Skip to main content
Brazilian Journal of Microbiology logoLink to Brazilian Journal of Microbiology
. 2024 May 31;55(3):2915–2922. doi: 10.1007/s42770-024-01401-2

Molecular detection and phylogenetic analysis of Borrelia Spp. In blood samples of cats and dogs by the nested-PCR method in West Azerbaijan Province, Iran

Abdolghaffar Ownagh 1, Sima Alempour Rajabi 1,, Ahmad Enferadi 1, Mojtaba Hadian 2
PMCID: PMC11405608  PMID: 38819772

Abstract

The objective of this study was to investigate the presence and genetic attributes of Borrelia spp. in cats and dogs from the West Azerbaijan Province, located in the northwest of Iran. A total of 250 blood samples from cats and 300 blood samples from dogs were collected, and information regarding their age, sex, breed, ownership status, sampling time and region was recorded. The identification of positive samples was accomplished through nested-PCR and sequencing, with subsequent analysis of the gene sequences conducted using BioEdit software. The gene sequences for Borrelia spp. in this study showed 100% similarity to reference sequences in the GenBank® database. Phylogenetic trees were built using MEGA11. The outcomes indicated that among 250 blood samples from cats, 48 (19.2%) tested positive for Borrelia spp. gene, with a CI from 14.8 to 24.53% for cats. Similarly, out of 300 blood samples from dogs, 45 (15%) tested positive for the Borrelia spp. gene, with a CI from 11.4 to 19.48% for dogs.

Keywords: Molecular detection, Borreliosis, Nested-PCR, Cat, Dog, Iran

Introduction

The Borrelia genus comprises multiple genospecies that impact both humans and animals, with certain species responsible for Lyme borreliosis (del Cerro, Oleaga et al. [9]). Lyme disease, primarily affecting humans, is predominantly found in temperate regions. Over 30,000 cases are reported annually to the US Center for Disease Control and Prevention (CDC) [21]. The spread of Lyme borreliosis is intricately connected to a variety of wildlife hosts that serve as sources of food, infection, and transportation for ticks. This, in turn, increases the risk of transmission in areas where the general public may come into contact with these infected ticks (Hansford, Wheeler et al. [15]). Dogs play a crucial role in the epidemiology of tick-borne diseases, particularly in regions where borreliosis is endemic, and they also serve as valuable indicators in epidemiological studies (Gonçalves, Cordeiro et al. [13]). Some argue that cats may not contract borreliosis due to their effective tick-removal mechanisms. Nevertheless, both naturally exposed and experimentally infested cat’s exhibit seroconversion, implying that infection can take place even if ticks are removed promptly. Currently, the evidence disproving borreliosis as a potential cause of clinical illness in cats is as inconclusive as the data supporting its causation (Littman, Gerber et al. [20]).

Tick-borne relapsing fever (TBRF) was originally documented by Dschunkowsky in the Ardabil region of Iran, leading to its designation as Borrelia persica [2]. In Iran, TBRF is an established, endemic condition caused by Borrelia genus belonging to the spirochetal agents. It is transmitted by soft ticks, primarily from the Argasidae family, with a particular focus on the Ornithodoros genus (Shirani, Rakhshanpoor et al. [26]). In a descriptive and retrospective study spanning from 1997 to 2006, Masoumi et al. found evidence that tick-borne diseases were identified in humans across 18 out of the 31 provinces in Iran (Asl, Goya et al. [1]). Furthermore, these reports suggest that Lyme disease and relapsing fever could be classified as emerging diseases within the country (Khoobdel, Jafari et al. [18]).

Borrelia virulence involves multiple mechanisms of dissemination and colonization in various tissues as well as evasion of the host immune responses (Coburn, Garcia et al. [6]). Research suggests that a history of prior exposure to the Borrelia bacterium may increase the susceptibility to severe COVID-19 (Szewczyk-Dabrowska, Budziar et al. [28]) indicating a potential connection between an elevated risk of severe COVID-19 and a history of tick bites and associated infections (Szewczyk-Dąbrowska, Budziar et al. [29]). This may be assisted by the shift of the immune system’s focus on to the SARS-CoV-2 virus, coupled with the simultaneous suppression of Borrelia using antibiotics and the administration of hydroxychloroquine which is known for its immunosuppressive properties (Shutikova, Leonova et al. [27]).

Among the various diagnostic tests available for Lyme disease in dogs, including ELISA and indirect fluorescence antibody (IFA), PCR stands out as the most sensitive and specific assay. It is excellent at detecting Borrelia spp. and can distinguish between an active infection and past exposure (Usman, Durrani et al. [31]). The classification of Borrelia spirochetes’ genospecies and genetic diversity has relied on genes such as 5–23 S, flagellin, ospA, and ospC. Importantly, the 5–23 S gene is highly conserved and displays specificity for each genospecies (Seo, Kwon et al. [25]).

Tick-borne pathogens have been documented in various parts of Iran, with the western region showing a notably higher infection rate compared to other areas. This increased prevalence can be attributed to several factors, including a large livestock population, shared borders with neighboring countries, and traditional livestock management practices that lack proper hygiene measures (Khoobdel, Jafari et al. [18]). Therefore, the objective of this study was to conduct genomic screening and phylogenetic analysis of Borrelia spp. in blood samples obtained from cats and dogs in the West Azerbaijan province of Iran.

Materials and methods

Study area

West Azerbaijan Province is located in the northwestern region of Iran, on the shores of Lake Urmia, precisely at coordinates 37° 33′ 10.08″ N latitude and 45° 4′ 33.24″ E longitude (Fig. 1). Based on available meteorological data, there is variation in local temperatures within the province. The average temperature ranges from 9.4 °C in Piranshahr to 11.6 °C in Mahabad, with Urmia at 9.8 °C and Khoy at 10.8 °C. According to the same dataset, the highest temperature recorded in the province is 34 °C in July, while the lowest temperature may drop to -16 °C in January (http://a-gharbi.rmto.ir/English/Pages/Introduction.aspx).

Fig. 1.

Fig. 1

A map illustrating the location of West Azerbaijan province, Iran (Enferadi, Ownagh et al. [11])

Sampling and data collection

Blood samples were collected from a total of 250 cats and 300 dogs in nine different cities of West Azerbaijan Province between January 2023 and June 2023. Aseptic techniques were rigorously applied to extract 2 mL of blood, drawn from either the saphenous or cephalic vein. These blood samples were then placed into EDTA-treated tubes and stored at -20 °C until the DNA extraction process was carried out.

Comprehensive records were meticulously maintained for each animal, including their age, sex, breed; ownership status, region, and the specific sampling time (cold or warm month). During the study, the sampled animals were categorized into two age groups: those aged ≤ 2 years and those older than 2 years. The categorization of breeds for both cats and dogs differentiated between long-haired and short-haired breeds. Long-haired dog breeds encompassed Shih Tzu, Terrier, totaling 170 dogs. On the other hand, short-haired dog breeds comprised Pointer, Doberman Pinscher, and German Shepherd, totaling 130 dogs. A similar classification was applied to cats, distinguishing between short-haired breed cats such as Domestic Short Hair (DSH) cats totaling 150 cats additionally, long-haired cats included Scottish Fold, Persian cats, and Turkish Van cats totaling 100 cats. Furthermore, the animals were categorized as either strays or pets.

In the West Azerbaijan Province, the sampling region was divided into three areas: the North, Central, and South of West Azerbaijan Province. This included a total of n = 75 cats and n = 75 dogs from Makou, Poldasht, and Khoy in the northern region, n = 100 cats and n = 150 dogs from Urmia, Piranshahr, and Naqadeh in the central region, and n = 75 cats and n = 75 dogs from Shahin Dezh, Bukan, and Mahabad in the southern region. The sampling time was categorized as “Cold Months” and “Warm Months.” The Cold Months, representing winter, spanned from January to March, while the Warm Months, signifying spring, extended from April to June within this region.

DNA extraction from blood samples

DNA was obtained from feline and canine blood samples by utilizing the Blood Genomic DNA Extraction Mini Kit (Denazist Company, Iran) following the manufacturer’s guidelines. The quality and quantity of the extracted DNA were subsequently assessed through Nano Drop 2000c (Thermo Scientific, USA). To ensure quality, all isolated DNA samples were subjected to gel electrophoresis and were then stored at -20 °C for future experimental use.

Nested-PCR for molecular detection of Borrelia spp

Nested PCR was performed using primers specific for Borrelia spp. (5–23 S rRNA). A negative control was set up for PCR using nuclease-free distilled water. The primer sequences, designed using Oligo7 software, and the nested-PCR conditions are detailed in Table 1.

Table 1.

Primer sequences for detection of Borrelia spp. by nested-PCR.

Species Target gene Primer Name Sequence
5’----3’
PCR condition PCR product size (bp)
Borrelia spp. 5 S rRNA-1 Borrelia spp.-F ACGGTCCTAAGGTAGCGAAATTCC 95 °C for 4 min, 32 cycles− 95 °C for 55 s, temperature transition phase from 66 °C to 63 °C for 5 cycles and 55 s each time, 72 °C for 55 s concluded each cycle, 72 °C for 7 min. 481
Borrelia spp.-R ACTTGCCACCGCAGATCACTA
23 S rRNA-2 Borrelia spp.-NF CGCACGAATGGTGTAACGATTTGG 95 °C for 4 min, 30 amplification cycles, 95 °C for 15 s, 66 °C for 15 s, and 72 °C for 15 s, 72 °C for 7 min. 317
Borrelia spp.-NR TTGCGCACCTCCGTTACTCTTTAG

In both stages of nested-PCR, each PCR reaction had a total volume of 25 µL. This included 3 µL of DNA template, 0.5 µL of each primer (initial concentration 20 µM), 10 µL of 2 × ready-to-use Taq DNA Polymerase Master Mix (Ampliqon Danmark), and sterile distilled water to reach the desired reaction volume. Additionally, to optimize the sensitivity of the reaction and minimize the presence of contaminants and inhibitors, a touchdown PCR approach was implemented [19]. The thermal cycling conditions for nested-PCR followed the protocol provided by Quanta Biotech (England), as specified in the thermal cycler manual. After PCR amplification, the resulting products were electrophoresed on a 2% agarose gel at 75 V for 45 min. Gel visualization was achieved under ultraviolet (UV) light using a gel documentation system from Syngene Bio-Imaging (United Kingdom).

Sequencing

Subsequent to the execution of the gene’s nested-PCR, the ensuing products underwent sequencing through the Sanger method. The obtained sequences were subsequently processed and refined using BioEdit software (Version 7.2.0) and then subjected to comparison against entries in the GenBank® database. Finally, a phylogenetic tree was meticulously assembled utilizing MEGA 11.0 software (Version 11.0.13).

Data analysis

Data from the present study were analyzed using SPSS21 software to assess potential statistically significant associations between the prevalence of positive cases and various factors, including age, sex, breed, ownership status, sampling time and different geographical regions. Chi-square analysis was employed with a confidence interval of 95%. Significance was determined when P < 0.05.

Results

Nested-PCR amplification of 5–23 S rRNA gene

The findings of this study indicated that 19.2% of the cats, and 15%, of the dogs were positive for Borrelia spp. DNA, with a 95% confidence interval ranging from 14.8 to 24.53% for cats and 11.4–19.48% for dogs. After amplification, the PCR products were analyzed by electrophoresis on a 2% agarose gel with a safe stain and then documented using the Ingenius Gel Documentation system, as shown in Fig. 2.

Fig. 2.

Fig. 2

Agarose gel visualization of the 317 bp fragment amplified through nested-PCR of the 5–23 S rRNA gene. In the image, M100 signifies a 100 bp molecular mass marker, while lanes 1, 2, 3, 4, 5, 6 and 7 represent samples that tested positive for Borrelia spp

Sequencing

The Borrelia spp. isolates obtained from dogs were sequenced and deposited in the GenBank® database under Accession Nos OR770094 and OR770195. Meanwhile, the isolates obtained from cats were deposited under Accession Nos OR770198 and OR771914.

The obtained gene sequences showed a minimum similarity of 100% when compared to the reference sequences available in the GenBank® database.

Phylogenetic analysis

The phylogenetic tree in Fig. 3 was constructed using the concatenated sequences of 317 bp for Borrelia spp. in both cats and dogs. In the analysis, it was observed that the strains isolated in this study, namely OR770198 and OR771914, fall within the same clade as strain AP024401 from Japan. Similarly, the strains OR770094 and OR770195 isolated in this study are grouped together within the same clade as strain CP088936 from Indonesia. This phylogenetic analysis suggests a genetic relationship between the strains isolated in this study and those from Japan and Indonesia, respectively.

Fig. 3.

Fig. 3

illustrates a phylogenetic tree developed through the maximum likelihood approach, relying on the 5–23 S rRNA nucleotide sequences of Borrelia spp. in cats and dogs. Black marks point to the sequences analyzed in this study. GenBank® accession numbers for other sequences are indicated alongside the sequence names. Branch numbers are indicative of bootstrap support (1000 replicates). The scale bar shows the number of substitutions per nucleotide

Statistical analysis

Out of the 250 cat and 300 dog blood samples tested using nested-PCR, 48 cats and 45 dogs tested positive for the presence of Borrelia spp. This resulted in a molecular prevalence of 19.2% (P < 0.05; 95% CI: 14.8- 24.53%) for cat and 15% (P < 0.05; 95% CI: 11.4-19.48%) for dog. Among the positive samples, 31 (24.8%) were from male cats and 28 (18.66%) were from male dogs. There was no significant difference in Borrelia spp. infection between male and female cats (p-value: 0.5206) or dogs (p-value: 0.4188).

Furthermore, the infection rate among cats aged over 2 years (p-value < 0.05, 95% CI: 20.24-34.26%) exceeded that of cats aged 2 years or younger (p-value < 0.05, 95% CI: 4.11-15%). Likewise, the infection rate among dogs aged over 2 years (p-value < 0.05, 95% CI: 16.76-28.84%) was higher than that among dogs aged 2 years or younger (p-value < 0.05, 95% CI: 1.79-9.39%). These findings indicate a statistically significant difference in Borrelia spp. infection rates between age groups.

Moreover, a significant difference in Borrelia spp. infection was observed between the short-haired dog breed (p-value < 0.05, 95% CI: 5.94-16.36%) and the long-haired breed (p-value < 0.05, 95% CI: 13.66-25.36%) (p-value: 0.001). However, there was no significant difference in the cat breeds. Furthermore, a significant difference in Borrelia spp. infection was found between stray dogs (p-value < 0.05, 95% CI: 15.49-26.63%) and pet dogs (p-value < 0.05, 95% CI: 1.57-9.84%) (p-value: 0.001). Nevertheless, no significant difference was observed between stray and pet cats.

Of the positive samples, 6 (6%) were collected during cold months and 42 (28%) during warm months in cats (p-value: 0.001). For dogs, 4 (4%) were gathered during cold months, and 44 (22%) during warm months (p-value: 0.001). These results indicate a significant difference in prevalence between cold and warm months.

The statistical analysis of the data, including sex, age, breed, ownership status, sampling time and region as epidemiological factors associated with Borrelia spp. Infection, is shown in Table 2.

Table 2.

The research findings for Borrelia spp. related to cats and dogs were subjected to statistical analysis based on aforementioned parameters

Variable Epidemiological Factors Frequency PCR-Positive (%) P-value
Total Cat Dog Cat Dog Cat Dog
250 300 48 (19.2%) 45 (15%)
Sex

Male

Female

125

125

150

150

26 (20.8%)

22 (17.6%)

25 (16.66%)

20 (13.33%)

0.627 0.419
Age group

≤ 2 years

> 2 years

100

150

120

180

8 (8%)

40 (26.6%)

5 (4.16%)

40 (22.22%)

0.001 0.001
Breed

Short-haired breeds

Long-haired breeds

150

100

130

170

23 (15.3%)

25 (25%)

4 (3%)

41 (24.11%)

0.057 0.001
Ownership status

Stray

Pet

125

125

200

100

21 (16.8%)

27 (21.6%)

41 (20.5%)

4 (4%)

0.335 0.001
Region

North

Center

South

75

100

75

75

150

75

18 (24%)

16 (16%)

14 (18.6%)

11 (14.6%)

18 (12%)

16 (21.33%)

0.409 0.180
Sampling time

Cold months

Warm months

100

150

100

200

6 (6%)

42 (28%)

4 (4%)

44 (22%)

0.001 0.001

Discussion

To the best of our knowledge, this study represents the first molecular investigation of Borrelia spp. in blood samples obtained from cats and dogs in West Azerbaijan Province, Iran. The research details the application of a nested-PCR assay for molecular identification, followed by phylogenetic analysis of Borrelia spp. within the blood samples of cat and dog populations, and determination of the prevalence of this infection in the region.

The findings from this study demonstrated a prevalence of 19.2% in cats and 15% in dogs for Borrelia spp. In a study conducted in Pakistan in 2022, it was reported that 4.3% of dogs were positive for B. burgdorferi s.l. (Usman, Durrani et al. [31]). In a 2021 study, the prevalence of Borrelia burgdorferi was investigated in blood samples obtained from 100 dogs in Egypt, revealing a prevalence rate of 1.67% (Elhelw, Elhariri et al. [10]). Another study examined the seroprevalence of B. burgdorferi antibodies in 100 cats from Bulgaria finding that 1% tested positive (Tsachev, Baymakova et al. [30]). In another study (2022) the prevalence of Borrelia persica in domestic cats and dogs in Israel was examined. Four out of the 208 dogs (1.9%) and three out of 103 cats (2.9%) tested positive for B. persica DNA by PCR (Baneth, Dvorkin et al. [4]).

The study found that age is a significant factor (p-value: 0.001), and may constitute a risk factor for Borrelia spp. infection in cats and dogs. A higher frequency of Borrelia spp. infection was observed in cats and dogs over 2 years of age, suggesting that initial bacteremia tends to occur at older age. The high prevalence of Borrelia spp. infection in cats over 2 years can be explained by increased exposure to ticks. These encounters increase the possibility of infection in this age range in cats and dogs. Sex and region did not significantly influence infection rates.

The study observed a higher frequency of Borrelia spp. infection in long-haired dogs compared to short-haired dogs (p-value: 0.001). However, this factor did not significantly influence infection rates in cats. This suggests that grooming behavior in cats is also known to reduce the number of ectoparasites, such as ticks and fleas (Davies, Abdullah et al. [7]), in both short-haired and long-haired breeds.

In a study conducted in 2020, the seroprevalence of B. burgdorferi in stray dogs from Southern Italy was examined. Seventeen sera (5.4%) tested positive for the antibodies via IFA and one blood sample (0.3%) tested positive for ospA via real time PCR (Galluzzo, Grippi et al. [12]). The present study showed higher prevalence of infection in stray dogs. A study conducted in 2022 on companion dogs from Central and North-Eastern Europe, employing PCR methods, reported a 4.4% prevalence of Borrelia burgdorferi s.l. in pet dogs (Bajer, Kowalec et al. [3]), which is consistent with the results obtained in this study on pet dogs. The high prevalence of infection in stray animals indicates a greater risk of exposure to ectoparasites. On the other hand the study found no significant difference in Borrelia spp. infection rates between stray and pet cats (p-value: 0.335). This suggests that both pet and stray cats exhibit a wider free-roaming and hunting behavior, bringing them into contact with a greater range of diverse habitats and animals compared to dogs (Davies, Abdullah et al. [7]).

In a 2014 conducted study in three Northern provinces of Iran, the seroprevalence of the B. burgdorferi sensu lato complex was found to be 8.1%. It was also discovered that the average annual temperature exhibited a positive and significant correlation with the percentage of borreliosis seroprevalence in dogs in these regions [14]. The present study’s findings for Borrelia spp. indicated a significant difference (p-value: 0.001) between blood samples taken during warm months and cold months. This observation can be explained by the fact that Borrelia spp. infection often occurs more frequently during the warmer months. This can be attributed to the heightened tick activity and increased outdoor activities of both humans (owners) and dogs [24], Littman, Gerber et al. [20]). The seasonal occurrence of TBP infections aligns with the presence and activity of ticks during the summer and autumn seasons, which play a pivotal role in the transmission of TBPs (Im, Baek et al. [16]). The majority of Lyme disease instances are contracted during the spring and early summer months [22].

Anticipated climate and environmental alterations are projected to increase the risk of ticks and tick-borne diseases (TBDs) through various mechanisms. These changes are expected to result in a greater prevalence, activity, and geographic distribution of several tick species and the pathogens they harbor. These alterations are caused by shifting weather patterns, which expand the range of animal reproduction and reservoir hosts (Bouchard, Dibernardo et al. [5]). Rising temperatures have created more favorable conditions for the survival and reproductive capabilities of ticks. This has expedited the tick life cycle due to faster development [23]. As the climate continues to change and favor the survival of ticks in new geographical regions, tick-borne diseases could become a growing concern in the future (Davies, Abdullah et al. [7]).

Lake Urmia, located in northwestern Iran, is the second-largest saltwater lake in the world. In recent years, the water level in Lake Urmia has exhibited a substantial decline. This decrease in size could potentially impact local climatic conditions. Furthermore, the influence of the lake on the local climate appears to intensify as temperatures rise, with the most notable effects observed during the summer season and the least during winter (Dehghanipour, Moshir Panahi et al. [8]). The temperature increase in this region could be one of the factors contributing to the high prevalence of the bacteria in cats and dogs in this study.

Undoubtedly, the local epidemiology of zoonotic diseases is of great importance for public health. Understanding the regional risk factors allows for the development of effective prevention strategies and their sustainable implementation (Jurke, Bannert et al. [17]).

Conclusion

The present study, along with several prior studies, highlights the endemic nature of Lyme disease in Iran. To the best of our knowledge, this study presents the initial molecular detection of Borrelia spp. in the blood of cats and dogs within West Azerbaijan Province, Iran. These findings contribute to our understanding of the geographical distribution and possible vector hosts for Borrelia spp., suggesting that cats and dogs may serve as reservoirs for the transmission of this tick-borne pathogen to other animals and humans. Investigating the risk of infestation with Borrelia spp. remains of significant importance, especially from both a zoonotic and public health perspective.

Acknowledgements

We would like to extend our gratitude to the Faculty of Veterinary Medicine at Urmia University for their invaluable financial support, which enabled the completion of this study. Furthermore, we wish to express our sincere appreciation to Mr. Kazemnia for his essential technical assistance at the beginning of this research, as well as the veterinarians who played a crucial role in collecting the blood samples. Their contributions were indispensable to the successful completion of this study.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Asl HM, Goya M, Vatandoost H, Zahraei S, Mafi M, Asmar M, Piazak N, Aghighi Z (2009) The epidemiology of tick-borne relapsing fever in Iran during 1997–2006. Travel Med Infect Dis 7(3):160–164 [DOI] [PubMed] [Google Scholar]
  • 2.Assous MV, Wilamowski A (2009) Relapsing fever borreliosis in Eurasia–forgotten, but certainly not gone! Clin Microbiol Infect 15(5):407–414 [DOI] [PubMed] [Google Scholar]
  • 3.Bajer A, Kowalec M, Levytska VA, Mierzejewska EJ, Alsarraf M, Poliukhovych V, Rodo A, Wężyk D, Dwużnik-Szarek D (2022) Tick-Borne Pathogens, Babesia spp. and Borrelia burgdorferi s.l., in Sled and Companion Dogs from Central and North-Eastern Europe. Pathogens 11(5) [DOI] [PMC free article] [PubMed]
  • 4.Baneth G, Dvorkin A, Ben-Shitrit B, Kleinerman G, Salant H, Straubinger RK, Nachum-Biala Y (2022) Infection and seroprevalence of Borrelia persica in domestic cats and dogs in Israel. Parasites Vectors 15(1):102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bouchard C, Dibernardo A, Koffi J, Wood H, Leighton PA, Lindsay LR (2019) N increased risk of tick-borne diseases with climate and environmental changes. Can Commun Dis Rep 45(4):83–89 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Coburn J, Garcia B, Hu LT, Jewett MW, Kraiczy P, Norris SJ, Skare J (2021) Lyme disease pathogenesis. Curr Issues Mol Biol 42(1):473–518 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Davies S, Abdullah S, Helps C, Tasker S, Newbury H, Wall R (2017) Prevalence of ticks and tick-borne pathogens: Babesia and Borrelia species in ticks infesting cats of Great Britain. Vet Parasitol 244:129–135 [DOI] [PubMed] [Google Scholar]
  • 8.Dehghanipour AH, Moshir Panahi D, Mousavi H, Kalantari Z, Tajrishy M (2020) Effects of water level decline in Lake Urmia, Iran, on local climate conditions. Water 12(8): 2153
  • 9.del Cerro A, Oleaga A, Somoano A, Barandika JF, García-Pérez AL, Espí A (2022) Molecular identification of tick-borne pathogens (Rickettsia spp., Anaplasma phagocytophilum, Borrelia burgdorferi Sensu Lato, Coxiella burnetii and piroplasms) in questing and feeding hard ticks from North-Western Spain. Ticks Tick-borne Dis 13(4):101961 [DOI] [PubMed] [Google Scholar]
  • 10.Elhelw R, Elhariri M, Hamza D, Abuowarda M, Ismael E, Farag H (2021) Evidence of the presence of Borrelia burgdorferi in dogs and associated ticks in Egypt. BMC Vet Res 17:1–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Enferadi A, Ownagh A, Tavassoli M (2023) Molecular detection of Borrelia spp. in Ticks of Sheep and Goats by Nested PCR method in West Azerbaijan Province. Iran. Vector Borne Zoonotic Dis [DOI] [PubMed]
  • 12.Galluzzo P, Grippi F, Di Bella S, Santangelo F, Sciortino S, Castiglia A, Sciacca C, Arnone M, Alduina R, Chiarenza G (2020) Seroprevalence of Borrelia burgdorferi in Stray Dogs from Southern Italy. Microorganisms 8(11) [DOI] [PMC free article] [PubMed]
  • 13.Gonçalves ES, Cordeiro MD, dos Santos LMR, Araújo IM, da Fonseca AH, Labruna MB, Guedes E (2022) Research of Rickettsia spp. and Borrelia spp. dogs Southeast Brazil Veterinary Parasitology: Reg Stud Rep 30:100706 [DOI] [PubMed] [Google Scholar]
  • 14.Hanifeh M (2012) Seroprevalence, geographic distribution and risk factor analysis of Borrelia burgdorferi sensu lato in naturally exposed dogs of Iran. Afr J Microbiol Res 6
  • 15.Hansford KM, Wheeler BW, Tschirren B, Medlock JM (2022) Questing Ixodes ricinus ticks and Borrelia spp. in urban green space across Europe: a review. Zoonoses Public Health 69(3):153–166 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Im JH, Baek J, Durey A, Kwon HY, Chung M-H, Lee J-S (2019) Current status of tick-borne diseases in South Korea. Vector-Borne Zoonotic Dis 19(4):225–233 [DOI] [PubMed] [Google Scholar]
  • 17.Jurke A, Bannert N, Brehm K, Fingerle V, Kempf VAJ, Kömpf D, Lunemann M, Mayer-Scholl A, Niedrig M, Nöckler K, Scholz H, Splettstoesser W, Tappe D, Fischer SF (2015) Serological survey of Bartonella spp., Borrelia burgdorferi, Brucella spp., Coxiella burnetii, Francisella tularensis, Leptospira spp., Echinococcus, Hanta-, TBE- and XMR-virus infection in employees of two forestry enterprises in North Rhine–Westphalia, Germany, 2011–2013. Int J Med Microbiol 305(7):652–662 [DOI] [PubMed] [Google Scholar]
  • 18.Khoobdel M, Jafari AS, Telmadarraiy Z, Sedaghat MM, Bakhshi H (2021) Tick-borne pathogens in Iran: a meta-analysis. Asian Pac J Trop Med 14(11):486–504 [Google Scholar]
  • 19.Korbie DJ, Mattick JS (2008) Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat Protoc 3(9):1452–1456 [DOI] [PubMed] [Google Scholar]
  • 20.Littman MP, Gerber B, Goldstein RE, Labato MA, Lappin MR, Moore GE (2018) ACVIM consensus update on Lyme borreliosis in dogs and cats. J Vet Intern Med 32(3):887–903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mahajan VK (2023) Lyme Disease: an overview. Indian Dermatology Online J 14(5):594–604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mead PS (2015) Epidemiology of Lyme disease. Infect Disease Clin 29(2):187–210 [DOI] [PubMed] [Google Scholar]
  • 23.Ogden NH, Lindsay LR (2016) Effects of climate and climate change on vectors and vector-borne diseases: ticks are different. Trends Parasitol 32(8):646–656 [DOI] [PubMed] [Google Scholar]
  • 24.Piesman J, Gern L (2004) Lyme borreliosis in europe and north America. Parasitology 129(S1):S191–S220 [DOI] [PubMed] [Google Scholar]
  • 25.Seo M-G, Kwon O-D, Kwak D (2020) Molecular Identification of Borrelia afzelii from Ticks Parasitizing Domestic and Wild animals in South Korea. Microorganisms 8(5):649 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Shirani D, Rakhshanpoor A, Cutler SJ, Ghazinezhad B, Naddaf SR (2016) A case of canine borreliosis in Iran caused by Borrelia persica. Ticks tick-borne Dis 7(3):424–426 [DOI] [PubMed] [Google Scholar]
  • 27.Shutikova AL, Leonova GN, Popov AF, Shchelkanov MY (2021) Clinical and diagnostic manifestations of tickborne mixed infection in combination with COVID-19. Klin Lab Diagn 66(11):689–694 [DOI] [PubMed] [Google Scholar]
  • 28.Szewczyk-Dabrowska A, Budziar W, Harhala M, Baniecki K, Pikies A, Jedruchniewicz N, Kaźmierczak Z, Gembara K, Klimek T, Witkiewicz W, Nahorecki A, Barczyk K, Kłak M, Grata-Borkowska U, Dabrowska K (2022) Correlation between COVID-19 severity and previous exposure of patients to Borrelia spp [DOI] [PMC free article] [PubMed]
  • 29.Szewczyk-Dąbrowska A, Budziar W, Harhala M, Baniecki K, Pikies A, Jędruchniewicz N, Kaźmierczak Z, Gembara K, Klimek T, Witkiewicz W (2022) Correlation between COVID-19 severity and previous exposure of patients to Borrelia spp. Sci Rep 12(1):15944 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Tsachev I, Baymakova M, Zlateva N, Kundurzhiev T, Solano-Gallego L (2020) Seroprevalence rates of tick-borne pathogens in cats from southern Bulgaria. Vector-Borne Zoonotic Dis 20(11):864–867 [DOI] [PubMed] [Google Scholar]
  • 31.Usman M, Durrani AZ, Mehmood N, Saleem MH, Chaudhry M (2022) Prevalence of Borrelia burgdorferi sensu lato in pet dogs and associated ticks in Pakistan. Pakistan Journal of Zoology

Articles from Brazilian Journal of Microbiology are provided here courtesy of Brazilian Society of Microbiology

RESOURCES