may be due to the less frequent public misuse of gentamicin, administered intravenously or intramuscularly. Our findings are similar to previous studies from Nigeria and other African countries, with similar antibiotic resistance patterns in these settings [31, 34, 35].

In this study, the staphylococcal enterotoxin c gene (sec) was the most prevalent enterotoxin among cases and controls (19.7% and 33.3%, respectively), while the sea was the least prevalent (2.8% and 0%, respectively). Staphylococcal enterotoxins act as superantigens that modulate Th2-immune responses, initiating inflammatory pathways including the production of IL-5 and IgE [7, 8]. These proteins have been implicated in the pathology of asthma and other chronic respiratory diseases particularly with increased hospitalizations, corticosteroid use, and reduced lung function [7, 36, 37]. Using serological techniques, previous studies have detected higher levels of serum IgE antibodies targeting staphylococcal enterotoxins (SE-IgE) among individuals with allergic respiratory diseases [27–29]. In adult asthma patients with poor asthma control, there was a higher prevalence of IgE against SEA and an association between staphylococcal enterotoxin sensitization and poor asthma control [38]. A study conducted in a general adult European population showed that SE-IgE was significantly associated with asthma [39]. In addition, logistic regression analyses conducted in a British asthma cohort revealed significantly higher risks of developing any form of asthma in SE-IgE positive subjects [40]. A limitation of using SE-IgE levels to determine S. aureus associations with asthma is SE-IgE is a product of an atopic host immune response, and little is known regarding the relationship between S. aureus exposure and asthma according to atopic status. It is unclear if host sensitization (measured via SE-IgE production) is necessary for disease pathogenesis given exposure to staphylococcal enterotoxins [2, 19]. Further, other S. aureus virulence factors, such as α-toxins, can trigger mast cell degranulation without IgE production [41–43].

Taken together, these results associate S. aureus nasal colonisation and enterotoxin production with asthma in children. The high colonisation rates of S. aureus, MRSA, and multidrug-resistant S. aureus in the cohort studied urgently call for improvement in antibiotic stewardship in paediatric medicine and implementation of infection control policies.

Limitations

The cross-sectional design is a limitation in assessing the association between asthma and S. aureus nasal carriage. Long-term cohort studies and nasal S. aureus decolonisation studies will better define causal relationships. However, this study has provided data on nasal carriage, virulence characteristics, and antibiotic resistance patterns of S. aureus isolated from children with asthma in a tropical setting.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Oyewumi Oshamika, Oreoluwa Sonowo, Olatunde Odusote and Yeside Akinbolagbe. The first draft of the manuscript was written by Oyewumi Oshamika, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.