ABSTRACT
Staphylococcus aureus is the most common cause of skin and soft tissue infections (SSTIs) with Methicillin-Resistant S. aureus (MRSA) strains being a major contributor in both community and hospital settings. S. aureus relies on metabolic diversity and a large repertoire of virulence factors to cause disease. This includes α-hemolysin (Hla), an integral player in tissue damage found in various models, including SSTIs. Previously, we identified a role for the Spx adapter protein, YjbH, in the regulation of several virulence factors and as an inhibitor of pathogenesis in a sepsis model. In this study, we found that YjbH is critical for tissue damage during SSTI, and its absence leads to decreased proinflammatory chemokines and cytokines in the skin. We identified no contribution of YjbI, encoded on the same transcript as YjbH. Using a combination of reporters and quantitative hemolysis assays, we demonstrated that YjbH impacts Hla expression and activity both in vitro and in vivo. Additionally, expression of Hla from a non-native promoter reversed the tissue damage phenotype of the ΔyjbIH mutant. Lastly, we identified reduced Agr activity as the likely cause for reduced Hla production in the ΔyjbH mutant. This work continues to define the importance of YjbH in the pathogenesis of S. aureus infection as well as identify a new pathway important for Hla production.
KEYWORDS: Staphylococcus, S. aureus, alpha-toxin, YjbH, skin, regulation
Introduction
The skin is one of the first lines of defense against pathogens. It has a variety of mechanisms to combat these pathogens including toxic fatty acids, low pH, layers of dead skin cells that slough off, tissue-resident immune cells, and the ability to rapidly recruit immune cells to the site of tissue damage or infection [1,2]. Problems arise when pathogens can circumvent these defenses and cause infection. While Staphylococcus aureus is a common colonizer of the human body, it is the leading cause of skin and soft tissue infections (SSTIs) in the United States [3,4]. The emergence of lineages, such as multidrug-resistant Community-Associated Methicillin Resistant S. aureus (CA-MRSA), has made treating S. aureus infections challenging for health-care providers and MRSA alone caused over 100,000 worldwide deaths in 2019 [5]. In addition to SSTIs, S. aureus can cause life-threatening invasive infections with high morbidity and mortality. While progress has been made toward decreasing S. aureus infection, this progress has reduced in recent years [6]. While the overall incidence of SSTI is not changing drastically, infections with complications have significantly increased, with deaths post-SSTI hospitalization and healthcare-related costs also rising [7]. Considering S. aureus’ importance in human health, understanding factors contributing to disease is imperative to combating this pathogen and the hope of developing new therapeutics and treatments to fight these infections.
S. aureus is a gram-positive opportunistic pathogen that can infect almost any anatomical site on the human body. It possesses a diverse metabolic potential and a variety of virulence factors that allow this bacterium to respond rapidly to changing host niches within different tissue environments. Recently, we found that the YjbH protein is important for the production of several key S. aureus virulence factors including aureolysin and staphyloxanthin, as well as resistance to oxidative and nitrosative stress [8]. We found that a ΔyjbIH mutant has increased pathogenesis during a murine model of systemic infection. This was followed by additional reports that YjbH is important for survival in whole blood [9] and pathogenesis in a silkworm model [10,11]. YjbH mutants have altered antibiotic susceptibility profiles, including glycopeptides and β-lactams [12–14]. Recently, mutations in yjbH were identified in invasive strains of S. aureus sequenced from human infections [15]. While the role of YjbH in virulence is becoming clearer, mechanistically how this protein modulates virulence is still poorly understood. YjbH has been characterized as an adapter protein for the stress response regulator Spx in several bacteria [16–18]. Under non-stress conditions, YjbH binds Spx and targets it for degradation via the ClpXP proteolytic system [16–21]. During stress, YjbH aggregates, leading to its disengagement with Spx, which then regulates gene expression. While the full extent of the YjbH/Spx regulon is not well described in S. aureus, it interplays with several other systems including the alternate sigma factor, σB and the MazEF toxin-antitoxin system [8,9,18].
One central virulence factor to S. aureus pathogenesis is α-hemolysin (Hla), a pore-forming toxin that can lyse a variety of host cells [22] and activate the NLRP3 inflammasome [23]. Hla is critical for S. aureus pathogenicity in a multitude of infection models and is essential for surface tissue damage during skin infection [24–31]. While Hla expression is impacted by several regulatory networks, activation of its promoter is primarily controlled by and is a direct target of the SaeRS two-component system [32–34]. Additionally, Hla is subject to post-transcriptional control, and cannot be efficiently translated without the Agr-dependent regulatory RNA, RNAIII [35,36].
In this study, we discovered that YjbH is critical for tissue damage during a model of S. aureus skin infection. We found that in the absence of YjbH, there is a concomitant significant decrease in Hla expression and activity compared to its parent strain in vitro, and a significant attenuation in Hla production in vivo, which likely accounts for the changes in tissue damage. The impact of YjbH on Hla production likely occurs through alterations in the activity of the Agr quorum sensing system. These data further demonstrate the importance of YjbH in the ability of S. aureus to cause disease.
Materials and methods
Bacterial strains and growth conditions
Unless otherwise stated, S. aureus strains (Table 1) were grown in tryptic soy broth (TSB, BD cat. #211822) with or without agar, as needed. When necessary, media was supplemented with trimethoprim (10 µg mlL−1), chloramphenicol (10 µg mL−1), and/or erythromycin (5 µg mL−1). Plates were grown at 37°C in a static incubator, and all cultures were grown at 37°C with a 1:10 media-to-flask volume ratio and shaken at 250 rpm. E. coli strains were grown in lysogeny broth (LB) with or without agar supplemented with ampicillin (100 µg mL−1) when needed.
Table 1.
Staphylococcus aureus strains and plasmids used in this study.
| Strain or Plasmid | Relevant characteristicsa | Source or reference |
|---|---|---|
| Bacterial Strains | ||
| RN4220 | Highly transformable S. aureus | [37] |
| AH1263 | USA300 CA-MRSA strain LAC lacking LAC-p03; wild-type strain used for these studies | [38] |
| JLB15 | AH1263 saeR::Tn, referred to as saeR | [39] |
| JLB24 | AH1263 hla::Tn | [40] |
| JLB110 | AH1263 ΔyjbIH | [8] |
| JLB134 | AH1263 ΔyjbI | [8] |
| JLB145 | AH1263 yjbH::Tn | [8] |
| JLB147 | AH1263 ΔyjbH | [8] |
| JLB323 | AH1263 ΔyjbIH hla::Tn | This study |
| JLB316 | AH1263 ΔRNAIII-agrBDCA | [41] |
| JLB331 | AH1263 ΔsaeRS | [42] |
| JLB362 | RN4220 Phla-lux | This study |
| JLB366 | AH1263 Phla-lux | This study |
| JLB367 | AH1263 ΔyjbIH Phla-lux | This study |
| JLB368 | AH1263 ΔRNAIII-agrBDCA Phla-lux | This study |
| JLB371 | AH1263 ΔsaeRS Phla-lux | This study |
| Plasmids | ||
| pCP4 | yjbIH pKK22-based complementation plasmid, referred to as pyjbIH | [8] |
| pCP5 | yjbH pKK22-based complementation plasmid, referred to as pyjbH | [8] |
| pCP6 | yjbI pKK22-based complementation plasmid, referred to as pyjbI | [8] |
| pCP20/pRKC1032 | Ppsmα-lacZ | [43] |
| pCP25 | hla under control of non-native promoter | This study |
| pJB1017 | Phla-lacZ reporter | [39] |
| pJB1018 | Pcoa-lacZ reporter | [39] |
| pJB1063 | lux system in pJC1112 | This study |
| pJB1066 | Hla lux reporter (Phla-lux) | This study |
| pJC1112 | ErmR plasmid that integrates into SapI1 | [44] |
| pKK22 | TmpR complementation plasmid | [24] |
| pRN7023 | Helper plasmid for SapI1 integration | [45] |
| pHC125 | luxCDABEG chromosomal integration plasmid for φ11 attachment site | [46] |
aTn indicates the insertion of the Bursa aurealis transposon from the Nebraska Transposon Mutant Library.
Construction of plasmids
Primers (Table 2) were synthesized by IDT, Inc. Plasmids were first generated and confirmed in E. coli DH5α or DH5αλpir (for pKK22-based plasmids) by restriction digest using New England Biolabs enzymes. Inserts were sequenced by ACGT, Inc. to ensure no unintended mutations occurred. Next, plasmids were transferred into S. aureus RN4220 by electroporation [37], with subsequent movement between S. aureus strains performed via ϕ11-mediated transduction as previously described [47].
Table 2.
Oligonucleotides used in this study.
| Name | Sequencea | Source or reference |
|---|---|---|
| CP14 | GCTAGGGCGATGTTATCAAAGTTGG | This study |
| JBPRO4 | CGATCCATTTAGCTCCGATTGCTTC | This study |
| CP114 | GCGAATTCCTAATCTCTCGCATAATTGCTTATG | [43] |
| CP115 | GAAGTCGACTAAGATTACCTCCTTTGCTTATGAGT | [43] |
| CP121 | gttACGCGTTTAATTTGTCATTTCTTCTTTTTCCCAATCG | This study |
| CP126 | ttaACGCGTCAAATCGTTTTAAAAAATAGAAGGATGATGAAA | This study |
| JBLUX1 | GCACGTGAAAGATTTTGTAGTGAAAGAGATGCAAG | This study |
| JB22 | ccgctagcCATTTTCATCATCCTTCTATTTTTTAAAACGG | [24] |
| JBKU145 | cacgaattCTTTATGAAACAAGGAAAAGACATAGC | This study |
| JCO717 | GTGCTTCACCAGCACCACATGCTG | [44] |
| JCO719 | GGTATTAGTTTGAGCTGTCTTGGTTCATTGATTGC | [44] |
aPrimer sequences are provided 5’ to 3,’ lowercase indicates non-homologous bases added for cloning purposes.
To construct the hla complementation plasmid with a non-native promoter, pCP25, the hla gene and Shine Dalgarno site were amplified from AH1263 using primers CP121 and CP126. The resulting product was digested with MluI and cloned into pKK22 digested with AscI. This places hla downstream of the PsarAP1 promoter and dfrA gene. This plasmid was then moved into JLB24 (hla::Tn), and JLB323 (ΔyjbIH hla::Tn).
The generation of the lacZ-reporter plasmid, pCP20, was partially described previously and named pRKC1032 [43]. For clarity, it is provided here with additional details. The psmα promoter was amplified from AH1263 using primers CP114 and CP115. The resulting product was digested with EcoRI and SalI and cloned into the same sites of pJB185.
Construction of mutant strains
To construct the ΔyjbIH hla::Tn mutant, ϕ11 was propagated on JLB24 (hla::Tn) and used to transduce the mutation into JLB110 (ΔyjbIH) [47]. This created the strain named JLB323 and confirmed using primers CP14 and JBPRO4.
For the lux reporter strains, a custom lux reporter construct was designed based on pHC125 and synthesized by GeneScript. The construct has luxCDEG constitutively expressed from Pcp25 and Pcap as in pHC125. They are followed by a Rho-independent transcriptional terminator and a multiple cloning site. The luxAB genes follow the multiple cloning site to allow promoter insertion. There is a second Rho-independent transcriptional terminator after luxB. This custom-designed and synthesized construct was cloned into pJC1112 to generate pJB1063, which inserts into the SapI1 site in the presence of the pRN7023 helper plasmid. Next, the hla promoter, including the RNAIII binding sequence, was synthesized and cloned into the PstI and NheI sites of pJB1063 such that the native ATG codon of Hla is the first codon of luxA, generating pJB1066. This plasmid was electroporated into S. aureus RN4220 containing pRN7023 to create JLB362 and integration was confirmed with JCO717 and JCO719. The integrated pJB1066 was transduced into AH1263. To create the reporter and control strains used for experiments, ϕ11 was used to make phage on AH1263 containing pJB1066, and transduction was performed with AH1263, JLB110 (ΔyjbIH), JLB331 (ΔsaeRS), and JLB316 (ΔRNAIII-agrBDCA) to create JLB366, JLB367, JLB371, and JLB368, respectively. Final confirmation was performed with JBLUX1, JB22, and JBKU145.
β-galactosidase assays
Assays for lacZ reporters were performed as previously described [48]. Briefly, cells from 1-mL of culture were harvested at 6 h for Pcoa and Ppsmα, and 8 h for Phla, and then subsequently frozen at −80°C until the assay was performed. Cell pellets were resuspended in Z-Buffer and disrupted using 0.1 mm glass beads in 2-mL tubes using an MP Biomedicals FastPrep-24 5G homogenizer. Cell debris was pelleted, and an aliquot of cell suspension was used to determine protein content by Bradford Assay. A separate aliquot was then mixed with Z-buffer and ONPG and incubated at 37°C until slightly yellow, at which point 1 M NaCO3 was added to stop the reaction. Absorbance at 420 nm was used to measure activity, and modified Miller units were calculated using protein content as the equilibrator.
Making of the inocula for the infection model
Inoculums for infection models were prepared as previously described with modifications [49]. Bacteria were retrieved from −80°C freezer stocks and inoculated into 3 mL of TSB supplemented with antibiotics when needed. The culture was incubated at 37°C overnight with shaking at 250 rpm. The culture was then diluted 1:100 in 10 mL TSB in a 50-mL conical tube with a loose cap and grown for 3 h at 37°C with shaking at 250 rpm. Bacteria were pelleted at 4,000 × g for 10 min, washed with Dulbecco’s phosphate-buffered saline (DPBS) without calcium and magnesium, pelleted again, and resuspended to ~4 × 107 CFU per 50-μL injection. The CFU concentrations were confirmed by dilution plating. When using strains containing pCP25, inoculums were reduced by half due to high levels of Hla production.
Subcutaneous murine infection
All animal studies were conducted in strict accordance with approved protocol by the University of Kansas Medical Center Institutional Animal Care and Use Committee under ACUP number 2021–2613 and follow the ARRIVE guidelines. Nine-week-old female C57BL/6J mice (Jackson Laboratory) or SKH1 mice (Charles River Laboratories) were infected as previously described [49], with modifications. For C57BL/6J mice, the mice were depilated by mechanical shaving and Nair® and then moisturized for two subsequent days before infection. SKH1 mice were untreated. For infection, mice were anesthetized via isoflurane gas and were injected subcutaneously with ~4×107 CFU of bacteria in 50 μL of DPBS (without calcium and magnesium; Corning). Mice were monitored and photographed daily for the duration of the infection. On day 4, mice were euthanized by CO2 inhalation per the institutional protocol. Using calipers, 2.25 cm2 of skin was excised around the lesion area, then bisected, and minced. The tissue was placed in two lysing matrix H tubes (MP Biomedicals) containing 1.5 mL total of Hank’s balanced salt solution (HBSS; no cations) plus 0.2% (wt/vol) human serum albumin (A5843; Sigma Aldrich) and 10 mM HEPES. The samples were homogenized using a Fastprep-24 5 G (MP Biomedicals), according to the manufacturer’s protocols for the skin. The skin samples were then serially diluted in PBS for bacterial titer enumeration on TSA plates. The remaining homogenate was clarified by centrifugation at 10,000 × g for 10 min at 4°C. cOmplete protease inhibitor (Roche) and 0.8 mM EDTA (Fisher Chemical) were added to the supernatant, and the sample was aliquoted and stored at −80°C for future cytokine and chemokine analyses. For infections using the strains containing pCP25, the lesions exceeded the given area created by the calipers, so the lesions were excised with ~3 mm of uninfected skin and weighed before homogenization. This adjustment to tissue collection was also applied to animals used in live animal imaging.
To determine surface lesion size, photos were taken with a ruler in the frame. Then, using ImageJ (NIH), the overall lesion size was measured as well as the necrosis size. Lesion size was defined as the largest observable surface lesion and included both blanching of the skin and the necrotic scab-like surface, which was used to determine necrosis alone.
For IVIS studies, infected mice were anesthetized with isoflurane and placed into an isolation imaging chamber and locked and transferred into the main imaging chamber of an IVIS Spectrum. Luminescence was monitored at 24-h intervals until euthanasia. Images were analyzed, and luminescence was quantified using Living Image 4.0 software (Perkin Elmer).
Cytokine measurement
Frozen homogenates were thawed, and cytokines and chemokines were quantified using cytometric bead array assays (BD Biosciences) following the manufacturer’s recommendations on a BD FACS Aria. A custom flex set was compiled to quantify the following cytokines: KC (CXCL1), IL-6, MIP-1α (CCL3), TNF, MIP-1β (CCL4), IL-1β, GM-CSF, RANTES, IFN-γ, G-CSF, MCP-1 (CCL2), IL-17F, and IL-1α. The BD Enhanced Flex Set was used for IL-4 and IL-17A. As previously described [49], everything was performed according to the manufacturer’s protocol, and the data analysis was performed using FCS Express Version 7.4.3.
Quantitative hemolysis assay
Cells were grown overnight at 37°C with shaking at 250 rpm. First, the OD600 of the culture was determined using a Genesys 10S UV-Vis (Thermo Scientific) spectrophotometer for standardization. Next, the supernatant from 1 mL of culture was collected. The amount of supernatant added to the assay was corrected by OD600 when compared to WT S. aureus and volume was balanced with supplementation of TSB. The total 200 μl solution was mixed with 200 μl 2X Hemolysis buffer (10% NaCl, 1 M CaCl2) and 40 μl of Rabbit blood (in Citrate from Hemostat Labs). The samples were placed in a nutator and incubated at 37°C for 10 min. Unlysed cells were concentrated by centrifugation at 5,500 × g for 1 min. The supernatant was transferred to a 96-well plate, and OD543 was measured for detection of released heme.
Sample growth, preparation, and LC-MS/MS analysis of secreted proteins
Strains were struck on TSA (with antibiotic if carrying a plasmid) from frozen stock for isolated colonies. The following day, cultures were started from isolated colonies in 3 mLs TSB (±antibiotic) and grown overnight. Cell density was determined using a spectrophotometer (Genesys 10S UV-Vis, Thermo Scientific) at OD600. The samples were then diluted in TSB to OD600 = 0.1 in 12.5 mL of TSB in a 125-mL flask. The flasks were then grown as previously stated above for 8 h. The samples were then pelleted by centrifugation and cell-free supernatants were collected by filtration (33 mm, 0.22 μm PES syringe filter, Fisher Scientific)
Next, the supernatants were concentrated 10× using 3k MWCO protein concentrators (0.5 mL, Pierce). The retained sample was transferred to a fresh microcentrifuge tube for protein isolation and reduced with the addition of 0.5 M TCEP to a final concentration of 5 mM followed by incubation at 37°C for 30 min. Reduced samples were alkylated with the addition of 375 mM iodoacetamide to a final concentration of 10 mM followed by incubation in the dark at room temperature for 30 min. Ice-cold acetone was added to each sample to a volume ratio of 5:1. Samples were vortexed and stored at −20°C overnight. After precipitation, samples were centrifuged at 14,000 × g at 4°C for 10 min to pellet the proteins. The supernatant was removed, and the pellet was air-dried on the benchtop for 10 min. The proteins were resuspended in 50 mM TEAB pH 8, 2 mM CaCl2. Trypsin was added (500 ng), and the proteins were allowed to digest overnight at 37°C with shaking at 500 RPM (Thermomixer, Eppendorf). The digestion was quenched with the addition of 10% formic acid to a final concentration of 1%. Digested samples were centrifuged at 10,000 × g for 10 min to remove particulates, and the supernatant was transferred to a fresh tube and stored at −20°C until mass spectrometry analysis. Peptide concentration was measured using a Nanodrop spectrophotometer (Thermo Scientific) at 205 nm.
Samples were injected using the Vanquish Neo (ThermoFisher) nano-UPLC onto a C18 trap column (PepMap™ Neo Nano Trap, 0.3 mm × 5 mm, 5 µm particle size) using pressure loading. Peptides were eluted onto the separation column (PepMap™ Neo, 75 µm × 150 mm, 2 µm C18 particle size, ThermoFisher) before elution directly to the mass spectrometer. Briefly, peptides were loaded and washed for 5 min at a flow rate of 0.350 µL/min at 2% B (mobile phase A: 0.1% formic acid in water, mobile phase B: 80% ACN, 0.1% formic acid in water). Peptides were eluted over 100 min from 2% to 25% mobile phase B before ramping to 40% B in 20 min. The column was washed for 15 min at 100% B before re-equilibrating at 2% B for the next injection. The nano-LC was directly interfaced with the Orbitrap Ascend Tribrid mass spectrometer (ThermoFisher) using a silica emitter (20 µm i.d., 10 cm, CoAnn Technologies) equipped with a high field asymmetric ion mobility spectrometry (FAIMS) source. The data were collected by data-dependent acquisition with the intact peptide detected in the Orbitrap at 120,000 resolving power from 375 to 1500 m/z. Peptides with charge + 2-7 were selected for fragmentation by higher energy collision dissociation (HCD) at 28% NCE and were detected in the ion trap at rapid scan rate. Dynamic exclusion was set to 60 s after one instance. The mass list was shared between the FAIMS compensation voltages. FAIMS voltages were set at −45 (1.4 s), −60 (1 s), −75 (0.6 s) CV for a total duty cycle time of 3 s. Source ionization was set at +1700 V with the ion transfer tube temperature set at 305°C. Raw files were searched against the Staphylococcus aureus (strain USA300) protein database downloaded from UniProt on 09-22-2023 and a common contaminants database using Sequest in Proteome Discoverer 3.0 [50]. Abundances, abundance ratios, and p-values were exported to Microsoft Excel for further analysis.
Statistical analysis
All statistical analyses were performed using GraphPad Prism (version 10) or Proteome Discoverer 3.0 for LC-MS/MS. Individual figure legends convey the tests performed on individual experiments and data groups.
Results
YjbH contributes to tissue damage in a skin infection model
Our previous work found that a ΔyjbIH mutant had increased pathogenicity in a systemic infection model [8]. Since SSTIs are the most common type of S. aureus infection [51–55], we tested the importance of YjbIH in a mouse model of SSTI. To this end, we examined surface lesion formation during infection over the first 4 days. In contrast to the systemic infection where the absence of YjbH enhanced pathogenesis, in the skin model, the ΔyjbIH mutant had significantly smaller surface lesions (Supplementary Figure 1). This was true for the necrotic scab-like portion of the lesion (Figure 1a,c) and the total lesion (Supplementary Figure 2), which is the largest surface area that includes both blanching of the skin and the necrosis. At times, no surface lesion was apparent in ΔyjbIH mutant-infected mice, but the infection appeared as a subdermal abscess (Supplementary Figure 1). The decreased lesion size observed by the ΔyjbIH mutant could be restored with yjbIH provided on a plasmid (Figure 1c, Supplementary Figures 1, and 2a). The reduced lesion size was not the result of decreased colonization as there was no difference in bacterial titers at the site of infection (Figure 1b,d). To determine the relative contributions of YjbI and YjbH to the phenotype, we tested individual ΔyjbI and ΔyjbH mutants. YjbI had no discernable impact on lesion formation (Figure 1a, Supplementary Figures 1, 2c, and 3); however, the ΔyjbH mutant phenocopied the ΔyjbIH mutant with lower total lesion (Supplementary Figure 2b) and necrosis (Figure 1a,c). This mutant often presented as a subdermal abscess as well (Suplementary Figure 1). We observed a modest reduction in bacterial titers at the site of infection for the ΔyjbH mutant (Figure 1f). As with ΔyjbIH, the ΔyjbH mutant phenotype could be restored when yjbH was provided on a plasmid (Figure 1e,f and Supplementary 2b). To ensure the ΔyjbH mutant phenotype was not mouse-line specific, we performed the same model using SKH1 mice. Again, the ΔyjbIH mutant infection had significantly smaller lesions at 4 days post-infection (Supplementary Figure 4a,b) and no difference in bacterial titers (Supplementary Figure 4c). Together, these results demonstrate that YjbH is important for tissue damage during infection and results from factors unrelated to bacteria levels at the site of infection.
Figure 1.

YjbH contributes to tissue damage during SSTI. C57BL/6J were infected subcutaneously with wild type (WT), mutants in ΔyjbI, ΔyjbH, ΔyjbIH, and respective complement plasmids as indicated. (a,c,e) Shown as necrosis size over time. Symbols represent the mean (n = 5-8) with SEM. (b,d,f) bacterial titers enumerated on day four post-infection. Bars represent the mean with SEM. Each dot represents an individual mouse. Data is representative of at least three independent experiments. *, p < 0.05; **, p < 0.01 by two-tailed Mann-Whitney test compared to WT.
The lack of YjbH leads to a decrease in proinflammatory cytokines
Considering the reduced skin pathology observed in the ΔyjbH mutant compared to wild type, we anticipated an attenuation of the immune response. Thus, we quantified a variety of cytokines and chemokines related to inflammation, immune cell recruitment, and immune cell activation at the site of infection. From the panel measured, we found a significant decrease in proinflammatory cytokines IL-6 and TNF as well as hematopoietic growth factors GM-CSF and G-CSF that aid in the activation/potentiation of neutrophils and other leukocytes in the ΔyjbH mutant when compared to the wild-type strain (Figure 2). We also discovered that chemokines CCL2 (MCP-1), and CXCL1 (KC), which are involved in leukocyte trafficking, showed a significant attenuation in the ΔyjbH mutant. Additionally, we found a trend towards decreased IL-1β, CCL4 (MIP-1β), and CCL5 (Figure 2 & Supplementary Figure 5) though they did not reach significance. We were unable to perform statistical analyses on CCL5 (RANTES), but in contrast to wild-type infected mice, all mice infected with the ΔyjbH mutant had concentrations below the level of detection. Surprisingly, we found an increase (p = 0.07) in proinflammatory cytokines IL-17A and IL-17F (Supplementary Figure 7) which are important for the defense against extracellular pathogens and important for the host immune response during S. aureus skin infections [56–59]. Again, to show reproducibility across mouse lines, we performed the same analysis on select cytokines in our SKH1 mice. Akin to C57BL/6J mice results, SKH1 mice infected with the ΔyjbIH mutant also had significantly decreased levels of IL-6, TNF, and CXCL1. In this case, both CCL4 and IL-1β reached significance (Supplementary Figure 6). Together, these data demonstrate an altered immune environment during SSTI with the ΔyjbH mutant leading to less proinflammatory cytokines produced.
Figure 2.

Mice infected with ΔyjbH mutant have altered cytokines at the site of infection. Homogenized infected skin from mice in Figure 1e was analyzed by cytometric bead arrays. Each dot represents an individual mouse. Empty symbols are values outside the limit of quantification and were set at the max or min limit of quantification. # and ## indicate a significant difference of p < 0.05 or 0.01, respectively, compared to wild type (WT) by two-tailed Mann-Whitney test.
Activity and expression of α-hemolysin are decreased in ΔyjbIH and ΔyjbH mutants
Hla is the primary contributor to skin necrosis and hla mutants cause little to no surface lesions [26,60]. In addition, hla mutants have a modest decrease in bacterial titers at the site infection at this same time point [29], like that seen in the ΔyjbIH and ΔyjbH mutants. Therefore, we hypothesized that reduced lesion formation in the ΔyjbH mutants was due to decreased Hla production. To test this, we examined Hla activity in vitro. To this end, we performed a quantitative hemolysis assay using rabbit blood. Supernatants from the ΔyjbH and ΔyjbIH mutants had significantly reduced hemolytic activity compared to the wild type and resembled an hla mutant (Figure 3a). This phenotype could be restored by providing yjbH or yjbIH on a plasmid in the respective mutant strains. Consistent with skin necrosis resembling wild type in the ΔyjbI mutant, the hemolytic activity of this mutant was not significantly different when compared to wild type. These data demonstrate that YjbH is important for Hla activity.
Figure 3.

YjbH is important for α-hemolysin production. (a) supernatants were collected from indicated strains after overnight (15 h) growth and used in a quantitative hemolysis assay with rabbit blood. Bars represent the mean (n = 3) with SEM. (b) cells of indicated strains were collected at early stationary phase and used in a β-galactosidase assay to measure activity of a Phla –lacZ reporter. Bars represent the mean (n = 3) with SEM. Data is representative of ≥3 independent experiments. * and ** indicate p-value of p < 0.05 and p < 0.01, respectively, by t-test.
Since Hla is subject to regulation at the transcriptional and post-transcriptional levels, reduced Hla activity could be due to either of these possibilities. Therefore, we next wanted to identify if the attenuation in activity was due to lower levels of expression or just overall activity. To test this, we used a lacZ reporter of Hla expression that accounts for both Sae- and Agr-dependent regulation of Hla. Expression was examined during the transition from exponential to stationary-phase growth when Hla is highly expressed. Like Hla activity, we found that both the ΔyjbIH and ΔyjbH mutants had significantly decreased expression from this reporter, while YjbI did not impact expression (Figure 3b). Again, expression was restored by complementation on a plasmid. Together, these data demonstrate that YjbH is important for the production of Hla, and this occurs at either the transcriptional or translational level.
YjbH promotes Agr activity
Reduced Hla expression could result from changes in SaeRS or Agr activity since the hla promoter is activated by SaeR and translation of Hla requires RNAIII, which is Agr dependent. We hypothesized that one or both systems would have reduced activity in the ΔyjbH mutant, leading to decreased Hla expression. To test SaeRS’ role in regulation, we used a lacZ-reporter plasmid for Pcoa, whose expression is dependent on activated SaeR. We observed a modest but significant increase in Pcoa expression in the ΔyjbH mutant, which could not account for the loss of Hla expression (Figure 4a). To measure Agr activity, we used the promoter for the α phenol-soluble modulins (psmα) operon which is a direct target of Agr activation [61]. Expression from this promoter was significantly decreased in both the ΔyjbH and ΔyjbIH mutants, indicative of reduced Agr activity (Figure 4b). The ΔyjbI mutant was similar to the wild-type strain for both reporters (Figure 4a,b). To further determine if the Agr regulon is impacted by YjbH, we performed LC-MS on the secreted proteins of wild-type and ΔyjbH strains when grown in broth culture to late exponential phase. We observed a significant change in the abundance of a number of proteins in the ΔyjbH strain compared to wild-type (Supplementary Figure 6a). This included multiple proteins that are Agr regulated [36,62,63] (Supplementary Figure 6a,b), including but not limited to Hla (2-fold), SpA (6.5-fold), and multiple leukocidins and proteases (ranging from 2–6-fold). Furthermore, ΔyjbH containing the complement plasmid more closely resembled the wild-type strain (Supplementary Figure 6b). Together, these data support a model by which Agr activity is decreased in the absence of YjbH, leading to decreased RNAIII expression and a reduction in Hla translation.
Figure 4.

The absence of YjbH leads to increased Sae activity and decreased Agr activity. Strains containing plasmids with the (a) Pcoa-lacZ or (b) Ppsmα-lacZ reporters for Sae and Agr activity, respectively. Samples were taken at mid-exponential phase of growth (6 h) and used in a β-galactosidase assay. Data are representative from ≥ 3 independent experiments. Bars represent the mean (n = 3 for (a) and n = 4 for (b)) with SEM. *, **, and *** indicate p < 0.05, p < 0.01, and p < 0.001 by t-test, respectively.
Controlled expression of hla alleviates YjbH effects on tissue damage
Since the ΔyjbH mutant has reduced lesion formation during skin infection and reduced Hla activity (Figure 1 and 3), we predicted that if we expressed Hla from a non-native promoter, tissue damage during infection would be unaffected by the absence of YjbH. To do this, we cloned hla under the control of the sarA P1 promoter. The plasmid was then transferred to the hla and ΔyjbH hla mutants so that the only Hla produced was from our construct. First, we confirmed that these strains had equal hemolytic activity in vitro (Figure 5a). Next, we tested whether YjbH still impacted lesion size in vivo when hla was expressed from a non-native promoter. We observed no difference in necrotic lesion formation between these strains (Figure 5b) and did not observe a difference in bacterial titers at the site of infection (Figure 5c). These data demonstrate that equalizing Hla expression between wild-type and ΔyjbH mutant strains leads to equal pathology and the restoration of bacterial titers recovered after infection. This supports the model that decreased Hla expression is the cause of reduced lesion formation in the ΔyjbH mutant.
Figure 5.

Controlled expression of α-hemolysin restores lesion formation in the ΔyjbIH mutant. (a) supernatants from overnight (15 hr) cultures of the hla mutant or ΔyjbIH hla mutant containing pCP25 (PsarA-hla) were used in a quantitative hemolysis using rabbit blood. An hla mutant without plasmid serves as a negative control. Bars represent the mean (n = 3) with SEM and are representative of ≥3 independent experiments. “ns” and ** indicate not significant or significant (p < 0.01) by t-test. (b & c) C57BL/6J mice were infected with the hla mutant or ∆yjbIH hla mutant containing PsarA-hla and (b) necrosis measured for 4 days and (c) bacterial titers enumerated at 4 days post-infection. Data represent the mean (n = 12-13) with SEM. For panels B & C, no comparison between strains was statistically different by two-tailed Mann-Whitney test.
Hla expression is reduced in the ΔyjbIH mutant during skin infection
Together, our data support a model whereby YjbH is important for AgrA-mediated activation of Hla expression and that this contributes to tissue damage during infection. While in vitro results are valuable, they do not always translate to in vivo responses. Therefore, we sought to monitor Hla expression during infection. To this end, we developed a bioluminescent reporter for Hla that included the native promoter, RNAIII-binding sequence, and the native Shine Dalgarno sequence. This construct (Supplementary Figure 7) was moved into wild type and ΔyjbIH as well as the negative control strains ΔsaeRS and Δagr. First, we tested these strains in vitro and showed that they behaved as expected, i.e., there was less luminescence in vitro for ΔyjbIH, ΔsaeRS, and Δagr (Figure 6a). Next, we performed our skin infection model. Bioluminescence, indicative of Hla expression, was highest at 1- and 2 days post-infection and declined afterward in the wild-type strain (Figure 6b). As expected, the bioluminescence of the Δagr and ΔsaeRS mutants was similar to background readings. The ΔyjbIH strain had significantly reduced bioluminescence, demonstrating a significant attenuation in Hla expression during skin infection. The strains behaved similarly to their parent strain (i.e. non-lux-containing strains) when it came to necrotic lesion formation (Figure 6c) and small attenuation in overall bacterial titers (Figure 6d) when compared to the WT strain. Overall, these data support the model that YjbH is important for Hla production both in vitro and in vivo and this contributes to pathology during an SSTI.
Figure 6.

YjbH is critical for α-hemolysin production during skin infection. (a) indicated strains expressing a Phla-lux reporter were grown in TSB until late exponential phase and relative luminescence were measured using a Tecan Spark plate reader. Bars represent the mean (n = 4) with SEM. (b-d) C57BL/6J mice were infected with indicated strains expressing Phla-lux reporter and (b) luminescence measured as photons per second using IVIS, (c) necrosis sized monitored, and (d) bacterial titers at the site of infection determined at 4 days post-infection. For b-c, data represents the mean (n = 10) with SEM. For d, each dot is an individual mouse, and the bars represent the mean (n = 10) with SEM. * p < 0.05; **, p < 0.01; ****, p < 0.0001 by t-test for panel a or two-tailed Mann-Whitney test in b-d.
Discussion
This study sheds new light on the impact of YjbH on S. aureus virulence factor regulation and disease outcomes. We observed a substantial reduction in lesion and necrosis formation when YjbH was absent compared to the wild-type strain, alongside a significant decline in specific proinflammatory cytokines. The data supports a model whereby YjbH is critical for Hla production by S. aureus, impacting disease outcomes during S. aureus skin infection. This model is supported by our findings that 1) when YjbH is absent, S. aureus produces less Hla and there is less hemolytic activity, 2) ectopic expression of Hla from a non-native promoter removes the YjbH effect on Hla activity and tissue damage, and 3) the ΔyjbH mutant has less Hla expression in vivo. Furthermore, our study revealed that this is likely mediated through the Agr quorum sensing system since Hla production is lower and Ppsmα activity is reduced, which are both consistent with lower Agr activity. This is supported by proteomics demonstrating protein changes indicative of reduced Agr activity. These results underscore the pivotal role of YjbH in S. aureus’ pathogenic potential.
The impact of YjbI and YjbH on S. aureus virulence has been tested in several in vitro and in vivo models. A yjbH mutant of strain SH1000 has decreased survival in whole-human blood [9]. By contrast, a yjbI:Tn mutant showed enhanced survival when exposed to the murine macrophage-like cell line RAW 264.7 [11]. However, the transposon insertion in yjbI has a polar effect on yjbH, and this was not further explored. The finding that the yjbI::Tn would be resistant to macrophage killing is surprising since YjbH contributes to oxidative and nitrosative stress resistance [8,64]. The same yjbI::Tn mutant also had decreased pathogenicity in a silkworm model [11], which was later shown to be the result of the polar effect on yjbH [10]. Interestingly, virulence in this model was due to the role of YjbH in oxidative stress resistance. The role of YjbI and YjbH in mouse systemic models of infection remains unclear. The yjbI::Tn mutant was shown to have lower bacterial burdens in the heart and kidney, while a yjbH::Tn mutant only showed decreased titers in the heart [11]. This contrasts with our previous study, which identified no difference in the yjbI mutant and enhanced bacterial burdens in the kidneys and spleens during infection with a yjbIH mutant [8], a phenotype that was complementable. The discrepancy between these systemic infection studies could be due to either the use of different mouse strains or time points examined, as we used C57BL/6J mice and measured titers at 5–6 d.p.i. versus ICR mice at 1 d.p.i. In addition, we infected with log-phase cells, while the other study used overnight cultures. While more work is needed to fully understand how YjbIH contributes to disease outcomes, it is clear from these studies that the YjbIH system contributes to pathogenesis in a variety of infection models. Additionally, yjbH mutations have been found in clinical isolates from invasive human infections [15], lending support to increased virulence in some niches. We have found that in the absence of yjbH there are a variety of proinflammatory cytokines and chemokines that are reduced during infection. Based on our studies and others, YjbH is important to produce multiple virulence factors. Deciphering whether it is changes in secreted virulence factors or changes in oxidative and nitrosative stress resistance that are mainly responsible for changes in ΔyjbH mutant virulence awaits further investigation.
In our current study, we extended the examination of YjbI and YjbH in virulence to the skin infection model for the first time. In this context, YjbH contributes to pathogenesis. One consistent trend in different virulence studies is that YjbH is the major contributor to the observed phenotypes. Whether YjbH positively or negatively impacts infection outcomes likely results from differences in each niche. We now know that YjbH impacts the expression of a variety of virulence factors, and this occurs through multiple regulatory networks including Spx [8,9], Agr (shown here), and the alternate sigma factor B (σB) [8,9]. Both Agr and σB regulate the expression of multiple virulence factors, including toxins and proteases. This is now further supported by our proteomics data demonstrating an altered abundance of proteins known to be regulated by these systems. The PSMs are important virulence factors in S. aureus and are a direct target of Agr regulation [61]. They are of interest because they can lyse a variety of host cells and contribute to disease in several animal models [61,65–70]. Indeed, several studies have examined their contribution during skin infection and found varying levels of importance. Using our infection model, we have previously found a psmα mutant to have a modest impact on necrosis [43] which agrees with another recent study [68]. By contrast, hla mutants consistently generate little to no necrosis during S. aureus skin infection. Moreover, when ADAM10, the cellular receptor for Hla, is inhibited early during a wild-type infection, it reduces necrosis and prevents vascular damage during an SSTI model [71]. We cannot rule out a contribution of the PSMs or other virulence factors to the ΔyjbH mutant skin infection phenotype. However, our data suggests that changes in Hla expression drive altered pathology, and it is the key factor impacting tissue damage when YjbH is absent.
While not a direct component of our studies, the IVIS data from our wild-type strain provide several interesting insights into S. aureus gene expression, in vivo. First, the use of this IVIS reporter allows for the tracking of S. aureus virulence factor expression over time, which can be a powerful new tool in understanding S. aureus virulence. Second, Hla is primarily or maximally produced during the early stage of infection. This timing, perhaps not surprisingly, is when primary tissue damage is occurring. Expression of Hla decreases at 3 d.p.i. which also correlates to around peak necrotic lesion size which occurs at 3 d.p.i. (Figure 1 and 6). This implies that the inability of S. aureus to cause continued tissue damage is due to reduced Hla expression over time. Our reporter contains both the Sae-dependent hla promoter and the Agr-dependent aspects of Hla post-transcriptional regulation. Thus, it informs us that both Agr and SaeRS are important early during infection. However, these data cannot determine whether it is a decrease in one or both systems that leads to reduced Hla expression after the first 48 h of infection, i.e., which is limiting. One future goal is to develop new reporters that are singly SaeRS or Agr-dependent to test this relationship.
Using a combination of reporters and assays, our data supports a model whereby YjbH plays a critical role in Agr activation. However, the mechanism by which this occurs remains unknown. Our previous study [8] demonstrated that under the growth conditions used, the ΔyjbH mutant grows similarly to wild type. Again, we did not observe any growth concerns during this study, demonstrating that the “quorum” component of quorum sensing is not what leads to reduced Agr activity. This then questions what is short-circuiting the Agr system when YjbH is absent. One possibility is that YjbH is essential for basal Agr expression. This does not appear to be the case because the Ppsmα activity in the ΔyjbH mutant is not attenuated to the point of an agr mutant (Figure 4). This would suggest that YjbH suppresses the Agr positive feedback loop. This suppression would likely be due to effects on either the AgrC kinase or AgrA response regulator. YjbH and Spx are well described to respond to redox and thiol stress. Indeed, the CxxC motif within Spx impacts its activity. Spx, in turn, induces expression of thioredoxin which reduces disulfide bonds. Interestingly, AgrA also possesses reactive cysteines that modulate its activity [72]. It is tempting to speculate whether decreased Agr activity in a ΔyjbH mutant is due to these downstream effects. Alternatively, YjbH has been found in both Bacillus and Listeria monocytogenes to bind proteins other than Spx [19,73]. Thus, ΔyjbH phenotypes could occur independent of Spx and have not been examined in S. aureus. Deciphering the mechanism by which YjbH influences Agr activity and whether this relies on Spx is the focus of our future studies.
This study adds to our understanding of YjbH in S. aureus. It demonstrates a role for YjbH in the regulation of a key virulence factor that contributes to infection in a variety of animal models. It further demonstrates that of the proteins encoded by the operon, YjbH is the major contributor to phenotypes associated with yjbIH and yjbI::Tn mutants. We demonstrate here for the first time that YjbH influences Agr activity and adds to the growing evidence that this protein has pleiotropic effects by modulating the activity of several global regulators. Given the overlap and cross-regulation of these networks in S. aureus, deciphering the mechanism by which YjbH influences them is the focus of our future studies.
Supplementary Material
Funding Statement
This work was supported by NIH NIAID award AI156251 to J.L.B. and award MF-2104-01575 from The G. Harold and Leila Y. Mathers Foundation to M.T.P.
Disclosure statement
No potential conflict of interest was reported by the author(s).
Author contributions
AKG McReynolds was involved in study design, data generation, writing and editing manuscript. EA Pagella generated data and edited manuscript. MJ Ridder generated a key resource and performed experiments. O Rippee performed experiments. Z Clark and MJ Rekowski generated data and contributed to manuscript preparation. MT Pritchard secured funding to generate a key reagent. JL Bose was involved in study design, data generation, writing and editing manuscript, and secured funding. All authors have read and approved the final version of this manuscript.
Data availability statement
The mass spectrometry data that support the findings of this study are openly available in Mass Spectrometry Interactive Virtual Environment (MassIVE) at (https://massive.ucsd.edu/ProteoSAFe/static/massive.jsp), reference number MSV000094753 and at https://doi.org/doi:10.25345/C53X83X5J.
Supplemental data
Supplemental data for this article can be accessed online at https://doi.org/10.1080/21505594.2024.2399798
References
- [1].Harris-Tryon TA, Grice EA.. Microbiota and maintenance of skin barrier function. Science. 2022 May 27;376(6596):940–15. doi: 10.1126/science.abo0693 [DOI] [PubMed] [Google Scholar]
- [2].Nguyen AV, Soulika AM. The dynamics of the Skin’s immune system. Int J Mol Sci. 2019 Apr 12;20(8):1811. doi: 10.3390/ijms20081811 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [3].Tong SY, Davis JS, Eichenberger E, et al. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev. 2015. Jul;28(3):603–661. doi: 10.1128/CMR.00134-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [4].Knox J, Uhlemann AC, Lowy FD. Staphylococcus aureus infections: transmission within households and the community. Trends Microbiol. 2015. Jul;23(7):437–444. doi: 10.1016/j.tim.2015.03.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [5].Murray Ksi CJL, Sharara F, Swetschinski L, et al. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet. 2022 Feb 12;399(10325):629–655. doi: 10.1016/S0140-6736(21)02724-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Kourtis AP, Hatfield K, Baggs J, et al. Vital signs: epidemiology and recent trends in methicillin-resistant and in methicillin-susceptible Staphylococcus aureus bloodstream infections — United States. MMWR Morb Mortal Wkly Rep. 2019. Mar 8;68(9):214–219. doi: 10.15585/mmwr.mm6809e1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7].Vella V, Derreumaux D, Aris E, et al. The incidence of skin and soft tissue infections in the United States and associated health care utilization between 2010 and 2020. Open Forum Infect Dis. 2024;11(6). doi: 10.1093/ofid/ofae267 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Austin CM, Garabaglu S, Krute CN, et al. Contribution of YjbIH to virulence factor expression and host colonization in Staphylococcus aureus. Infect Immun. 2019. Jun;87(6). doi: 10.1128/IAI.00155-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [9].Donegan NP, Manna AC, Tseng CW, et al. CspA regulation of Staphylococcus aureus carotenoid levels and σ(B) activity is controlled by YjbH and Spx. Mol Microbiol. 2019. Aug;112(2):532–551. doi: 10.1111/mmi.14273 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Paudel A, Panthee S, Hamamoto H, et al. YjbH regulates virulence genes expression and oxidative stress resistance in Staphylococcus aureus. Virulence. 2021. Dec;12(1):470–480. doi: 10.1080/21505594.2021.1875683 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11].Paudel A, Hamamoto H, Panthee S, et al. Large-scale screening and identification of novel pathogenic Staphylococcus aureus genes using a silkworm infection Model. J Infect Dis. 2020;221(11):1795–1804. doi: 10.1093/infdis/jiaa004 [DOI] [PubMed] [Google Scholar]
- [12].Göhring N, Fedtke I, Xia G, et al. New role of the disulfide stress effector YjbH in β-lactam susceptibility of Staphylococcus aureus. Antimicrob Agents Chemother. 2011. Dec;55(12):5452–5458. doi: 10.1128/AAC.00286-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [13].Renzoni A, Andrey DO, Jousselin A, et al. Whole genome sequencing and complete genetic analysis reveals novel pathways to glycopeptide resistance in Staphylococcus aureus. PLOS ONE. 2011;6(6):e21577. doi: 10.1371/journal.pone.0021577 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [14].Nielsen TK, Petersen IB, Xu L, et al. The Spx stress regulator confers high-level β-lactam resistance and decreases susceptibility to last-line antibiotics in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2024 May 1:e0033524. doi: 10.1128/aac.00335-24 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15].Giulieri SG, Guérillot R, Duchene S, et al. Niche-specific genome degradation and convergent evolution shaping Staphylococcus aureus adaptation during severe infections. eLife. 2022. Jun 14;11. doi: 10.7554/eLife.77195 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Garg SK, Kommineni S, Henslee L, et al. The YjbH protein of Bacillus subtilis enhances ClpXP-catalyzed proteolysis of Spx. J Bacteriol. 2009. Feb;191(4):1268–1277. doi: 10.1128/JB.01289-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [17].Engman J, Rogstam A, Frees D, et al. The YjbH adaptor protein enhances proteolysis of the transcriptional regulator Spx in Staphylococcus aureus. J Bacteriol. 2012. Mar;194(5):1186–1194. doi: 10.1128/JB.06414-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18].Panasenko OO, Bezrukov F, Komarynets O, et al. YjbH solubility controls Spx in Staphylococcus aureus: implication for MazEF toxin-antitoxin system regulation. Front Microbiol. 2020;11:113. doi: 10.3389/fmicb.2020.00113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [19].Kommineni S, Garg SK, Chan CM, et al. YjbH-enhanced proteolysis of Spx by ClpXP in Bacillus subtilis is inhibited by the small protein YirB (YuzO). J Bacteriol. 2011. May;193(9):2133–2140. doi: 10.1128/JB.01350-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [20].Awad W, Al-Eryani Y, Ekström S, et al. Structural basis for YjbH adaptor-mediated recognition of transcription factor Spx. Structure. 2019 Jun 4;27(6):923–936.e6. doi: 10.1016/j.str.2019.03.009 [DOI] [PubMed] [Google Scholar]
- [21].Donegan NP, Marvin JS, Cheung AL. Role of adaptor TrfA and ClpPC in controlling levels of SsrA-tagged proteins and antitoxins in Staphylococcus aureus. J Bacteriol. 2014. Dec;196(23):4140–4151. doi: 10.1128/JB.02222-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [22].Nygaard TK, Pallister KB, DuMont AL, et al. Alpha-toxin induces programmed cell death of human T cellsAlpha-toxin induces programmed cell death of human T cells, B cells, and monocytes during USA300 infection [Research Support, N.I.H. extramural. Research Support, Non-U.S. Gov’t]. PLOS ONE. 2012;7(5):e36532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [23].Craven RR, Gao X, Allen IC, et al. Staphylococcus aureus alpha-hemolysin activates the NLRP3-inflammasome in human and mouse monocytic cells. PLOS ONE. 2009 Oct 14;4(10):e7446. doi: 10.1371/journal.pone.0007446 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Krute CN, Krausz KL, Markiewicz MA, et al. Generation of a stable plasmid for in vitro and in vivo studies of Staphylococcus species. Appl Environ Microbiol. 2016 Dec 1;82(23):6859–6869. doi: 10.1128/AEM.02370-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [25].Inoshima N, Wang Y, Bubeck Wardenburg J. Genetic requirement for ADAM10 in severe Staphylococcus aureus skin infection. J Invest Dermatol. 2012. May;132(5):1513–1516. doi: 10.1038/jid.2011.462 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [26].Tkaczyk C, Hua L, Varkey R, et al. Identification of anti-alpha toxin monoclonal antibodies that reduce the severity of Staphylococcus aureus dermonecrosis and exhibit a correlation between affinity and potency. Clin Vaccine Immunol. 2012. Mar;19(3):377–385. doi: 10.1128/CVI.05589-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [27].Berube BJ, Sampedro GR, Otto M, et al. The psmα locus regulates production of Staphylococcus aureus alpha-toxin during infection. Infect Immun. 2014. Aug;82(8):3350–3358. doi: 10.1128/IAI.00089-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [28].Ziesemer S, Kuhn SO, Hahnenkamp A, et al. Staphylococcus aureus Alpha-Toxin in deep tracheal aspirates—preliminary evidence for its presence in the lungs of sepsis patients. Toxins (Basel). 2022 Jun 30;14(7):450. doi: 10.3390/toxins14070450 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [29].Ridder MJ, Daly SM, Triplett KD, et al. Staphylococcus aureus fatty acid kinase FakA modulates pathogenesis during skin infection via proteases. Infect Immun. 2020 Jul 21;88(8). doi: 10.1128/IAI.00163-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Powers ME, Becker RE, Sailer A, et al. Synergistic action of Staphylococcus aureus α-toxin on platelets and myeloid lineage cells contributes to lethal sepsis. Cell Host Microbe. 2015 Jun 10;17(6):775–787. doi: 10.1016/j.chom.2015.05.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [31].Kennedy AD, Bubeck Wardenburg J, Gardner DJ, et al. Targeting of alpha-hemolysin by active or passive immunization decreases severity of USA300 skin infection in a mouse model. J Infect Dis. 2010 Oct 1;202(7):1050–1058. doi: 10.1086/656043 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Gudeta DD, Lei MG, Lee CY, et al. Contribution of hla regulation by SaeR to Staphylococcus aureus USA300 pathogenesis. Infect Immun. 2019. Sep;87(9). doi: 10.1128/IAI.00231-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [33].Sun F, Li C, Jeong D, et al. In the Staphylococcus aureus two-component system sae, the response regulator SaeR binds to a direct repeat sequence and DNA binding requires phosphorylation by the sensor kinase SaeS. J Bacteriol. 2010. Apr;192(8):2111–2127. doi: 10.1128/JB.01524-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34].Nygaard TK, Pallister KB, Ruzevich P, et al. SaeR binds a consensus sequence within virulence gene promoters to advance USA300 pathogenesis. J Infect Dis. 2010 Jan 15;201(2):241–254. doi: 10.1086/649570 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [35].Morfeldt E, Taylor D, von Gabain A, et al. Activation of alpha-toxin translation in Staphylococcus aureus by the trans-encoded antisense RNA, RNAIII. Embo J. [1995 Sep 15];14(18):4569–4577. doi: 10.1002/j.1460-2075.1995.tb00136.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36].Cheung GY, Wang R, Khan BA, et al. Role of the accessory gene regulator agr in community-associated methicillin-resistant Staphylococcus aureus pathogenesis. Infect Immun. 2011. May;79(5):1927–1935. doi: 10.1128/IAI.00046-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [37].Kreiswirth BN, Löfdahl S, Betley MJ, et al. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature. 1983 Oct 20–26;305(5936):709–712. doi: 10.1038/305709a0 [DOI] [PubMed] [Google Scholar]
- [38].Boles BR, Thoendel M, Roth AJ, et al. Identification of genes involved in polysaccharide-independent Staphylococcus aureus biofilm formation. PLOS ONE. 2010;5(4):e10146. doi: 10.1371/journal.pone.0010146 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [39].Krute CN, Rice KC, Bose JL, et al. VfrB is a key activator of the Staphylococcus aureus SaeRS two-component system. J Bacteriol. 2017 Mar 1;199(5). doi: 10.1128/JB.00828-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [40].Bose JL, Daly SM, Hall PR, et al. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus. Infect Immun. 2014. May;82(5):1813–1822. doi: 10.1128/IAI.01655-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [41].Brandwein JN, Sculthorpe TS, Ridder MJ, et al. Factors impacting the regulation of nos gene expression in Staphylococcus aureus. Microbiol Spectr. 2023 Sep 25;11(5):e0168823. doi: 10.1128/spectrum.01688-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [42].DeMars ZR, Krute CN, Ridder MJ, et al. Fatty acids can inhibit Staphylococcus aureus SaeS activity at the membrane independent of alterations in respiration. Mol Microbiol. 2021. Nov;116(5):1378–1391. doi: 10.1111/mmi.14830 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [43].Briaud P, Zapf R, Mayher A, et al. The small RNA Teg41 is a pleiotropic regulator of virulence in Staphylococcus aureus. Infect Immun. 2022;90(11). in press. doi: 10.1128/iai.00236-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [44].Chen J, Yoong P, Ram G, et al. Single-copy vectors for integration at the SaPI1 attachment site for Staphylococcus aureus. Plasmid. 2014. Nov;76:1–7. doi: 10.1016/j.plasmid.2014.08.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [45].Ruzin A, Lindsay J, Novick RP. Molecular genetics of SaPI1–a mobile pathogenicity island in Staphylococcus aureus. Mol Microbiol. 2001. Jul;41(2):365–377. doi: 10.1046/j.1365-2958.2001.02488.x [DOI] [PubMed] [Google Scholar]
- [46].Miller RJ, Crosby HA, Schilcher K, et al. Development of a Staphylococcus aureus reporter strain with click beetle red luciferase for enhanced in vivo imaging of experimental bacteremia and mixed infections. Sci Rep. 2019 Nov 13;9(1):16663. doi: 10.1038/s41598-019-52982-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [47].Krausz KL, Bose JL. Bacteriophage transduction in Staphylococcus aureus: broth-based method. Methods Mol Biol. 2016;1373:63–68. [DOI] [PubMed] [Google Scholar]
- [48].Lehman MK, Bose JL, Sharma-Kuinkel BK, et al. Identification of the amino acids essential for LytSR-mediated signal transduction in Staphylococcus aureus and their roles in biofilm-specific gene expression. Mol Microbiol. 2015. Feb;95(4):723–737. doi: 10.1111/mmi.12902 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [49].Ridder MJ, McReynolds AKG, Dai H, et al. Kinetic characterization of the immune response to methicillin-resistant Staphylococcus aureus subcutaneous skin infection. Infect Immun. 2022. Jul 21;90(7):e0006522. doi: 10.1128/iai.00065-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [50].Orsburn BC. Proteome discoverer—A community enhanced data processing suite for protein informatics. Proteomes. 2021 Mar 23;9(1):15. doi: 10.3390/proteomes9010015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [51].Talan DA, Krishnadasan A, Gorwitz RJ, et al. Comparison of Staphylococcus aureus from skin and soft-tissue infections in US emergency department patients, 2004 and 2008. Clin Infect Dis. 2011 Jul 15;53(2):144–149. doi: 10.1093/cid/cir308 [DOI] [PubMed] [Google Scholar]
- [52].Suaya JA, Mera RM, Cassidy A, et al. Incidence and cost of hospitalizations associated with Staphylococcus aureus skin and soft tissue infections in the United States from 2001 through 2009. BMC Infect Dis. 2014 Jun 2;14(1):296. doi: 10.1186/1471-2334-14-296 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [53].Ray GT, Suaya JA, Baxter R. Incidence, microbiology, and patient characteristics of skin and soft-tissue infections in a U.S. population: a retrospective population-based study. BMC Infect Dis. 2013 May 30;13(1):252. doi: 10.1186/1471-2334-13-252 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [54].Moran GJ, Krishnadasan A, Gorwitz RJ, et al. Methicillin-resistant S. aureus infections among patients in the emergency department. N Engl J Med. 2006 Aug 17;355(7):666–674. doi: 10.1056/NEJMoa055356 [DOI] [PubMed] [Google Scholar]
- [55].Hatlen TJ, Miller LG. Staphylococcal skin and soft tissue infections. Infect Dis Clin North Am. 2021. Mar;35(1):81–105. doi: 10.1016/j.idc.2020.10.003 [DOI] [PubMed] [Google Scholar]
- [56].Marchitto MC, Dillen CA, Liu H, et al. Clonal Vγ6(+)Vδ4(+) T cells promote IL-17-mediated immunity against Staphylococcus aureus skin infection. Proc Natl Acad Sci USA. 2019 May 28;116(22):10917–10926. doi: 10.1073/pnas.1818256116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [57].Cho JS, Pietras EM, Garcia NC, et al. IL-17 is essential for host defense against cutaneous Staphylococcus aureus infection in mice. J Clin Invest. 2010. May;120(5):1762–1773. doi: 10.1172/JCI40891 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [58].Moos S, Regen T, Wanke F, et al. IL-17 signaling in keratinocytes orchestrates the defense against Staphylococcus aureus skin infection. J Invest Dermatol. 2023. Jul;143(7):1257–1267.e10. doi: 10.1016/j.jid.2023.01.016 [DOI] [PubMed] [Google Scholar]
- [59].Miller LS, Cho JS. Immunity against Staphylococcus aureus cutaneous infections. Nat Rev Immunol. 2011 Jul 1;11(8):505–518. doi: 10.1038/nri3010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [60].Tkaczyk C, Hamilton MM, Datta V, et al. Staphylococcus aureus alpha toxin suppresses effective innate and adaptive immune responses in a murine dermonecrosis model. PLOS ONE. 2013;8(10):e75103. doi: 10.1371/journal.pone.0075103 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [61].Queck SY, Jameson-Lee M, Villaruz AE, et al. Rnaiii-independent target gene control by the Agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus. Mol Cell. 2008 Oct 10;32(1):150–158. doi: 10.1016/j.molcel.2008.08.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [62].Ziebandt AK, Weber H, Rudolph J, et al. Extracellular proteins of Staphylococcus aureus and the role of SarA and sigma B. Proteomics. 2001. Apr;1(4):480–493. doi: [DOI] [PubMed] [Google Scholar]
- [63].Podkowik M, Perault AI, Putzel G, et al. Quorum-sensing agr system of Staphylococcus aureus primes gene expression for protection from lethal oxidative stress. eLife. 2024. Apr 30;12. doi: 10.7554/eLife.89098 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [64].Grosser MR, Paluscio E, Thurlow LR, et al. Genetic requirements for Staphylococcus aureus nitric oxide resistance and virulence. PLOS Pathog. 2018. Mar;14(3):e1006907. doi: 10.1371/journal.ppat.1006907 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [65].Wang R, Braughton KR, Kretschmer D, et al. Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA. Nat Med. 2007. Dec;13(12):1510–1514. doi: 10.1038/nm1656 [DOI] [PubMed] [Google Scholar]
- [66].Grando K, Nicastro LK, Tursi SA, et al. Phenol-soluble modulins from Staphylococcus aureus biofilms form complexes with DNA to drive autoimmunity. Front Cell Infect Microbiol. 2022;12:884065. doi: 10.3389/fcimb.2022.884065 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [67].Damour A, Robin B, Deroche L, et al. Phenol-soluble modulins α are major virulence factors of Staphylococcus aureus secretome promoting inflammatory response in human epidermis. Virulence. 2021. Dec;12(1):2474–2492. doi: 10.1080/21505594.2021.1975909 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [68].Nguyen TH, Cheung GYC, Rigby KM, et al. Rapid pathogen-specific recruitment of immune effector cells in the skin by secreted toxins. Nat Microbiol. 2022. Jan;7(1):62–72. doi: 10.1038/s41564-021-01012-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [69].Yamazaki Y, Ito T, Tamai M, et al. The role of Staphylococcus aureus quorum sensing in cutaneous and systemic infections. Inflamm Regen. 2024 Mar 1;44(1):9. doi: 10.1186/s41232-024-00323-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [70].Zapf RL, Wiemels RE, Keogh RA, et al. The Small RNA Teg41 regulates expression of the alpha phenol-soluble modulins and is required for virulence in Staphylococcus aureus. MBio. 2019 Feb 5;10(1). doi: 10.1128/mBio.02484-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [71].Yang C, Robledo-Avila FH, Partida-Sanchez S, et al. α-hemolysin-mediated endothelial injury contributes to the development of Staphylococcus aureus-induced dermonecrosis. Infect immun. 2024. Jul 2. p. e0013324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [72].Sun F, Liang H, Kong X, et al. Quorum-sensing agr mediates bacterial oxidation response via an intramolecular disulfide redox switch in the response regulator AgrA. Proc Natl Acad Sci USA. 2012 Jun 5;109(23):9095–9100. doi: 10.1073/pnas.1200603109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [73].Ruhland BR, Reniere ML, Henkin TM. YjbH requires its thioredoxin active motif for the nitrosative stress response, cell-to-cell spread, and protein-protein interactions in Listeria monocytogenes. J Bacteriol. 2020 May 27;202(12). doi: 10.1128/JB.00099-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The mass spectrometry data that support the findings of this study are openly available in Mass Spectrometry Interactive Virtual Environment (MassIVE) at (https://massive.ucsd.edu/ProteoSAFe/static/massive.jsp), reference number MSV000094753 and at https://doi.org/doi:10.25345/C53X83X5J.
