Skip to main content
Brazilian Journal of Microbiology logoLink to Brazilian Journal of Microbiology
. 2024 Jul 9;55(3):2547–2556. doi: 10.1007/s42770-024-01437-4

Quadruplex qPCR for detection and discrimination of C. Coli,C. fetus, and C. Jejuni from other Campylobacter species in chicken and sheep meat

Marwan Abu-Halaweh 1,✉, Eman Al-bsoul 1
PMCID: PMC11405656  PMID: 38977544

Abstract

Campylobacter is gram-negative bacteria considered the predominant genera isolated from poultry samples and associated with gastroenteritis. Due to the problems in conventional cultural methods of time-consuming and technically demanding requirements, a rapid and feasible method for their identification and discrimination of the closely related spp. Including Campylobacter coli, Campylobacter fetus, and Campylobacter jejuni is needed. This study analyzes the chicken and sheep meats samples (n = 125) using culture and pre-enrichment-based Quadraplex real-time PCR by targeting OrfA, CstA, HipO, and 16 S rRNA genes of C. coli, C. fetus, C. jejuni and Campylobacter spp. Respectively. The analysis of 125 chicken and sheep meat samples by culture and real-time PCR showed high concordance between the results of the two methods. The present study show high prevalence of Campylobacter species (35% and 32% from chicken and meat respectively) of which C. jejuni were the most abundant. Reaction efficiencies were between 90 and 110%, and detect as low as 8.9 fg in C. jejuni. The need for quick detection and discrimination methods in sheep and chicken meat can be met using the described Quadraplex real-time PCR methodology.

Keywords: Quadraplex real-time PCR, Campylobacter, Species, Differentiation

Introduction

Campylobacter is a genus of gram-negative epsilon proteobacteria with many vertebrate hosts, including humans, wild animals, and pets [1]. According to the Centers for Disease Control and Prevention, species of the Campylobacter genus are the most frequent sources of bacterial food-borne diarrheal disease, accounting for approximately 1.3 million cases in the USA, 0.6 million in the U.K., and more than 150 million worldwide every year [2–4]. Among Campylobacter species, C. jejuni and C. coli are the most common infectious species that cause diarrhea in humans [5–7]. Campylobacter is also associated with many other human complications, such as inflammatory bowel disease (IBD), colorectal cancer, and neurological disorders, such as Guillain‒Barré syndrome (GBS), reactive arthritis, meningitis, and Miller–Fisher syndrome (MFS) [3, 5, 8, 9]. In terms of severity, fatal cases of Campylobacter infection have been reported among children < 5 years of age, elderly individuals, and immunocompromised patients [10]. In addition to humans, C. jejuni causes mastitis and abortion in bovines [11–13]. C. fetus causes sporadic abortions, infertility, and embryonic mortality in cattle, sheep, goats, and equines [14–18].

The primary sources of Campylobacter include the consumption of undercooked meat, the intake of contaminated or untreated water, and the consumption of raw and improperly pasteurized milk, which are known to cause sporadic infection [11, 12, 19–21]. Therefore, advanced methods for the detection and quantification of Campylobacter species in edible samples are needed. Such methods can provide a great advantage to food manufacturing companies by avoiding expensive and damaging product recalls, as most.

food products are not held in warehouses pending test results.

In conventional investigations, Campylobacter species are cultured in selective media at 42 °C in a microaerophilic environment. Although these techniques are inexpensive and feasible, they can take up to 6 days to complete [22, 23]. In addition, a variety of diagnostic molecular techniques for the detection and discrimination of Campylobacter spp. have been developed, including enzyme-linked immunoassays [19, 24], MALDI-TOF mass spectrometry [25, 26], and DNA microarrays [27, 28].

On the other hand, rapid and accurate molecular techniques, such as PCR and real-time PCR, have recently been used to observe and distinguish Campylobacter species in contaminated food and water [29–35]. Leblanc-Maridor et al. (2001) reported the direct detection and quantification of C. coli and C. jejuni in feces, feed, and environmental samples by real-time PCR. Lanzel et al. (2022) reported using real-time PCR combined with an enrichment step for the differentiation of C. jejuni from C. coli by targeting C. jejuni (MapA), C. coli (CeuE), and both species (Cje) [34]. Additionally, He et al. (2011) described the development of multiplex real-time PCR assays combined with an enrichment step for the rapid detection of C. jejuni, C. coli, and C. lari in chicken samples [36]. Furthermore, the simultaneous detection of C. jejuni and C. coli in broiler neck skin samples has been reported [37]. In addition, Govindaswamy et al. (2022) reported the use of droplet digital PCR (ddPCR) to quantify C. coli and C. jejuni in chicken meat rinses from naturally contaminated samples from slaughterhouses and supermarkets [38]. However, none of these real-time PCR techniques are capable of differentiating and quantifying C. coli, C. jejuni, or C. fetus from other Campylobacter species in a single tube.

In this paper, we report the development of a new one-step multiplex real-time PCR assay for the simultaneous detection and distinguishing of the targeted species C. coli, and C. jejuni, and C. fetus from other Campylobacter species in chicken and meat samples and provide an assessment of its equivalence with conventional culture methods. This Quadruplex real-time PCR assay encompasses four targets, namely, 16 S rRNA, which is a Campylobacter-specific, and three other targets that are specific for C. jejuni, C. coli. and C. fetus specific: HipO for C. jejuni, OrfA for C. coli, and CstA for C. fetus. Compared with traditional microbiological and conventional PCR methods, the developed Quadruplex real-time PCR method is an efficient, sensitive, specific, cost effective, fast, and simple tool for the diagnosis of Campylobacter.

Materials and methods

Sampling and processing

This investigation utilized an optimized multiplex real-time PCR assay to observe Campylobacter spp. and distinguish C. coli, C. fetus, and C. jejuni from other Campylobacter spp. in 125 chicken and sheep meat samples, in addition to 15 non-Campylobacter isolates obtained from our previous laboratory collections.

Sampling and processing

A convenience sampling approach was used to collect one hundred raw chicken samples (including the skin, meat, and carcass), and twenty-five samples of raw sheep meat were obtained from local shops in Amman, Jordan. Despite the lack of clear generalizability, convenience sampling is widely used in similar research.

In a sterile bag, 25 g of fresh meat or chicken sample was rinsed carefully with approximately 100 mL of sterile water. Next, 10 mL of the suspension was added to 100 ml of Bolton broth (Sigma‒Aldrich, St. Louis, MO) along with 5% lysed horse blood, 20 µg/mL each vancomycin, trimethoprim lactate, cefoperazone, and 10 µg/mL amphotericin-B. The samples were homogenized to enrich Campylobacter isolates, placed in candle jars and incubated at 42 °C for 24 h under microaerophilic conditions. Next, plates of enriched swabs and type strains (Table 1) were cultured in modified charcoal-cefoperazone-deoxycholate agar (mCCDA) supplemented with 10 µg/mL amphotericin-B and 32 µg/mL cefoperazone (Oxoid-UK). The inoculated plates were then incubated under the same enrichment conditions. Colonies showing Campylobacter-like morphology on mCCDA were then subjected to additional testing with API Campy test strips according to the manufacturer’s instructions. The results were interpreted using API Campy analytical profile index software (bioMerieux, France).

Table 1.

American Type Culture Collection reference strains used in the inclusivity study for C. Jejuni, C. Coli, C. fetus and identification by the developed Quadruplex real-time PCR assay

Campylobacter reference isolate Strain
C. coli ATCC 43,478
C. fetus subspp. fetus ATCC 27,374
C. jejuni ATCC 33,560

*ATCC American Type Culture Collection number

DNA isolation

DNA isolation was performed by the fast boiling technique, in which a loopful of 5–10 colonies were taken from each sample after culturing [39]. DNA from Campylobacter-type strains) Table (1 used to optimize the Quadruplex PCR assay was isolated using a QIAamp DNA Mini Kit (QIAGEN, Germany) following the manufacturer’s protocols.

Primer and probe design

All primers and probes (Table 2) used in this study were reported by Abu-Halaweh et al. (2005) and Hum et al. (1999), except for the TaqFetus probe. CstA sequences of 10 C. fetus species were obtained from the National Center for Biotechnology Information (NCBI) database. The sequences were aligned with BioEdit v7.0.5 15 [40], and the probes were designed within the TaqFetusF and TaqFetusR primer regions (Table 2). The Basic Local Alignment Search Tool (BLAST) algorithm was used to evaluate the specificity of this probe and its lack of homology with other microbial sequences [41]. Additionally, in silico PCR amplification was carried out to further analyze the specificity of the gene amplification using online bioinformatic tools (http://insilico.ehu.es/PCR/index.php?mo=Campylobacter). The probes and primers were purchased from Integrated DNA Technologies (Alpha DNA, Canada). The probes were labeled with different fluorescent reporter dyes on the 5′ end and with Black Hole Quencher® (BHQ) at the 3′ end (Table 2).

Table 2.

Primer and probe sequences with fluorescent dyes * used for qPCR analyses of campylobacter spp. In this study

Primer or probe Sequence (5’ − 3’) References
16 S rRNA-783F2 CAGGATTAGATACCCTGGTAG [39]
16 S rRNA-1542Rd1 AAGGAGGTGATCCAGCC
TaqCam-936 F CAAGCGGTGGAGCATGTGGTTT [39]
TaqCam-1087R CAACATCTCACGACACGAGCTG
TaqCam-1034 Cy5-CAGCCGTGCAGCACCTGTCTCTAAGTTCT-BHQ-2
TaqHip-1754 F TGGTGCTAAGGCAATGATAGAAGA [39]
TaqHip-1924R TGACCACCTCTTCCAATAACTTCA
TaqJej-1864 Max-AACTATCCGAAGAAGCCATCATCGCACCTT-BHQ-1
TaqOrf-4024 F GCACTCATCCAATACTTACAAGA
TaqOrf-4129R CATTATGGTGTATTCCGCCCA
TaqColi-4075 Fam-AAGTTCCATCTGACGCTGAAGCTACTCAAG-BHQ-1
TaqFetus F GGTAGCCGCAGCTGCTAAGAT [43]
TaqFetus R AGCCAGTAACGCATATTATAGTAG
TaqFetus TEXAS RED -CGGTTGATGCCGGTACTAGAACAGGACGAT–BHQ-1 Current study

*The fluorescent dyes of the reporter (Fam, Max, Cy5 and Texas red); BHQ black hole quencher, F forward primer, R reverse primer

Quadruplex real-time PCR assay

The probe and primer concentrations for the first experiments were based on previously published assays in which the final concentrations of primers and probes were 0.50 µM and 0.20 µM, respectively [22, 24, 39–41]. The primer and probe concentrations of each target and the PCR conditions were evaluated and adjusted based on the previously described conditions to achieve the best detection performance with this Quadruplex PCR assay. Furthermore, to verify the probe specificity experimentally, different experiments were carried out with Campylobacter type strains and non-Campylobacter species (Table 1). After that, Quadruplex real-time PCR was performed using the four sets of primers and probes with DNA from one type strain in a single tube to evaluate the presence of undesirable inhibition caused by interactions between components.

After adjusting the reaction conditions, the one-step Quadruplex real-time PCR assay was optimized. The optimized reaction contained 10.0 µl of Luna Universal Probe qPCR Master Mix (New England Biolabs, USA), 0.3 µM each primer, 0.1 µM probe (Table 2), 2.0 µl of template, and up to 20 µl of nuclease-free water. The protocol program was as follows: initial denaturation for 2 min at 95 °C, followed by 40 cycles of denaturation for 20 s at 95 °C and annealing/extension for 40 s at 60 °C. For comparison, distilled water was used as a negative control, and type strain prepared DNA was used as a positive control. Fluorescence signals were recorded during the annealing/extension step of each thermal cycle in this quadruplex real-time PCR assay using a Rotor-Gene Q Real-Time PCR system (Qiagen, USA). All calculations were made using Rotor-Gene Q (version 1.4) software (Qiagen, USA). In this assay, the reference strains of Campylobacter spp. and the Campylobacter isolates obtained in this study were evaluated.

Analytical specificity

A collection of non-Campylobacter strain templates, including the closely related species Arobacter butzleri, listed in Table 3, was used to assess the specificity of this real-time multiplex PCR assay. All bacterial strains were previously confirmed by biochemical detection and PCR.

Table 3.

Non-campylobacter isolates used to identify the specificity of the developed Quadruplex real-time PCR assay and their source of isolation

Bacterial spp. Source Number of isolates
A. butzleri Chicken thigh 3
Enterococcus faecalis Urine 3
Escherichia coli Human feces 3
Shigella spp. Human feces 3
Salmonella spp. Chicken pieces 3

Standard curve and sensitivity analysis

DNA purified from the cultured type strains of C. coli, C. fetus, and C. jejuni were quantified via spectrophotometric analysis using a Multiskan microplate spectrophotometer (Thermo), and serial dilutions ranging from 0.89 nanograms (ng) to 8.9 femtograms (fg), 20.8 ng to 20.8 fg, and 14.7 ng to 14.7 fg, respectively. These data were used to estimate the lowest DNA concentration of each individual species that can be detected using the newly developed Quadruplex real-time PCR. The extracted DNA from each dilution step was run in duplicate, and the standard curves and amplification efficiency (E) values were generated automatically based on the cycle threshold (Ct) values by Rotor-Gene Q software.

Detection limit and reproducibility of the qPCR assay

The lowest DNA concentration of C. jejuni and the other tested species that generated Ct values < 358 was considered the limit of detection (LOD) of this assay. A standard curve correlating the Ct value and known concentration of C. jejuni cells was established and used to estimate the amplification efficiency and quantification capability. The amplification efficiency (E) was calculated using the slope of the standard curve as follows: E = [10(–1/slope) − 1] ∗ 100%.

DNA sequencing

Representative Campylobacter species isolates (4 isolates of C. jejuni, 4 of C. coli and 2 of C. fetus) detected by Quadruplex real-time PCR assay were confirmed and identified by Sanger sequencing of the 16 S rRNA gene (Sanger DNA sequencing performed by Macrogen, Korea) by targeting hypervariable regions using F2 and Rd1 primers (Table 2), as previously described [39].

Results

Optimization of the Quadruplex real-time PCR assay

All Campylobacter-type strains and local isolates detected by real-time PCR were grown in enrichment and selective media. Campylobacter spp. displayed the expected amplified signals, while the non-Campylobacter bacteria, including the closely related species A. butzleri, produced negative results in the real-time multiplex PCR assay (Table 4). The results revealed no false-positive or false-negative outcomes, revealing the high sensitivity of the developed Quadruplex real-time PCR assay following culture and biochemical identification.

Table 4.

Detection of Campylobacter spp. in chicken meat using a quadruplex real-time PCR assay and conventional culture method

Campylobacter Species Phenotypic and biochemical results Real-time PCR results
Chicken Meat (n = 100) Sheep Meat (n = 25) Chicken Meat (n = 100) Sheep Meat (n = 25)
C. jejuni 24 (24%) 4 (16%) 24 (24%) 4 (16%)
C. coli 9 (9%) 2 (8%) 9 (9%) 2 (8%)
C. fetus 0 2 (8%) 0 2 (8%)

Other

Campylobacter spp.

2 (2%) 0 2 (2%) 0
Total 35 (35%) 8 (32%) 35 (35%) 8 (32%)

Detection of naturally contaminated chicken samples

From 125 samples (100 chicken and 25 sheep meat), bacteriological examination yielded 43 Campylobacter spp. Multiplex PCR confirmed the presence of the following isolates: 28 C. jejuni, 11 C. coli, 2 C. fetus, and 2 other Campylobacter spp. (Table 4). Campylobacter-positive samples contained only one species.

Assay sensitivity, linearity, and efficiency

Real-time PCR assays using decimal serial dilutions of DNA isolated from C. jejuni, C. coli, and C. fetus type strains demonstrated excellent detection limit efficiency and analytical sensitivity. The primer and probe sets for specifically distinguishing Campylobacter spp. had sensitivities as low as 8.9 fg for C. coli and Campylobacter, 20.8 fg for C. fetus, and 14.7 fg for C. jejuni (the genomes of C. jejuni and C. coli are approximately 1.7 fg) (Figs. 1, 2, 3 and 4). The average slopes of the standard curves for C. coli, C. fetus, C. jejuni, and Campylobacter spp. were − 3.464, -3.26, -3.09, and − 3.099, respectively. The multiplex real-time PCR assays with correlation coefficients (R2 values) above 0.987 and amplification efficiency (E) values between 93% and 110% were highly linear.

Fig. 1.

Fig. 1

A detection limit of qPCR targeting the OrfA gene in C. coli: Using the quantification cycle numbers of a 10-fold dilution series ranging from 8.9 ng to 8.9 fg per reaction, a standard curve is generated

Fig. 2.

Fig. 2

A detection limit for qPCR targeting the CstA gene in C. fetus: Using the quantification cycle numbers of a 10-fold dilution series ranging from 20.8 ng to 208 fg per reaction, a standard-curve is generated

Fig. 3.

Fig. 3

A detection limit of qPCR targeting the 16 S rRNA gene in Campylobacter spp.: Using the quantification cycle numbers of a 10-fold dilution series of 0.89 ng to 8.9 fg per reaction standard curve is generated

Fig. 4.

Fig. 4

A detection limit of qPCR targeting the HipO gene in C. jejuni: Using quantification cycle numbers of a 10-fold dilution series of 14.7 ng to 147 fg per reaction standard curve is generated

16 S rRNA sequencing

Amplification followed by Sanger sequencing of a hypervariable segment of the 16 S rRNA gene confirmed the species identification of 4 C. jejuni, 4 C. coli and 2 C. fetus randomly selected isolates.

Discussion

Campylobacter is a zoonotic microorganism widely known as a source of bacterial food-borne diarrheal disease worldwide. In 2019, 220,682 cases of Campylobacteriosis were reported in European Union countries alone, making it the most common zoonosis [10].

Conventional techniques for the enumeration and isolation of Campylobacter species based on microbiological culture and biochemical tests are considered the gold standard. Although inexpensive and sensitive, these techniques are time-consuming, laborious, and technically demanding because of the fastidious growth of these bacteria and their biochemical indisposition [43–45]. On the other hand, nucleic acid amplification techniques such as conventional and real-time PCR are rapid and specific and have been utilized to identify food-borne infectious agents, including Campylobacter species from foods and human samples [29, 46–51]. In comparison, continued acquisition of the fluorescence signals derived during real-time PCR amplification avoids the conventional PCR limitations of using gel electrophoresis to detect amplified products. In real-time PCR, different probe technologies have been employed, such as scorpion probes, adjacent hybridization probes, TaqMan nuclease probes, and TaqMan MGB probes [52–55]. These probes enable the detection of the cumulative fluorescence signal generated during the amplification reaction via the hybridization and dissociation of a fluorescently labeled probe, which is proportional to the accumulated targeted PCR product.

Selecting specific target genes and designing compatible primers and probes are crucial in developing Quadruplex real-time PCR assays for Campylobacter spp. differentiation. Regardless of the homology of the genomes of various Campylobacter spp., although these species are related, some genes were found to be unique and specific to each species, such as genes encoding the hippuricase gene HipO, which was observed only within the C. jejuni genome and is responsible for hippurate activity, while the other primers and probes targeting the 16 S rRNA, OrfA, and CstA genes were highly specific for the detection of their target species based on in silico analysis and as reported in previous studies [30, 56–59].

The primers and probes used in this study have already been reported and validated by Abu-Halaweh et al. (2005) for the identification and quantification of Campylobacter spp. The authors reported high specificity for the detection of Campylobacter spp. predominantly found in poultry, such as C. jejuni, C. coli, C. lari, and C. upsaliensis, with these primers and probes [15]. Moreover, Abu-Halaweh et al. demonstrated the highly efficient detection of both C. jejuni and C. coli using primer and probe sets targeting the HipO and OrfA genes. Moreover, On et al. (2013) demonstrated highly specific C. jejuni detection using HipO primers and probes as well as highly specific C. coli detection using OrfA primers with different probe sequences.

This study developed and evaluated a culture-dependent TaqMan Quadruplex real-time PCR assay to allow the simultaneous identification, quantification, and differentiation of C. coli, C. fetus, and C. jejuni from other Campylobacter spp. Furthermore, the ability of this assay to detect and discriminate Campylobacter spp. from other non-Campylobacter spp., including the closely related A. butzleri, was evaluated. High specificity was demonstrated by the absence of a fluorescence signal during the amplification steps even when using universal primers that can amplify and generate an amplicon, as is the case when using universal 16 S rRNA primers for the detection of Campylobacter spp.

Evaluation of the analytical sensitivity of the developed Quadruplex real-time PCR assay showed as little as 8.9 fg, 20.8 fg, and 14.7 fg of C. coli, C. fetus, and C. jejuni could be detected, respectively, indicating its sensitivity for diagnostic purposes, as reported in previous studies [60–63]. Furthermore, the designed procedure can be completed in a few hours after culturing, significantly reducing the time needed for multiple bacterial detection. With enrichment culture, multiplex real-time PCR sensitivity can be increased by omitting PCR inhibitors, as shown by Ding et al. (2017) [64].

The correlation coefficient (R2) of the developed assay revealed a strong linear correlation between the template (log DNA concentration) and product (represented by Ct) of all four standard curves (ranging from 0.988 to 0.999). The results indicated that the developed Quadrplex PCR assay was accurate and capable of quantifying various C. jejuni, C. coli, C. fetus and Campylobacter spp. Furthermore, the slope and efficiency of the four curves are within the normal range of those of an efficient qPCR assay (− 3.58 to − 3.1 and 90–110%, respectively), confirming the effectiveness of the detection performance of the Quadruplex qPCR assay.

In the present study, 100% of Campylobacter spp. were confirmed by the API Campy identification system (bioMérieux). These results are similar to those obtained by Ito and Kishimoto (2013), who reported 100% Campylobacter spp. identification by the API system and real-time PCR. Yang et al. (2003) reported significant differences in the abilities of real-time PCR and culture methods to detect C. jejuni in poultry, water and milk.The relatively high frequency of Campylobacter species (35% and 32% in chicken and sheep meat, respectively), of which C. jejuni was the most abundant, observed in the current study is within the range of other studies from different countries [65, 66]. In Croatia. Mikulić et al. (2016) reported that the prevalence of Campylobacter spp. was 73.86%, while C. jejuni and C. coli were isolated from 53% to 15.35% of the samples, respectively [67]. In the United Kingdom, Kramer et al. (2000) reported that Campylobacter species were isolated from chicken samples (83.3%), C. jejuni was predominant in chicken (77.3%), lamb (75.0%), and ox liver (49.0%), and C. coli predominated in pigs’ liver (42.4%). C. fetus was identified in 12.5% of ox liver samples and in pigs and lambs [68, 69]. Mohamed et al. (2019) and Di Giannatale et al. (2019) reported lower prevalences in poultry meat (6% and 17.38%, respectively) [70, 71].

In conclusion, a specific and simple one-step TaqMan Quadruplex real-time PCR assay for the simultaneous identification and discrimination of three prevalent Campylobacter spp., C. coli, C. fetus, and C. jejuni, was developed in the current study. The developed Quadruplex real-time PCR assay exhibited high specificity and sensitivity for detecting Campylobacter spp. in chicken and sheep meat.

Funding

The Deanship of Scientific Research and Graduate Studies at Philadelphia University/Jordan funded this study entirely.

Data availability

The datasets analyzed during the current study are available within the manuscript.

Declarations

Conflict of interest

On behalf of all the authors, the corresponding author states that there are no conflicts of interest.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Facciolà A, Riso R, Avventuroso E, Visalli G, Delia SA, Laganà P (2017) Campylobacter: from microbiology to prevention. J Prev Med Pub Health 582:E79–E92 [PMC free article] [PubMed] [Google Scholar]
  • 2.Goddard MR, O’Brien S, Williams N, Guitian J, Grant A, Cody A, Colles F, Buffet J-C, Adlen E, Stephens A (2022) and others. A restatement of the natural science evidence base regarding the source, spread and control of Campylobacter species causing human disease. Proceedings of the Royal Society B: Biological Sciences 2891977:20220400. doi:10.1098/rspb.2022.0400 [DOI] [PMC free article] [PubMed]
  • 3.Huayanay I, Pozo L, Bangash S, Ramirez D, Rosas L, Arauco Brown R (2020) An Unusual Case of Campylobacter jejuni Gastroenteritis Presenting with Acute Reversible Encephalopathy in an Immunocompetent Host. Case Reports in Infectious Diseases 2020:9603428. 10.1155/2020/9603428 [DOI] [PMC free article] [PubMed]
  • 4.CDC CfDCP- (2017) Campylobacter (Campylobacteriosis)
  • 5.Liu KC, Jinneman KC, Neal-McKinney J, Wu WH, Rice DH (2017) Simultaneous identification of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari with SmartCycler-Based multiplex quantitative polymerase chain reaction. Foodborne Pathog Dis 147:371–378. 10.1089/fpd.2016.2245 [DOI] [PubMed] [Google Scholar]
  • 6.Rautelin H, Hanninen M-L (2000) Campylobacters: the most common bacterial enteropathogens in the nordic countries. Ann Med 327:440–445. 10.3109/07853890009002018 [DOI] [PubMed] [Google Scholar]
  • 7.Taheri N, Fällman M, Wai SN, Fahlgren A (2019) Accumulation of virulence-associated proteins in Campylobacter jejuni outer membrane vesicles at human body temperature. J Proteom 195:33–40. 10.1016/j.jprot.2019.01.005 [DOI] [PubMed] [Google Scholar]
  • 8.Man SM (2011) The clinical importance of emerging Campylobacter species. Nat Reviews Gastroenterol Hepatol 812:669–685 [DOI] [PubMed] [Google Scholar]
  • 9.Scallan E, Hoekstra RM, Mahon BE, Jones TF, Griffin PM (2015) An assessment of the human health impact of seven leading foodborne pathogens in the United States using disability adjusted life years. Epidemiol Infect 14313:2795–2804. 10.1017/s0950268814003185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.European Food Safety Authority ECfDPaC (2021) The European Union One Health 2019 Zoonoses Report. EFSA J 19(2):e06406. 10.2903/j.efsa.2021.6406 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Delong WJ, Jaworski MD, Ward AC (1996) Antigenic and restriction enzyme analysis of Campylobacter spp associated with abortion in sheep. Am J Vet Res 57(2):163–167 [PubMed] [Google Scholar]
  • 12.Skirrow MB (1994) Diseases due to Campylobacter, Helicobacter and related bacteria. J Comp Pathol 1112:113–149. 10.1016/s0021-9975(05)80046-5 [DOI] [PubMed] [Google Scholar]
  • 13.Hakkinen M, Hänninen M-L (2009) Shedding of Campylobacter spp. in Finnish cattle on dairy farms. J Appl Microbiol 1073:898–905. 10.1111/j.1365-2672.2009.04269.x [DOI] [PubMed] [Google Scholar]
  • 14.Garcia M (1983) Campylobacter important in veterinary medicine. Vet Bull 53:793–818 [Google Scholar]
  • 15.Campero CM, Anderson ML, Walker RL, Blanchard PC, Barbano L, Chiu P, Martínez A, Combessies G, Bardon JC, Cordeviola J (2005) Immunohistochemical identification of Campylobacter fetus in natural cases of bovine and ovine abortions. J Vet Med B 523:138–141. 10.1111/j.1439-0450.2005.00834.x [DOI] [PubMed] [Google Scholar]
  • 16.Dorsch MA, Casaux ML, Calleros L, Aráoz V, Caffarena RD, Monesiglio C, Barcellos M, da Silva Silveira C, Perdomo Y, Banchero G (2022) and others. Placentitis and abortion caused by a multidrug resistant strain of Campylobacter fetus subspecies fetus in a sheep in Uruguay Rev Argent Microbiol 54(1):25–30. 10.1016/j.ram.2021.02.005 [DOI] [PubMed]
  • 17.Hong CB, Donahue JM (1989) Campylobacteriosis in an aborted equine fetus. J Am Vet Med Assoc 194(2):263–264 [PubMed] [Google Scholar]
  • 18.Sauerwein RW, Bisseling J, Horrevorts AM (1993) Septic abortion associated with Campylobacter fetus subspecies fetus infection: case report and review of the literature. Infection 215:331–333. 10.1007/bf01712458 [DOI] [PubMed] [Google Scholar]
  • 19.Kuhn KG, Falkenhorst G, Ceper T, Dalby T, Ethelberg S, Mølbak K, Krogfelt KA (2012) Detection of antibodies to Campylobacter in humans using enzyme-linked immunosorbent assays: a review of the literature. Diagn Microbiol Infect Dis 742:113–118. 10.1016/j.diagmicrobio.2012.06.004 [DOI] [PubMed] [Google Scholar]
  • 20.Hänninen M-L, Haajanen H, Pummi T, Wermundsen K, Katila M-L, Sarkkinen H, Miettinen I, Rautelin H (2003) Detection and typing of Campylobacter jejuni and Campylobacter coli and Analysis of Indicator Organisms in three Waterborne outbreaks in Finland. Appl Environ Microbiol 693:1391–1396. 10.1128/AEM.69.3.1391-1396.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wu Z, Sippy R, Sahin O, Plummer P, Vidal A, Newell D, Zhang Q (2014) Genetic diversity and antimicrobial susceptibility of Campylobacter jejuni isolates associated with sheep abortion in the United States and Great Britain. J Clin Microbiol 526:1853–1861. 10.1128/jcm.00355-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Erdősi O, Szakmár K, Szili Z, Szita G, Bernáth S, Sövényi J, Laczay P (2018) Rapid in-house detection method of Campylobacter spp. from food by redox potential monitoring combined with real-time PCR. Acta Vet Hung 661:1–11. 10.1556/004.2018.001 [DOI] [PubMed] [Google Scholar]
  • 23.Fabiani L, Delibato E, Volpe G, Piermarini S, De Medici D, Palleschi G (2019) Development of a sandwich ELIME assay exploiting different antibody combinations as sensing strategy for an early detection of Campylobacter. Sens Actuators B Chem 290:318–325 [Google Scholar]
  • 24.Platts-Mills JA, Liu J, Gratz J, Mduma E, Amour C, Swai N, Taniuchi M, Begum S, Peñataro Yori P, Tilley DH (2014) Detection of Campylobacter in stool and determination of significance by culture, enzyme immunoassay, and PCR in developing countries. J Clin Microbiol 524:1074–1080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bessède E, Solecki O, Sifré E, Labadi L, Mégraud F (2011) Identification of Campylobacter species and related organisms by matrix assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry. Clin Microbiol Infect 1711:1735–1739. 10.1111/j.1469-0691.2011.03468.x [DOI] [PubMed] [Google Scholar]
  • 26.Feucherolles M, Nennig M, Becker SL, Martiny D, Losch S, Penny C, Cauchie H-M, Ragimbeau C (2021) Investigation of MALDI-TOF Mass Spectrometry for Assessing the Molecular Diversity of Campylobacter jejuni and Comparison with MLST and cgMLST: A Luxembourg One-Health Study. Diagnostics 1111:1949 [DOI] [PMC free article] [PubMed]
  • 27.Keramas G, Bang DD, Lund M, Madsen M, Rasmussen SE, Bunkenborg H, Telleman P, Christensen CBV (2003) Development of a sensitive DNA microarray suitable for rapid detection of Campylobacter spp. Mol Cell Probes 174:187–196. 10.1016/S0890-8508(03)00052-5 [DOI] [PubMed] [Google Scholar]
  • 28.Volokhov D, Chizhikov V, Chumakov K Fau, Chumakov K, Rasooly A Fau, Rasooly A (2003) Microarray-based identification of thermophilic Campylobacter jejuni, C. Coli, C. lari, and C. Upsaliensis. J Clin Microbiol 41(9):4071–4080. 10.1128/JCM.41.9.4071-4080.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Peruzy MF, Proroga YTR, Capuano F, Corrado F, Santonicola S, De Medici D, Delibato E, Murru N (2020) Detection and quantification of Campylobacter in foods: New analytic approaches to detect and quantify Campylobacter spp. in food samples. Ital J Food Saf 92:8591. 10.4081/ijfs.2020.8591 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Abu-Halaweh M, Bates J, Patel BKC (2005) Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR. Res Microbiol 1561:107–114. 10.1016/j.resmic.2004.08.008 [DOI] [PubMed] [Google Scholar]
  • 31.Best EL, Powell EJ, Swift C, Grant KA, Frost JA (2003) Applicability of a rapid duplex real-time PCR assay for speciation of Campylobacter jejuni and Campylobacter coli directly from culture plates. FEMS Microbiol Lett 2292:237–241. 10.1016/s0378-1097(03)00845-0 [DOI] [PubMed] [Google Scholar]
  • 32.Liu Y, Xu M, Wang J, Cao Y, Wang T, Mu L, Niu C (2022) Detection of Campylobacter jejuni based on a real-time fluorescence Loop-mediated isothermal amplification method. Biomed Res Int 2022:3613757. 10.1155/2022/3613757 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ito S, Kishimoto M (2023) Development of a sampling and real-time PCR method for the quantitative detection of Campylobacter spp. in Retail Chicken meat without DNA extraction. J Food Prot 861:100028. 10.1016/j.jfp.2022.100028 [DOI] [PubMed] [Google Scholar]
  • 34.Lanzl MI, Zwietering MH, Abee T, den Besten HMW (2022) Combining enrichment with multiplex real-time PCR leads to faster detection and identification of Campylobacter spp. in food compared to ISO 10272–1:2017. Food Microbiol 108:104117. 10.1016/j.fm.2022.104117 [DOI] [PubMed] [Google Scholar]
  • 35.Ricke SC, Feye KM, Chaney WE, Shi Z, Pavlidis H, Yang Y (2018) Developments in Rapid Detection methods for the detection of Foodborne Campylobacter in the United States. Front Microbiol 9:3280. 10.3389/fmicb.2018.03280 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.He Y, Yao X, Gunther NW, Xie Y, S-I T, Shi X (2010) Simultaneous detection and differentiation of Campylobacter jejuni, C. Coli, and C. lari in chickens using a Multiplex Real-Time PCR assay. Food Anal Methods 34:321–329. 10.1007/s12161-010-9136-6 [Google Scholar]
  • 37.Schnider A, Overesch G, Korczak B, Kuhnert P (2010) Comparison of real-time PCR assays for detection, quantification, and differentiation of Campylobacter jejuni and Campylobacter coliin broiler Neck skin samples. J Food Prot 736:1057–1063 [DOI] [PubMed] [Google Scholar]
  • 38.Govindaswamy J, Zeller-Péronnet V, Pavlovic M, Wirtz D, Murr L, Thärigen D, Colson B, Uhlig S, Busch U, Huber I (2022) Digital droplet-PCR for quantification of viable Campylobacter jejuni and Campylobacter coli in chicken meat rinses. Appl Ther 1211:5315 [Google Scholar]
  • 39.Abu-Halaweh M (2005) Molecular methods for Campylobacter and Arcobacter detection. Griffith University, Brisbane, Queensland, Australia [Google Scholar]
  • 40.Hall TA, BIOEDIT: A USER-FRIENDLY, BIOLOGICAL SEQUENCE ALIGNMENT EDITOR (1999) AND ANALYSIS PROGRAM FOR WINDOWS 95/98/ NT
  • 41.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 2153:403–410. 10.1016/s0022-2836(05)80360-2 [DOI] [PubMed] [Google Scholar]
  • 42.Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG (2012) Primer3–new capabilities and interfaces. Nucleic Acids Res 4015:e115. 10.1093/nar/gks596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Hum S, Quinn K, Brunner J, On SL (1997) Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies. Aust Vet J 7511:827–831 [DOI] [PubMed] [Google Scholar]
  • 44.Debruyne L, Samyn E, De Brandt E, Vandenberg O, Heyndrickx M, Vandamme P (2008) Comparative performance of different PCR assays for the identification of Campylobacter jejuni and Campylobacter coli. Res Microbiol 1592:88–93. 10.1016/j.resmic.2007.11.020 [DOI] [PubMed] [Google Scholar]
  • 45.Talibart R, Denis M, Castillo A, Cappelier JM, Ermel G (2000) Survival and recovery of viable but noncultivable forms of Campylobacter in aqueous microcosm. Int J Food Microbiol 551–3:263–267. 10.1016/s0168-1605(00)00201-4 [DOI] [PubMed] [Google Scholar]
  • 46.Oliver JD (2005) The viable but nonculturable state in bacteria. J Microbiol 43 Spec No:93–100 [PubMed]
  • 47.Bender AC, Faulkner JA, Tulimieri K, Boise TH, Elkins KM (2020) High resolution melt assays to detect and identify Vibrio parahaemolyticus, Bacillus cereus, Escherichia coli, and Clostridioides difficile Bacteria. Microorganisms 84. 10.3390/microorganisms8040561 [DOI] [PMC free article] [PubMed]
  • 48.Liu Y, Singh P, Mustapha A (2018) High-resolution melt curve PCR assay for specific detection of E. Coli O157:H7 in beef. Food Control 86:275–282. 10.1016/j.foodcont.2017.11.025 [Google Scholar]
  • 49.Van Lint P, De Witte E, De Henau H, De Muynck A, Verstraeten L, Van Herendael B, Weekx S (2015) Evaluation of a real-time multiplex PCR for the simultaneous detection of Campylobacter jejuni, Salmonella spp., Shigella spp./EIEC, and Yersinia enterocolitica in fecal samples. Eur J Clin Microbiol Infect Dis 343:535–542 [DOI] [PubMed] [Google Scholar]
  • 50.Thomas M, Janzen T, Huscyzynsky G, Mathews A, Amoako K (2017) Development of a novel multiplexed qPCR and pyrosequencing method for the detection of human pathogenic yersiniae. Int J Food Microbiol 257:247–253 [DOI] [PubMed] [Google Scholar]
  • 51.Ruan JH, Wang WJ, Zhang TY, Bai QY, Zheng T, Zhang ZD, Wu LY, Huang YF, Yu DJ (2017) Rapid detection of serratia fonticola by TaqMan quantitative real-time PCR using primers targeting the gyrB Gene. Curr Microbiol 7411:1343–1348 [DOI] [PubMed] [Google Scholar]
  • 52.Liu Y, Cao Y, Wang T, Dong Q, Li J, Niu C (2019) Detection of 12 common food-borne bacterial pathogens by TaqMan Real-Time PCR using a single set of reaction conditions. Front Microbiol 10. 10.3389/fmicb.2019.00222 [DOI] [PMC free article] [PubMed]
  • 53.Dharmaraj K, Andersen MT, Alexander BJR, Toome-Heller M (2022) A New TaqMan Real-Time PCR assay for detecting the Blueberry Pathogen Monilinia vaccinii-corymbosi. Plant Dis 1067:1826–1831. 10.1094/pdis-08-21-1737-re [DOI] [PubMed] [Google Scholar]
  • 54.Zübert C, Kube M (2021) Application of TaqMan Real-Time PCR for Detecting ‘Candidatus Arsenophonus Phytopathogenicus’ Infection in Sugar Beet. Pathogens 1011. 10.3390/pathogens10111466 [DOI] [PMC free article] [PubMed]
  • 55.Baccari O, Barkallah M, Elleuch J, Ben Ayed N, Chtourou A, Karray-Hakim H, Hammami A, Michaud P, Fendri I, Abdelkafi S (2022) A new TaqMan real-time PCR assay to detect Parachlamydia acanthamoebae and to monitor its co-existence with SARS-COV-2 among COVID-19 patients. Environ Sci Pollut Res. 10.1007/s11356-022-23227-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Xu G, Ribbe F, McCaffery J, Luo C-Y, Li AY, Rich SM (2022) Development of a Taqman Real-Time PCR for the identification of Haemaphysalis longicornis (Acari: Ixodidae). J Med Entomol 594:1484–1487. 10.1093/jme/tjac074 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Groff ACM, Kirinus JK, Silva MSe, Machado G, Costa MM, Vargas APC (2010) Polymerase chain reaction for the diagnosis of bovine genital campylobacteriosis. Pesqui Vet Bras. 30
  • 58.Merker Breyer G, Dias ME, Henker LC, Lorenzett MP, Ferreira Baumbach L, Canal CW, Petinatti Pavarini S, Maboni Siqueira F (2021) Campylobacter fetus in Abomasal Fluid from spontaneously aborted bovine and ovine fetuses. Acta Sci Veterinariae 49. 10.22456/1679-9216.117643
  • 59.On S, Brandt J, Cornelius A, Fusco V, Quero G, Maćkiw E, Houf K, Bilbao A, Díaz, Benejat (2013) and others. PCR revisited: A case for revalidation of PCR assays for microorganisms using identification of Campylobacter species as an exemplar. Quality Assurance and Safety of crops & foods 5:49–62. 10.3920/QAS2012.0158
  • 60.Totten P, Patton C, Tenover F, Barrett T, Stamm W, Steigerwalt A, Lin J, Holmes K, Brenner D (1987) Prevalence and characterization of hippurate-negative Campylobacter jejuni in King County, Washington. J Clin Microbiol 259:1747–1752 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Iraola G, Pérez R, Betancor L, Marandino A, Morsella C, Méndez A, Paolicchi F, Piccirillo A, Tomás G, Velilla A (2016) and others. A novel real-time PCR assay for quantitative detection of Campylobacter fetus based on ribosomal sequences. BMC Vet Res1746-6148 (Electronic) [DOI] [PMC free article] [PubMed]
  • 62.Kreitlow A, Becker A, Ahmed MFE, Kittler S, Schotte U, Plötz M, Abdulmawjood A (2021) Combined Loop-mediated isothermal amplification assays for Rapid Detection and one-step differentiation of Campylobacter jejuni and Campylobacter coli in Meat products. Front Microbiol 12:241–250. 10.3389/fmicb.2021.668824 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Liu Y, Xu M, Wang J, Cao Y, Wang T, Mu LA-O, Niu CA-O (2022) Detection of Campylobacter jejuni based on a real-time fluorescence Loop-mediated isothermal amplification method. BioMed Research International2314-6141 (Electronic). [DOI] [PMC free article] [PubMed]
  • 64.Mayr AM, Lick S, Bauer J, Thärigen D, Busch U, Huber I (2010) Rapid Detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in Food, using Multiplex Real-Time PCR. J Food Prot 732:241–250. 10.4315/0362-028X-73.2.241 [DOI] [PubMed] [Google Scholar]
  • 65.Ding T, Suo Y, Zhang Z, Liu D, Ye X, Chen S, Zhao Y (2017) A multiplex RT-PCR assay for S. Aureus, L. monocytogenes, and Salmonella spp. detection in raw milk with pre-enrichment. Front Microbiol 8:989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Quynh Huong L, Thi Hanh T, Dac Cam P, Thi Be N (2006) Study on the prevalence of Campylobacter spp. from chicken meat in Hanoi, Vietnam. ANN NY ACAD SCI 1081:273–275. 10.1196/annals.1373.036 [DOI] [PubMed] [Google Scholar]
  • 67.Rodrigues CS, Armendaris PM, de Sá CVGC, Haddad JPA, de Melo CB (2021) Prevalence of Campylobacter spp. in chicken carcasses in slaughterhouses from South of Brazil. Curr Microbiol 786:2242–2250. 10.1007/s00284-021-02478-w [DOI] [PubMed] [Google Scholar]
  • 68.Mikulić M, Humski A, Njari B, Ostović M, Duvnjak S, Cvetnić Ž (2016) Prevalence of Thermotolerant Campylobacter spp. in Chicken meat in Croatia and Multilocus sequence typing of a small subset of Campylobacter jejuni and Campylobacter coli isolates. Food Technol Biotechnol 544:475–481. 10.17113/ftb.54.04.16.4647 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Kramer JM, Frost JA, Bolton FJ, Wareing DR (2000) Campylobacter contamination of raw meat and poultry at retail sale: identification of multiple types and comparison with isolates from human infection. J Food Prot 6312:1654–1659. 10.4315/0362-028x-63.12.1654 [DOI] [PubMed] [Google Scholar]
  • 70.Di Giannatale E, Calistri P, Di Donato G, Decastelli L, Goffredo E, Adriano D, Mancini ME, Galleggiante A, Neri D, Antoci S (2019) Thermotolerant Campylobacter spp. in chicken and bovine meat in Italy: prevalence, level of contamination and molecular characterization of isolates. PLoS ONE 1412:e0225957 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Mohamed K (2019) Prevalence of Campylobacter spp. and its pathogenic genes in Poultry Meat, Human and Environment in Aswan, Upper Egypt. Assiut Vet Med J 65(161):151–158. 10.21608/avmj.2019.168777 [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets analyzed during the current study are available within the manuscript.


Articles from Brazilian Journal of Microbiology are provided here courtesy of Brazilian Society of Microbiology

RESOURCES