Multiplex Loop-Mediated Isothermal Amplification Coupled Lateral Flow Assay for Point-of-Care Detection of Syphilis

Abstract

Syphilis is a re-emerging sexually transmitted disease caused by the pathogenic spirochete T. pallidum. Every year more than 5 million cases are reported globally. The current diagnostic methods are primarily based on serological assays, which are less sensitive at an early stage of infection. To improve the disease diagnosis, there is a need to develop a rapid, simple, sensitive, and cost-effective point-of-care application, which plays an effective role in the detection of syphilis infection. In this study, we developed a multiplex loop-mediated isothermal amplification coupled lateral flow assay (multiplex LAMP-LFA) for the detection of syphilis. Two different genes, the target amplicon (polA) and the internal control amplicon (human RNase P) were amplified using multiplex LAMP assay. The amplified products were detected using LFA strips coated with Anti-FITC and Anti-DIG antibodies within 5 minutes of flowthrough. Multiplex LAMP LFA detection limit was found to be 3.8 × 10³ copies/mL with high specificity. The developed strip was tested with 130 clinically suspected cases and 50 healthy individuals. With the clinical samples, the method shows a sensitivity of 93.84% and a specificity of 100%. The Multiplex LAMP LFA has the potential to overcome the limitations of both Non Treponemal tests and Treponemal tests which are prone to prozone effects and expensive reagents respectively. The proposed method holds promise for sensitive, rapid, and visual detection of T. pallidum, thereby offering a facile and affordable alternative to existing diagnostic methods. This approach is poised to advance the development of point-of-care diagnostics, addressing a critical need in public healthcare, particularly in resource-limited settings.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12088-024-01308-4.

Introduction

Syphilis is a sexually transmitted disease caused by the spirochete bacterium T. pallidum subsp. pallidum, which creates a severe threat to global public health [1]. The World Health Organization estimates the disease rate between 5.6 million and 11 million new cases of syphilis are diagnosed globally each year [2]. Syphilis is mainly acquired through sexual contact and is characterized by several mucosal (genital, anal, and oral) and cutaneous lesions [3, 4]. The stages of syphilis are generally divided into two categories such as early syphilis and late syphilis. Early syphilis refers to the primary, secondary, and early latent stages that last for less than a year and are all highly contagious. The symptoms of early syphilis include malaise, appetite loss, fever, headache, stiff neck, nasal discharge, and depression. Late syphilis refers to the latent and tertiary stages of syphilis when the infection prevails for more than a year. Skin, cardiovascular, and neurological manifestations that are rarely observed in the late syphilis [5]. The Gold-standard diagnostic methods include pathogenic examination by microscope through silver staining and serological tests such as rabbit infectivity test. The non-invasive diagnostic methods arose due to various limitations presented by Darkfield Microscope (DFM) associated silver staining and Direct Fluorescent Antibody (DFA) tests owing to their difficult stain interpretation and reliability on specific antibodies respectively [6]. The current detection method of syphilis is based on clinical symptoms combined with serological assays (treponemal (TT) and nontreponemal (NTT) tests) which detect specific and non-specific antibodies. The treponemal assays include the fluorescent treponemal antibody absorption (FTA-Abs), enzyme immunoassays (EIA), chemiluminescent immunoassays (CIA), T. pallidum hemagglutination assay (TPHA), and T. pallidum particle agglutination assay (TPPA), which detects specific IgG and IgM antibodies in the patient serum. The non treponemal assay, including the rapid plasma reagin (RPR) test and the venereal disease research laboratory (VDRL) test, which identify the antibodies against cardiolipin and lecithin antigens of T. pallidum [7]. The Syphilis diagnostics algorithm comprises two, namely, the traditional algorithm, and a reverse sequence serology algorithm where the former often produces a prozone effect while the latter promises a greater diagnostic efficacy [8]. Serological assays can detect primary, secondary, and latent stages of infection but generate false-positive results due to the persistence of T. pallidum antibodies from past infections [9]. Unfortunately, serological assays cannot discriminate between treated and untreated individuals. Another drawback of these assays is their inability to detect corresponding antibodies in immunodeficient patients [10]. The molecular assays like Polymerase chain reaction (PCR) [4], nested PCR [11], real-time multiplex PCR [12], real-time quantitative PCR [13], and Taqman real-time PCR [14], were developed to detect T. pallidum in blood samples. These methods require long detection time, sophisticated equipment, and trained personnel for handling and analysis, which limits their use in point-of-care diagnostics.

Loop-mediated isothermal amplification (LAMP) has been widely used in molecular diagnostics because it promises to offer high sensitivity, specificity, and rapid outcome [15]. LAMP uses 4 to 6 sets of primers and a Bst polymerase with strand displacement activity, which recognizes multiple sequences in the target nucleic acid. target nucleic acid fragments can be amplified using a heating block or water bath. Therefore, it is suitable for clinical diagnosis in resource-limited areas [16]. Previously, LAMP was reported to detect T. pallidum target genes such as polA, tprL, TP_0619, and bmp [15–18].

Recently, the multiplex loop-mediated isothermal amplification method (multiplex LAMP) combines multiple primer sets in a single reaction system. The technique has gained popularity by its merits. Mainly, this method allows simple and easy selection of target genes, thus facilitating rapid processing. Unlike a single LAMP, multiplex LAMP produces a more complex ladder-like pattern of amplicons that cannot be analyzed by agarose gel electrophoresis (AGE) [19]. Several methods have been reported to detect and differentiate multiplex LAMP products, such as real-time turbidimeters, colorimetric agents, fluorophore-labeled primers with intercalator dyes, and pyrosequencing [20]. However, these methods require precise instruments making them unsuitable for point-of-care testing.

Point-of-care testing has been made possible by assessing the LAMP reaction via Lateral Flow Assay (LFA). In the current scenario, people who do not have access to laboratory services in developing countries need rapid, reliable, and affordable point-of-care diagnostics. The LFA provides a portable, visible, and simple-to-use detection tool, providing enormous potential for point-of-care testing because the LFA method can distinguish multiple LAMP amplicons [21]. To the best of our knowledge, there has been no previous report on the simultaneous detection of syphilis using the multiplex LAMP-LFA approach in a single reaction.

In this study, we developed a multiplex LAMP-LFA targeting the polA and human RNase P marker genes to detect T. pallidum DNA in blood samples. Human RNase P is used as an internal control for indicating the successful amplification. This assay offers a simple, efficient, compatible, point-of-care platform for a preliminary assessment of syphilis diagnosis.

Materials and Methods

Genomic DNA, Strains, and Reagents Used

The genomic DNA of T.pallidum subsp. pallidum was isolated from patients. Bacterial strains such as Escherichia coli (MTCC 1302), Staphylococcus epidermidis (MTCC 10623), Staphylococcus aureus (MTCC 1430), Leptospira interrogans serovar Canicola (ATCC 23606), and Stenotrophomonas maltophilia (MTCC 7528), were used for specificity analysis. The LAMP reagents, including warmstart 2.0 Bst DNA polymerase and dNTP mixture, were purchased from New England Biolabs (NEB, USA). Hydroxy naphthol blue (HNB) dye was obtained from HiMedia Pvt. Ltd. (India). Customized Nucleic acid Lateral Flow Test Cassettes/strips were procured from Abingdon Health, UK.

Clinical Participation and Ethical Approval

Between January 2022 and June 2023, suspected syphilis cases presented at Rajiv Gandhi Government Central Hospital in Chennai were included in the study after informed consent had been acquired from the participants. To protect the autonomy of the individuals, the patients were educated with the research purpose and a full disclosure with comprehension, during the informed consent process, adhering to the ethical principles. Privacy and data confidentiality were upheld throughout the study. A total of 130 suspected cases were enrolled as clinical participants in this study. The collected samples were clinically and serologically documented. The study included suspected individuals with clinical manifestations such as sores or ulcers on the skin and genital areas. If an individual had been treated with antibiotics within one month, they were excluded from the study. Fifty blood samples from healthy donors were collected and used as a control group. Indian institutional ethical committee of Madras Medical College (MMC) had approved this study for sample collection (EC Reg. No. ECR/270/Inst./TN/2013).

Whole blood samples were collected from suspected syphilis cases. All the samples were stored at −20° C until DNA extraction. All samples were carefully labeled to ensure the confidentiality of patients' identities while performing the work. All samples from patients were forwarded to the clinical laboratory for routine screening using T. pallidum particle agglutination (TPPA), T. pallidum hemagglutination assay (TPHA), and rapid plasma reagin (RPR), adhering to the standard diagnostic test protocols.

DNA Isolation

Genomic DNA was extracted from suspected syphilis using 1 mL of their whole blood sample by QIAamp DNA Blood Midi Kit (Qiagen, Inc., Valencia, CA, USA), as recommended by the manufacturer, eluted in 100 μL elution buffer and kept at −80° C until required. To avoid cross-contamination, the samples were handled individually under sterile conditions. The extracted DNA was quantified using a Bio-photometer (Eppendorf, Hamburg, Germany) and stored at −20° C. The isolated DNA was PCR amplified and cloned into pGEM®-T Easy Vector. The plasmid containing polA (pGEM‐T/polA) and human RNase P (pGEM‐T/ Human RNase P) genes were subjected to Sanger sequencing. The plasmid sequencing results showed 100% identity with T. pallidum. The real-time PCR quantification protocol was followed, as reported in [18]. The PCR-confirmed pGEM‐T clones of each gene with a defined number of copies were used as a positive control for the optimization of the study.

Primer Designing

Based on the previous study [14], the T. pallidum polA was chosen as a target gene for LAMP assay. The marker gene polA encodes for DNA polymerase I, a highly specific marker gene to detect all the subspecies of T. pallidum [22]. The human RNase P gene serves as an internal control because the human genome has many copies and is easily obtained [23] after DNA extraction. The gene sequences were retrieved from the NCBI Genbank database (https://www.ncbi.nlm.nih.gov/) and were designed using primer explorer software (http://primerexplorer.jp/e/) and synthesized by Eurofins. The sensitivity and specificity of the primers were checked with an in-silico program (https://genome.ucsc.edu/cgi-bin/hgPcr). The self-dimerization and hetero dimerization of primers were checked by oligo analyzer software (https://www.idtdna.com/calc/analyzer). Cross-reactivity between the primers, without their specific target DNA was tested, using pGEM‐T/polA and pGEM‐T/ Human RNase P plasmids, to avoid false positive amplification. Primers used in this study are given in Fig. 1 and Table 1.

Fig. 1.

Sequences and positions of target primers used in the multiplex LAMP-LFA. A polA gene and B human RNase P gene. The polA is the target gene in this study that confirms the presence of T. pallidum and the RNase P gene is used as an internal control gene to indicate the presence of human DNA

Table 1.

Primers used in this study

Target genes	Sequence (5’-3’)	References
polA	FP- 5’ ATTGGTCCTAAGACGGCT 3’	[13]
	RP- 5’ GCGGAATACAACAGGAATC 3’
	FIP- Digoxigenine- 5’ CAGCGCTTCTTTTAAGGAATAGGTAGCACATCTTCTCCACTGT 3’
	BIP- Biotin- 5’CGCACGAAGATAGTGTGTGGACATGGTACATCGTCACG 3’
Human RNase P	FP- 5’ GCACTGAGAATTGCAAGTATAGC 3’	In this study
	RP- 5’ GCAGTACCACTATCCCACATACC 3’
	FIP- FITC- 5’ CCCAAATTCCAGTATTTGCTATCAGCCCTTCCTGAT 3’
	BIP- Biotin- 5’ CCGTGGAGGCTCGGAGAACTAGATAGTATTGTTCCA 3’

LAMP assay was performed for rapid and sensitive detection of T. pallidum DNA. The PCR confirmed DNA (10 ng/μL) was quantified by real-time quantitative PCR (qPCR) for copy number analysis and found to be 59293 copies/μL. The LAMP assay was performed in a 25  μL reaction mixture containing positive control DNA (10 ng/μL), polA primer mix, human RNase P primer mix [outer primers F3 and B3 (0.2 μM), and inner primers FIP and BIP (0.8 μM)], 2.5 μL of 10X isothermal reaction buffer (consisting of 20 mM Tris-HCl, 10 mM KCl, 10 mM (NH4)₂SO₄, 2 mM MgSO₄, and 0.1% Tween 20), 1.4 mM dNTPs, 8 mM MgSO_4, and 8 U of Bst DNA Polymerase. Optimization of the isothermal amplification conditions was carried out for reaction time (30, 45, 60, 75, and 90 minutes) and temperature (59 ℃, 61 ℃, 63 ℃, 65 ℃, and 67 ℃). The assay without template DNA was considered a negative control. The LAMP amplified products of the optimization experiments were analyzed by Agarose gel electrophoresis as well as by colorimetric detection using hydroxy naphthol blue. A gel documentation system (Gelstan, Medicare Pvt Ltd, India) was used to visualize the amplified LAMP products run on 2.5% agarose gel stained with ethidium bromide. The HNB dye (120 μM) was added to the above-mentioned reaction mixture for naked-eye visualization of the amplified products [24]. A color change was observed from violet to sky blue in all positive reactions, while no color change indicates negative amplification.

Optimization of Multiplex LAMP Assay

Multiplex LAMP assay was performed using a primer mix for both polA and RNase P genes. The assay was performed in a 25 μL reaction, using the aforementioned LAMP reagent concentrations for the master mix preparation. The amplification was carried out in a dry bath at 65° C for 60 minutes. All the reactions were run in triplicate and included a DNA-free template (nuclease-free water) as a negative control (NC). After amplification, the products were analyzed using agarose gel electrophoresis and colorimetric detection via HNB.

Multiplex LAMP-LFA

The multiplex LAMP-LFA analysis was performed with a customized LFA kit (Abingdon Health, UK). The instructions of the LFA kit were followed as per the manufacturer’s guidelines. The forward inner primers (FIP) targeting the polA and human RNase P genes were labeled with Digoxigenin and FITC, respectively, and backward inner primers of the two genes were labeled with biotin. In the presence of target DNA, large amounts of DIG-Biotin, and FITC-Biotin-labeled amplicons are produced with the help of specific labeled primers by the multiplex LAMP assay. After amplification, the products (6 μL) were mixed with a running buffer (84 μL), and the amplicon mixture (75 μL) was added to the sample pad.

The mixture moves through the capillary action on the LFA strip and gets combined with Neutravidin coated with carbon particles on the conjugate pad, forming the DIG-amplicon-Biotin-Neutravidin carbon particle-complex and the FITC-amplicon-Biotin-Neutravidin- carbon particle complex. These complexes continue to move on the LFA strip and reach the reaction pad, where they are captured by anti-DIG antibody (T1) and anti-FITC antibody (T2) on test lines, and the remaining unbound particles continue to migrate and captured by anti-mouse antibody on strip control line C, which is visualized as a black line because of the aggregation of carbon particles.

The LFA strips were observed for the line development for 10 minutes. The detection of target and internal control genes on the LFA strip was determined by the presence of black lines on the reaction pad [25]. When the target analyte is not present in the given sample, only the strip control line (C) appears as a validation of the LFA strip detection Fig. 2. The distance from the point of loading sample to the end of the conjugation pad is 35 mm. The migration of the sample was observed and it took about 1.35 mins to flow till the conjugation pad. The flow rate was calculated to be 2.5 cm/min which is 0.4 mm /sec. The interference of LAMP reaction parameters in the LFA was analyzed by loading the LAMP products from the assay performed at different time and temperature conditions.

Fig. 2.

Schematic illustration of the working principle of LFA strip. The LFA consists of a sample pad, a reaction pad, and an absorbent pad. T1 and T2 are the test lines coated with anti-DIG (T1) and anti-FITC (T2); C is a strip control line. The T1 line captures the DIG-amplicon-Biotin-Neutravindin carbon particle complex. The T2 line captures the FITC-amplicon-Biotin-Neutravindin carbon particle complex. Line C is the strip control line to validate the working condition of the LFA, in which the Neutravindin carbon particle binds to the anti-mouse antibody fixed on that line

Sensitivity, Specificity, and Robustness of Multiplex LAMP-LFA

The sensitivity of the multiplex LAMP-LFA was determined by 10-fold serial dilution of positive control DNA of T. pallidum (polA gene) and internal control RNase P gene (59,293 copies/μL, 10 ng/μL, both genes) with nuclease-free water yield the concentrations of 10, 2, 0.4, 1.6 × 10⁻², 6.4×10⁻⁴, and 2.56×10⁻⁵ ng/μL. Then, 1 μL of sample DNA from each dilution was used for multiplex LAMP-LFA and multiplex LAMP assay. All reactions were run in triplicates and included a negative control (nuclease-free water). The Concentration determination for the 10-fold serial dilution of control DNA was predicted from the melting curve analysis done in the HRM-based Multiplex LAMP assay [18]. The assay specificity was validated by testing closely related bacterial species like E. coli, S. epidermidis, S. aureus, L. interrogans serovar Canicola, S. maltophilia, and C. trachomatis. All the reactions were performed with the isolated genomic DNA from the organisms and run in triplicate with a negative control (nuclease-free water).

The assay was performed using different reagents from manufacturers such as Aura Biotechnologies, New England Biolabs, and Origin Diagnostics to check the robustness of the method. Different individuals also performed the assay and finally, the reproducibility was assessed. The interference of the different instruments such as water bath, dry bath, and Thermocycler to maintain isothermal conditions during the assay was also checked for the validation of the developed LFA kit.

Validation with Clinical Samples

The clinical evaluation of the multiplex LAMP-LFA was performed by the determination of sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and accuracy using the expressions listed below [18]. The statistical analysis was done using odds ratio software, MedCalc (https://www.medcalc.org/calc/odds_ratio.php) as per the medical statistics [26]. The software uses a Confidence Interval of 95% to retrieve the predictive power of the diagnostic test and present it as an ROC (Receiver Operating Characteristic curve) plot to handle the empirical uncertainties with utmost care.

$$\text{Sensitivity}=\text{Number}\text{of}\text{TP/Number}\text{of}\text{TP}+\text{Number}\text{of}\text{FN}\times 100$$

$$\text{Specificity}=\text{Number}\text{of}\text{TN/Number}\text{of}\text{FP}+\text{Number}\text{of}\text{TN}\times 100$$

$$\text{PPV}=\text{Number}\text{of}\text{TP}/\text{Number}\text{of}\text{TP}+\text{Number}\text{of}\text{FP}\times 100$$

$$\text{NPV}=\text{Number}\text{of}\text{TN}/\text{Number}\text{of}\text{FN}+\text{TN}\times 100$$

$$\text{Accuracy}=\text{Number}\text{of}\text{TP}+\text{TN}/\text{Number}\text{of}\text{TP}+\text{FP}+\text{TN}+\text{FN}\times 100$$

where TP is the true positive, FP is the false positive, TN is the true negative, and FN is the false negative.

Results and Discussion

Clinical Characteristics of Enrolled Patients

The clinical diagnosis of syphilis was combined with the patient's serological assays, disease history, and clinical characteristics. A total of 130 suspected patients (76 male and 54 female) were examined with a median age of 31–35 years. The suspected patients were determined to have syphilis after a continuous visit for one month. The sample included 53 suspected primary syphilis and 77 suspected secondary syphilis. Among them, there were 49 primary cases and 73 secondary cases that tested positive for serological findings. The remaining eight cases showed negative results in serological screening after one month of visit. A group of 50 healthy volunteers who tested negative for syphilis infection was considered a control group.

Optimization of the Conventional LAMP

To optimize the LAMP reaction conditions, temperatures ranging from 59 ℃ to 67 ℃ at 2 ℃ intervals were compared to determine the optimal reaction temperature. The amplification was observed for both the genes in all the temperatures except 59 ℃ and the efficiency of amplification was found to be higher in 65 ℃, which was considered for subsequent reactions. The reaction time of LAMP varied from 30 minutes to 90 minutes and the optimum time required for LAMP reaction is 60 minutes. Hence, the subsequent LAMP reactions were performed for 60 minutes (Fig. 3). The amplified products were visualized using HNB dye, which binds to the major groove of double-stranded DNA and produces a color change from violet to sky blue in all positive reactions. A faint color change of the HNB dye was observed in the experiment with a reaction time of 75 minutes, which was unclear in agarose gel. No color change was observed in the negative samples.

Fig. 3.

Optimization of conventional LAMP of polA and human RNase P genes visualized on 2% agarose gel. A Optimization of reaction temperature. Lane 1-5: polA amplicon (59 ℃, 61 ℃, 63 ℃, 65 ℃ and 67 ℃), Lane 6-10: human RNase P amplicon (59 ℃, 61 ℃, 63 ℃, 65 ℃ and 67 ℃), and Lane 11: Negative control. B Optimization of reaction time. Lane 1-5: polA amplicon (30, 45, 60, 75, and 90 minutes), Lane 6-10: human RNase P amplicon (30, 45, 60, 75, and 90 minutes), Lane 11: Negative control, and Lane M: 100 bp ladder

Optimization of Multiplex LAMP Assay

To simultaneously detect polA and human RNase P amplicon products in a single reaction, a multiplex LAMP assay was performed. The multiplex LAMP assay showed clear ladder-like bands on 2.5% agarose gel electrophoresis at 65 ℃ for 60 min (Fig. 4A). In multiplex LAMP, assessment of primer specificity is important to rule out the false positive results generated by coexisting primers. As shown in Fig. 4B amplification was observed when polA gene and RNase P gene targets were amplified only with their specific primers. Hence the optimized multiplex LAMP assay had no cross-reactivity.

Fig. 4.

Visualization of multiplex LAMP assay using polA and human RNase P amplicons. (A) Visualization by agarose gel: Lane M: 100 bp ladder, Lanes 1-3: polA amplicon, human RNase P amplicon, and multiplex LAMP (both polA and human RNase P in a single reaction), Lane 4: negative control. B Colorimetric detection using HNB dye: No. 1-3: polA amplicon, human RNase P amplicon, and multiplex LAMP amplicon, No. 4: negative control. (B) Primer cross-reactivity of individual LAMP products and multiplex LAMP amplicon. a monoplex LAMP assay with polA primers: Lane 1: PolA plasmid, Lane 2: human RNase P plasmid, and Lane 3: NC. b monoplex LAMP assay with human RNase P primers: Lane 4: human RNase P plasmid, Lane 5: PolA plasmid, and Lane 6: NC. c multiplex LAMP assay with polA and human RNase P primers: Lane 7: monoplex LAMP assay with polA, Lane 8: monoplex LAMP assay with human RNase P, Lane 9: multiplex LAMP assay (Both polA and human RNase P), Lane 10: NC, and Lane M: 100 bp ladder

Optimization of Multiplex LAMP-LFA

Due to difficulties in observing Multiplex LAMP products through an agarose gel and colorimetric detection, the LFA approach was adopted. Multiplex LAMP could amplify multiple targets simultaneously in a single reaction, polA, and human RNase P genes were amplified, and discrimination by the multiplex LAMP-LFA assay was evaluated. The validation of positive results was based on the presence of three black lines (T1, T2, & C) on the reaction pad.

The first black line formation indicated the presence of the LAMP product of polA and the second and third lines indicated the human RNase P and strip control lines. The multiplex LAMP-LFA indicates a clear positive result for the targets by producing three black lines on a test strip, whereas negative control produces only one line (Fig. 5). The lines started to form within five minutes of flowthrough which followed the earlier study that deployed the LFA strips in pathogen detection [25]. The LFA strips were analyzed for their ability to provide results without any false positivity. It was evident from the Fig. S1 that the polA amplicons and RNase P amplicons were solitarily responsible for the lines T1 & T2 respectively with no cross-reaction. The optimized time and temperature (60 mins & 65 ℃) in the multiplex LAMP assay were found to be consistent with the LFA (Fig. S1).

Fig. 5.

Visualization of multiplex LAMP-LFA using polA and human RNase P amplicons. Multiplex LAMP-LFA detection: T1, T2, and, C denote the test line (polA), the internal control line (RNase P), and the strip control line, respectively

Sensitivity, Specificity, and Robustness of Multiplex LAMP-LFA

To detect the sensitivity, positive control DNA and internal control DNA templates of T.pallidum were prepared, ranging from 10 to 2.56 × 10⁻⁵ ng/μL to detect the amplification in multiplex LAMP-LFA. Conventional LAMP with agarose gel electrophoresis showed a detection limit of 1.6 × 10⁻² ng/μL (equivalent to 95copies/μL). The multiplex LAMP LFA reached a Limit of Detection (LOD) of 6.4 × 10⁻⁴ ng/μL (equivalent to 3.8 × 10³ copies/mL). The assay included the RNase P gene as no bacteria control. The sensitivity achieved was found to be better than the LOD obtained for LAMP-based detection of Treponema pallidum subsp. pertenue (2.8 × 10⁴ copies/mL) [27]. It revealed that multiplex LAMP LFA gave better sensitivity than an agarose gel electrophoresis technique (Fig. 6).

Fig. 6.

Comparison of sensitivity by conventional LAMP and multiplex LAMP assay of polA and human RNase P amplicon. A Agarose gel electrophoresis detection of multiplex LAMP products: Lane 1-6: (10, 2, 0.4, 1.6 × 10⁻², 6.4 × 10⁻⁴ and 2.56 × 10⁻⁶ ng/μL), Lane M: 100 bp ladder. B In- detection using HNB dye: card 1-6: (10, 2, 0.4, 1.6 × 10⁻², 6.4 × 10^-4 and 2.56 × 10⁻⁶ ng/μL). C LFA detection: strip 1-6: (10, 2, 0.4, 1.6×10⁻², 6.4 × 10⁻⁴ and 2.56 × 10⁻⁶ ng/μL)

The specificity assay indicated that the reaction was highly specific only for T. pallidum genomic DNA in the LFA strips (Fig. S1) Table 2. The results obtained for validating the robustness of the LFA indicate that the technique will work with varied LAMP reagents (Fig. S1) with minimal interference from different instruments used. The reproducibility of the multiplex LAMP LFA remains unaffected when handled by different individuals (Fig. S1). Moreover, the LFA strips have greater stability at room temperature for months including the extraction buffer provided in the kit. The developed method is extremely compatible in a field setting due to its faster turnaround time, reduced need for expensive instruments, and durable regents with inhibitors tolerance.

Table 2.

Specificity analysis of multiplex LAMP-LFA with other organisms

Bacterial strains	Multiplex LAMP-LFA
T. pallidum subsp. pallidum (Genomic DNA)	+
E. coli (MTCC 1302)	−
S. epidermidis (MTCC 10623)	−
S. aureus (MTCC 1430)	−
L. Interrogan serovar canicola (ATCC 23606)	−
S. maltophilia (MTCC 7528)	−
C. Trachomatis (Genomic DNA)	−
T. pallidum subsp. Endemicum (Genomic DNA)	−

Validation of Multiplex LAMP-LFA

To ascertain the clinical sensitivity and specificity of the multiplex LAMP-LFA, 130 suspected syphilis cases and 50 healthy individuals (control) were investigated. Of these suspected syphilis cases, there were 122 known positive cases by multiplex LAMP-LFA, including 49 primary syphilis cases, and 73 secondary syphilis cases. A comparative analysis of the multiplex LAMP-LFA and conventional LAMP assay was performed. All positive cases had definitive bands on Lateral flow strips with varying intensities (both target line T1 and internal control line T2), while test bands were absent in all the T. pallidum negative cases (healthy control). The overall sensitivity for the multiplex LAMP-LFA was 93.84% (122 of 130 cases) and for conventional LAMP assay 86.92% (113 of 130 cases). Among different stages of syphilis for multiplex LAMP-LFA and conventional LAMP assay from patients with primary syphilis (PS, 92.45% (49 of 53 cases) vs. 84.90% (45 of 53 cases)) and secondary syphilis (SS, 94.80% (73 of 77 cases) vs. 88.31% (68 of 77 cases)), the multiplex LAMP-LFA showed better sensitivity than conventional LAMP assay. The clinical specificity was evaluated with a control group of 50 cases. 100% specificity was observed for both multiplex LAMP-LFA and conventional LAMP assay for primary and secondary syphilis. The obtained sensitivity of the developed method is superior to the nested PCR that had reported a sensitivity of 24% in detecting the tpp47 gene of T. pallidum in whole blood fractions [4]. A PCR-based detection of syphilis incurred a sensitivity of 44% in a total population of 68 patients from their blood specimens [28].

The PPV of a LAMP assay refers to the likelihood that a positive test result accurately reflects the existence of the disease. As a proof of concept, the current assay achieved a high PPV of 100%, conferring better sensitivity and specificity. The NPV, on the other hand, refers to the probability that a negative test result truly indicates the absence of disease. The assay achieved an NPV of 74.14% which is comparatively higher than the NPV obtained by Xiao et al., 2017 in the LAMP assay-based detection of T. pallidum DNA [15].

The multiplex LAMP LFA allowed the detection of T. pallidum with a sensitivity, specificity, and accuracy of 93.85%, 100%, and 94.77%, respectively. In comparison, the conventional LAMP had a sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and accuracy of 86.92%, 100%, 100%, 57.44%, and 88.88%, respectively. All the collected samples were validated by the detection of the internal control gene (human RNase P) (Table 3).

Table 3.

Sensitivity, specificity, positive predictive value (ppv), negative predictive value (npv), and accuracy of multiplex lamp-lfa in syphilis and non-syphilis group

Method		Number of syphilis cases (N=130)	Number of non-syphilis cases (N=50)	Sensitivity (95% CI)	Specificity (95% CI)	PPV (95% CI)	NPV (95% CI)	Accuracy
multiplex LAMP-LFA	(+)	122	0	93.84%	100%	100%	74.14%	94.77%
	(-)	8	50	(88.23%–97.31%)	(92.89%–100.00%)	(97.02% –100.00%)	(59.44%–84.87%)	(90.43%–97.53%)
Conventional LAMP	(+)	113	0	86.92%	100.00%	100.00%	57.44%	88.88%
	(-)	17	50	(79.89%–92.19%)	(92.89%–100.00%)	(96.89% –100.00%)	(46.42%–67.76%)	(83.36%–93.08%)

Positive (+), Negative (-)

The overall sensitivity of the assay depends on the prevalence of the bacteria at the collected region and the stage of infection, which governs the T. pallidum DNA load in the sample [29]. Since the bacterium is found below the epidermis, careful monitoring is required to ensure that bacteria are properly collected. Consumption of antibiotics during the treatment could hamper the diagnostic process and cause false negative results during detection [30]. Lastly, the possibility of deterioration of the T. pallidum DNA during sample collection cannot be eliminated [1]. The present Multiplex LAMP LFA with high PPV and NPV, makes it a useful tool for diagnosing and managing syphilis infections. Its ability to yield accurate and dependable results can assist healthcare providers in making timely decisions about the care and treatment of syphilis patients, which will ultimately improve patient outcomes. The Developed Multiplex LAMP LFA can also be improvised with digitalization to enhance visual interpretation with the help of machine-read results. Cloud-based smartphone apps can be utilized to collect data in real-time from the LFA readouts and the apps also help with the analysis and storage of the data [31].

Conclusion

Improved diagnostics methods are essential to monitor and control the global rise in syphilis incidence in recent years. The developed assay provides equipment-free, low-cost, simple fabrication for amplifying and quantifying T. pallidum DNA. This point-of-care device meets the eligibility criteria of ASSURED set out by the World Health Organization (WHO). This multiplex LAMP LFA addresses the limitations of traditional molecular methods by providing high sensitivity, and rapid analysis in less than an hour. The Multiplex LAMP LFA can also be adapted to detect multiple targets in syphilis patients by detecting distinct genes with no similarities to ensure accurate detection of co-infections. Early and precise syphilis diagnosis will facilitate the best possible treatment options promptly. This technique can be used as a promising alternative for the point-of-care identification of T. pallidum infection in resource-limited areas.

Supplementary Information

Below is the link to the electronic supplementary material.

Funding

This research is funded under Extramural Research (Small grants) by the Indian Council of Medical Research, grant number EM/Dev/SG/167/5001/2023 (E-Office-173073).

Declarations

Conflict of interest

The authors declare that they have no conflict of interest.