Protocol for CRISPR-Cas12a genome editing of protein tyrosine phosphatases in human pluripotent stem cells and functional β-like cell generation

Summary

Gene editing of human pluripotent stem cells is a promising approach for developing targeted gene therapies for metabolic diseases. Here, we present a protocol for generating a CRISPR-Cas12a gene knockout of protein tyrosine phosphatases in human embryonic stem cells. We describe steps for differentiating the edited clones into pancreatic islet-like spheroids rich in β-like cells. We then detail procedures for implanting these spheroids under the murine kidney capsule for in vivo maturation.

Graphical abstract

Highlights

• •Optimization of CRISPR-Cas12a gene editing in human embryonic stem cells
• •Steps for stem cell differentiation to generate pancreatic islet-like spheroids
• •Implantation of pancreatic islet-like spheroid in NOD-SCID mice for maturation
• •Functional pancreatic islet-like spheroids respond to glucose and control glycemia

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Gene editing of human pluripotent stem cells is a promising approach for developing targeted gene therapies for metabolic diseases. Here, we present a protocol for generating a CRISPR-Cas12a gene knockout of protein tyrosine phosphatases in human embryonic stem cells. We describe steps for differentiating the edited clones into pancreatic islet-like spheroids rich in β-like cells. We then detail procedures for implanting these spheroids under the murine kidney capsule for in vivo maturation.

Before you begin

Kinases and phosphatases regulate signal transduction, and their dysfunction has critical implications in metabolic diseases. Protein tyrosine phosphatases (PTPs) are a superfamily of enzymes that have been identified as important modulators of cellular function and disease development.^1,2 Importantly, dysregulated expression of protein tyrosine phosphatase receptor F (PTPRF) results in dysfunctional insulin signaling and insulin resistance.^3,4 Recently, the protein tyrosine phosphatase receptor kappa (PTPRK) was found to be associated with an increased risk of type 1 diabetes development in a genome-wide association study.^5,6 However, the functional consequences of PTPRF or PTPRK dysregulation during the development of mature β cells remain unknown.

Gene editing in human pluripotent stem cells (hPSCs) is currently being developed and harnessed for use in drug discovery and personalized medicine.⁷ Using CRISPR-Cas12a technology, we established a gene editing protocol for H1 stem cells, a human embryonic stem cell line. PTPRF and PTPRK gene knockouts were generated, and clone validation was performed. Subsequently, we optimized a β-like cell differentiation protocol for our PTPRF wild-type and knockout clones to generate pancreatic islet-like spheroids, adapted from published protocols.^8,9 These spheroids were successfully implanted under the kidney capsule of non-obese diabetic severe combined immunodeficient (NOD/SCID) mice. Grafted cells contributed to glucose homeostasis, and the in vivo response was determined by post-implantation blood human C-peptide levels. This protocol was established and refined to study the roles of PTPs and other genes of interest in β-like cell development and maturation.

We made several adaptations to develop an improved gene editing protocol, including the electroporation conditions and clone characterization. In addition, coating, medium, and rho kinase (ROCK) inhibitors were carefully selected to effectively generate gene knockouts. This protocol was designed using the H1 human embryonic stem cell (hESC) line, Cas12a protein, and Neon transfection system. We utilized Cas12a instead of other RNA-guided CRISPR-associated (Cas) proteins because of its higher specificity and more precise DNA recognition, which prevents off-target effects.^10,11 Furthermore, Cas12a is smaller, facilitating its insertion into cells while causing less damage to the cell membrane. It also recognizes T-rich PAM sequences and generates a staggered cut distal to the PAM site. The 5′ and 3′ sticky ends generated by Cas12a reduce the formation of small insertions and deletions (INDELs) and are advantageous for knock-in gene editing.¹² In addition to the H1 hESC line, we tested this protocol in the HEL 46.11 hiPSC line to generate knockouts. The proposed protocol can be adapted for other hPSC lines with minor changes in coating or medium selection. Further optimization may be required for different cell types, such as tumor, immortalized, or primary cell lines.

Several β-like cell differentiation protocols have been published demonstrating varying efficiencies of insulin-positive cells.^{9,13,14,15,16} In this protocol, we describe a time-efficient and reliable method for generating β-like cells. The resulting pancreatic islet-like spheroids can be utilized for various applications, including western blotting, qPCR, immunofluorescence, and single-cell RNA sequencing. Importantly, we implanted stem cell-differentiated spheroids, rich in β-like cells, under the kidney capsule of NOD/SCID mice for in vivo maturation. Several studies have utilized stem cell-derived β-like cell implantation to study their role in vivo and in hPSC-based diabetes disease models.^8,17,18 Here, we propose the first step-by-step detailed protocol, including troubleshooting and quality controls. After 16 weeks of in vivo maturation and chemical ablation of murine endogenous β cells, the implanted spheroids effectively controlled glucose homeostasis in mice. Using our methods, gene editing can be performed on key genes involved in diabetes (PTPRF and PTPRK) to assess their roles in β-like cell development and pathophysiology.

Human embryonic stem cell general guidelines

Due to the cellular stress induced by electroporation, stem cells should be maintained and cultured for at least 1 week after thawing and before transfection. Additionally, stem cells should be thawed at a low passage number (below 20 passages) and monitored for steady growth rate, morphology, and spontaneous differentiation. All culture vessels must be precoated and, along with the stem cell media, equilibrated to 20°C–25°C for 1 h before use. Below, we describe the general steps required for coating, cell maintenance, splitting, and freezing stem cells.

• 1.
  Coat one 3.5-cm dish with 1.5 mL of 50 μg/mL of Matrigel diluted in DMEM F-12.

  • a.
    Use 150–200 μL of Matrigel diluted in DMEM F-12 per cm² of culture vessel, as per manufacturer’s instructions for optimal cell attachment and development.
  • b.
    Perform Matrigel coating using pre-chilled tips in a pre-chilled culture vessel and incubate at 37°C for 30 min to form the gel.

Note: After coating, store plates at 4°C in Matrigel coating solution for up to a week.

Alternatives: Several matrix options are available for feeder-free hPSC maintenance, including Geltrex, Laminin (especially Laminin 521), CellStart, and Vitronectin, in addition to Matrigel. When switching matrices, it is crucial to test diverse options to determine the most suitable for the hPSC line.

• 2.
  Quickly thaw a frozen cryovial containing the H1 cells in a 37°C bath until a small amount of ice remains in the vial.

  • a.
    In a laminar flow, gently transfer the cells into a 15 mL tube.
  • b.
    Add 4 mL of mTeSR Plus supplemented with 10 μM ROCK inhibitor, drop by drop, while gently flicking the tube.
  • c.
    Centrifuge at 250 × g for 3 min.
  • d.
    During centrifugation, change the medium in the coated 3.5-cm dish with 1 mL of mTeSR Plus supplemented with 10 μM ROCK inhibitor.
  • e.
    After centrifugation, remove the supernatant, and gently resuspend the cell pellet in 1 mL of freshly prepared mTeSR Plus supplemented with 10 μM ROCK inhibitor.
  • f.
    Add the cell suspension to the coated 3.5-cm dish.
  • g.
    Place the dish into a humidified incubator at 37°C and 5% CO₂ concentration.
• 3.Replace the medium daily with 1.5 mL of fresh mTeSR Plus without ROCK inhibitor.
• 4.
  Split the cells when they reach approximately 80% confluence, ideally 3–4 days after every seeding.

  • a.
    Wash the cells twice with 1 mL of 0.5 mM EDTA.
  • b.
    Incubate with 1 mL of 0.5 mM EDTA for 3–4 min at 20°C–25°C.
  • c.
    Remove the EDTA and add 1 mL of fresh mTeSR Plus.
  • d.
    Gently detach the cells pipetting up and down the medium 4–6 times.
  • e.
    Distribute the cells in the required culture vessels with a recommended split ratio of 1:6–1:10.
  • f.
    Place the dish into a humidified incubator at 37°C with 5% CO₂ concentration.

Note: EDTA is used as a gentle, non-enzymatic dissociation reagent for long-term culture expansion of hPSCs due to its simplicity and efficiency. It partially dissociates cells into small aggregates and enhances cell survival.

Note: To ensure a low passage number during gene editing, the cells will be used for electroporation after being split once and reaching 80% confluence (see Transfection section).

• 5.
  Freeze the cells.

  • a.
    Once the cells are 80% confluent, prepare 2 cryovials per 3.5-cm dish and fresh Freezing Medium I and II.

    Note: Freezing medium I is kept at 20°C–25°C for resuspending cells after EDTA-mediated dissociation of hPSCs. Freezing medium II is pre-chilled at 4°C to maintain cell viability and integrity during cryopreservation. Pre-chilling prevents thermal shock, reduces metabolic activity, and preserves cell function and structure, while enhancing the efficacy of cryoprotectants like DMSO.

  • b.
    Wash the cells twice with 1 mL of 0.5 mM EDTA.
  • c.
    Add 1 mL of 0.5 mM EDTA and incubate for 3–4 min at 20°C–25°C.
  • d.
    Remove the EDTA and add 1 mL of Freezing medium I.
  • e.
    Detach the cells using a cell scraper and gently resuspend the cells.
  • f.
    Distribute half the volume of the cell suspension in each cryovial.
  • g.
    Add 500 μL of cold Freezing medium II drop by drop to each vial, while gently flicking the tube.
  • h.
    Close the cryovial and invert it once.
  • i.
    Rapidly place the cryovials in an appropriate freezing container that allows the temperature to decrease at a rate of 1°C per minute and store them at −80°C for 14–18 h.
• 6.Transfer the cryovials to a liquid nitrogen tank the next day for long-term storage.

Preparation of the basal media and small molecules

Access to basic cell culture facilities, supplies, and a robust knowledge of stem cell culture and mouse handling is required for this protocol. The specific set of resources, consumables, and reagents needed are detailed in the key resources table.

• 7.Prepare the basal media under aseptic conditions.

Note: The media must be filter sterilized after all the reagents have been dissolved. The basal media should be stored at 4°C protected from light for up to 3 weeks.

• 8.Prepare small molecules and reagents for each stage of the β-like cell differentiation protocol (Table 1).

Note: To improve protocol efficiency and limit freeze-thaw cycles, small molecules and reagents are combined into stage-specific supplements, which are aliquoted into 25 μL volumes. Small molecules and supplements should be stored protected from light at −20°C for up to 6 months.

Table 1.

Reagents and small molecules used in the β-like cell differentiation

Reagent	Final concentration	Solvent
α-Amyloid precursor protein modulator	2.5 mM	DMSO
Activin A	1 mg/mL	ddH2O with 0.1% BSA
ALK5 Inhibitor II	50 mM	DMSO
CHIR-99021	10 mM	DMSO
FGF-7 (KGF)	100 μg/mL	DPBS with 0.1% BSA
Sobetirome (GC-1)	10 mM	DMSO
γ-Secretase Inhibitor XX (GSiXX)	1 mM	DMSO
Human recombinant EGF	1 mg/mL	ddH2O
SP600125 (JNK Pathway inhibitor)	100 mM	DMSO
L-Ascorbic acida	250 mM	ddH2O
LDN-193189	1 mM	DMSO
N-acetylcysteinea	100 mM	ddH2O
Nicotinamidea	1 M	ddH2O
Bemcentinib (R428)	10 mM	DMSO
Recombinant Human Betacellulin	100 μg/mL	ddH20 with 0.1% BSA
Retinoic acid	10 mM	DMSO
ROCK inhibitor (Y-27632)	10 mM	ddH2O
Resveratrol (RSV)	225 mM	DMSO
SANT-1	2.5 mM	DMSO
Trolox	100 mM	DMSO
Zinc sulfate heptahydratea	10 mM	ddH2O

Concentrations of reagents and small molecules along with their respective solvents for reconstitution.

^aSterilize by filtering using a 0.22 μm filter after dissolution.

Institutional permissions

This protocol was developed to generate stem cell-derived mature β-like cells. All animals were maintained according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and all experimental procedures were approved and performed following the Commission d’Ethique du Bien-être Animal of the ULB (ref. 732N and 802N).

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit PTPRF/LAR polyclonal antibody (1:500)	Cell Signaling Technology	Cat# 17164, RRID: AB_2798778
Rabbit PTPRF/LAR (E6W4X) monoclonal antibody (1:500)	Cell Signaling Technology	Cat# 61611, RRID: AB_2941368
Rabbit PTPRF monoclonal antibody (S165-38) (1:500)	Thermo Fisher Scientific	Cat# MA5-27668, RRID: AB_2735337
Rabbit PTPRK polyclonal antibody (1:500)	Novus	Cat# NBP2-30977, RRID: AB_2941369
Human PTPRK monoclonal antibody (1:500)	Faernley et al., eLife, 2019	Clone 2. H4
Rabbit Oct-4A (C30A3) monoclonal antibody (1:500)	Cell Signaling Technology	Cat# 2840, RRID: AB_2167691
Rabbit Nanog (D73G4) XP monoclonal antibody (1:500)	Cell Signaling Technology	Cat# 4903, RRID: AB_10559205
Mouse SSEA4 monoclonal antibody (MC-813-70), DyLight 550 (1:500)	Thermo Fisher Scientific	Cat# MA1-021-D550, RRID: AB_2536689
Mouse TRA-1-60 monoclonal antibody (TRA-1-60) (1:500)	Thermo Fisher Scientific	Cat# MA1-023, RRID: AB_2536699
Rabbit Vimentin (D21H3) XP monoclonal antibody (1:500)	Cell Signaling Technology	Cat# 5741, RRID: AB_10695459
Rabbit β3-Tubulin (D71G9) XP monoclonal antibody (1:500)	Cell Signaling Technology	Cat# 5568, RRID: AB_10694505
Goat anti-human Sox17 polyclonal antibody (1:500)	R&D Systems	Cat# AF1924, RRID: AB_355060
Mouse anti-Nkx6.1 (clone R11-560) monoclonal antibody (1:400)	BD Biosciences	Cat# 563022; RRID: AB_2737958
Rabbit Pdx1 (D59H3) XP monoclonal antibody (1:400)	Cell Signaling Technology	Cat# 5679 RRID: AB_10706174
Guinea pig insulin polyclonal antibody (FLEX RTU)	Agilent Technologies	Cat# IR002 RRID: AB_2800361
Rabbit glucagon polyclonal antibody (1:500)	Cell Signaling Technology	Cat# 2760 RRID: AB_659831
Rat somatostatin (human/mouse) monoclonal antibody (1:500)	Bio-Techne	Cat# MAB2358 RRID: AB_2722572
Donkey anti-rabbit IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor 488 (1:500)	Thermo Fisher Scientific	Cat# A-21206, RRID: AB_2535792
Donkey anti-rabbit IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor Plus 555 (1:500)	Thermo Fisher Scientific	Cat# A32794, RRID: AB_2762834
Donkey anti-mouse IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor Plus 555 (1:500)	Thermo Fisher Scientific	Cat# A32773, RRID: AB_2762848
Donkey anti-mouse IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor 488 (1:500)	Thermo Fisher Scientific	# A21202, RRID: AB_141607
Donkey anti-goat IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor Plus 555 (1:500)	Thermo Fisher Scientific	Cat# A32816, RRID: AB_2762839
Goat anti-Guinea pig IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor 488 (1:500)	Thermo Fisher Scientific	Cat# A11073 RRID: AB_2534117
Donkey anti-rat IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor 647 (1:500)	Thermo Fisher Scientific	Cat# A78947 RRID: AB_2910635
Rabbit β-actin polyclonal antibody (1:5,000)	Cell Signaling Technology	Cat# 4967 RRID: AB_330288
Chemicals, peptides, and recombinant proteins
Matrigel growth factor reduced (GFR) basement membrane matrix, phenol red-free, LDEV-free	Corning Incorporated	Cat# 356231
mTeSR Plus	STEMCELL Technologies	Cat# 100-0276
ROCK inhibitor (Y-27632)	STEMCELL Technologies	Cat# 72304
UltraPure 0.5 M EDTA, pH 8.0	Thermo Fisher Scientific	Cat# 15575020
DMEM/F-12, GlutaMAX supplement	Thermo Fisher Scientific	Cat# 10565018
DMEM, high glucose, pyruvate, no glutamine	Thermo Fisher Scientific	Cat# 21969035
Fetal bovine serum, qualified, USDA-approved regions	Thermo Fisher Scientific	Cat# 10437028
Dimethyl sulfoxide (DMSO)	Merck	Cat# D2650
α-Amyloid precursor protein modulator	Merck	Cat# 565740
Activin A	PeproTech	Cat# 120-14E
ALK5 inhibitor II	Enzo Life Sciences	Cat# ALX-270-445
CHIR-99021	Axon Medchem	Cat# 1386
FGF-7 (KGF)	PeproTech	Cat# 100-19
Sobetirome (GC-1)	Tocris	Cat# 4554
γ-Secretase inhibitor XX (GSiXX)	Merck Millipore	Cat# 565789
Human recombinant EGF	STEMCELL Technologies	Cat# 78006
SP600125 (JNK inhibitor)	Selleck Chemicals	Cat# S1460
L-ascorbic acid	Merck	Cat# 95210
LDN-193189	Selleck Chemicals	Cat# S2618
N-acetylcysteine	Merck	Cat# A9165
Nicotinamide	Merck	Cat# N3376
Bemcentinib (R428)	SelleckChem/Bio-Connect BV	Cat# S2841
Recombinant human betacellulin	PeproTech	Cat# 100-50
Retinoic acid	Merck	Cat# R2625
Resveratrol (RSV)	Merck	Cat# R5010
SANT-1	Merck	Cat# S4572
(±)-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox)	Merck	Cat# 238813
Zinc sulfate heptahydrate	Merck	Cat# Z0251
KnockOut serum replacement	Thermo Fisher Scientific	Cat# 10828010
MEM non-essential amino acids solution (100X)	Fisher Scientific	Cat# 11-140-050
2-β-Mercaptoethanol (50 mM)	Thermo Fisher Scientific	Cat# 31350-010
Penicillin-Streptomycin (10,000 U/mL)	Thermo Fisher Scientific	Cat# 15140122
Trizma base	Merck	Cat# T6066
SDS (sodium dodecyl sulfate) Ultrapure	Molekula	Cat# 10325163
Proteinase K	QIAGEN	Cat# 19131
MCDB131 medium (no glutamine)	Thermo Fisher Scientific	Cat# 10372019
GlutaMAX	Thermo Fisher Scientific	Cat# 35050061
Sodium bicarbonate	Merck Millipore	Cat# 1.06329.0500
Glucose, 45% in H2O (2.5 mM)	Merck	Cat# G8769
Bovine serum albumin	Merck	Cat# A7030-100G
Insulin-Transferrin-Selenium-Ethanolamine (100X)	Thermo Fisher Scientific	Cat# 51500056
Heparin (1 mg/mL in H2O)	Merck	Cat# H3149
Citric acid monohydrate	Merck	Cat# C7129
Sodium citrate dihydrate	Merck	Cat# W302600
Matrigel hESC-qualified matrix, LDEV-free	Corning Incorporated	Cat# 354277
Accutase cell detachment solution	Capricorn Scientific	Cat# ACC-1B
CloneR	STEMCELL Technologies	Cat# 05889
Alt-R A.s. Cas12a (Cpf1) Ultra	Integrated DNA Technologies	Cat# 10001272
Alt-R Cpf1 electroporation enhancer	Integrated DNA Technologies	Cat# 1076300
DPBS, calcium, magnesium	Thermo Fisher Scientific	Cat# 14040091
DPBS, no calcium, no magnesium	Thermo Fisher Scientific	Cat# 14190169
MyTaq Red DNA polymerase	GC Biotech	Cat# BIO-21109
GeneRuler 100 bp Plus DNA ladder, ready-to-use	Thermo Fisher Scientific	Cat# SM0323
EZ-LiFT stem cell passaging reagent	Merck	Cat# SCM139
Q5 Hot Start high-fidelity 2× master mix	New England Biolabs	Cat# M0494S
KaryoMAX Colcemid Solution	Thermo Fisher Scientific	Cat# 15210040
Potassium chloride, ≥99.0%	Merck	Cat# P9541
Methanol	Merck	Cat# 1.06008.1000
Acetic acid (Glacial) 100% anhydrous	Merck	Cat# 1.00063.2500
Anti-adherence rinsing solution	STEMCELL Technologies	Cat# 07010
Accumax cell dissociation solution	Thermo Fisher Scientific	Cat# A7089
Critical commercial assays
Neon transfection system 10 μL Kit	Thermo Fisher Scientific	Cat# MPK1096
MycoAlert PLUS Mycoplasma Detection Kit	Lonza	Cat# LT07-701
MycoAlert Assay Control Set	Lonza	Cat# LT07-518
Wizard SV Gel and PCR clean-up system	Promega	Cat# A9282
Human Ultrasensitive C-peptide ELISA	Mercodia	Cat# 10-1141-01
Experimental models: Cell lines
Human WA01 (H1 hESCs) line (wild-type control cell line, male, blastocyst stage)	WiCell	Cat# wa01, RRID:CVCL_9771
Experimental models: Organisms/strains
Mice: NOD/severe-combined-immunodeficiency (8–10 weeks, males)	Jackson Laboratory	Cat# 001303
Oligonucleotides
Table S1	This paper	N/A
Software and algorithms
SnapGene viewer	SnapGene	https://www.snapgene.com/
Benchling	Benchling	https://www.benchling.com/
CRISPOR	Concordet and Haeussler19	http://crispor.tefor.net/
RGENs Cas-Designer	Park et al.20	http://www.rgenome.net/cas-designer/
CHOPCHOP v3	Labun et al., 201921	https://chopchop.cbu.uib.no/
Primer3	Untergasser et al.22	https://www.primer3plus.com/
Primer-BLAST	Ye et al.23	https://www.ncbi.nlm.nih.gov/tools/primer-blast/
Eurofins Genomics	Eurofins Genomics	https://eurofinsgenomics.eu/en/ecom/tools/sequencing-primer-design/
ZEN 3.2 (blue edition)	Carl Zeiss Microscopy GmbH	https://www.micro-shop.zeiss.com/en/be/softwarefinder/software-categories/zen-blue/
D-DiGit Image Acquisition Software	LI-COR	https://www.licor.com/bio/ddigit/software
Amersham ImageQuant 800	Cytiva	https://www.cytivalifesciences.com/en/be/shop/protein-analysis/molecular-imaging-for-proteins/imaging-systems/amersham-imagequant-800-systems-p-11546
CFX Manager Software #1845000 v3.1	Bio-Rad Laboratories	https://www.bio-rad.com/en-be/sku/1845000-cfx-manager-software?ID=1845000
Fiji	Schindelin et al.24	https://fiji.sc/
GraphPad Prism	GraphPad Software	https://www.graphpad.com/
CellProfiler	Stirling et al.25	https://cellprofiler.org/
Other
Neon transfection system	Thermo Fisher Scientific	Cat# MPK5000
VECTASHIELD Antifade mounting medium with DAPI	VectorLabs	Cat# H-1200
AggreWell400	STEMCELL Technologies	Cat# 34450
Corning cell strainer, pore size 40 μm	Merck	Cat# CLS431750-50EA
Hamilton syringe (100 μL, model 710 RN) with needle	Hamilton Company	Cat# 80600
PE-50 tubing	Harvard Apparatus	Cat# 64-0752
Absorbable sutures	SMI	Cat# 15101512
Nylon sutures	SMI	Cat# 9151516
Microvette 100 EDTA K3E	Sarstedt	Cat# 20.1278
Leica TP1020 automatic tissue processor	Leica Biosystems	Cat# 14042231418

See Table S1 for Guide RNAs and oligonucleotides.

Materials and equipment

EDTA 0.5 mM

• •EDTA 0.5 M.
• •DPBS without calcium and magnesium.

Note: Sterilize by filtering using a 0.22 μm filter; store at 20°C–25°C for up to 3 months.

Freezing Medium I

Reagent	Final concentration	Amount
DMEM, high glucose, no glutamine	---	8 mL
Fetal Bovine Serum	20%	2 mL
Total	N/A	10 mL

Note: Do not filter; prepare fresh and use it the same day.

Freezing Medium II

Reagent	Final concentration	Amount
DMEM, high glucose, no glutamine	---	6 mL
Fetal Bovine Serum	20%	2 mL
DMSO	20%	2 mL
Total	N/A	10 mL

Note: The addition of DMSO will heat the solution. Cool it to 4°C, protect it from light, and use it within 30 min after preparation.

Embryoid body formation Medium

Reagent	Final concentration	Amount
DMEM/F-12 GlutaMAX	---	8.78 mL
Knockout Serum Replacement	10%	1 mL
MEM Non-Essential Amino Acids Solution (100X)	1%	100 μL
β-mercaptoethanol	0.1 mM	20 μL
Penicillin/Streptomycin	1%	100 μL
Total	N/A	10 mL

Note: Do not filter; store at 4°C, protected from light, for up to 3 weeks.

gDNA buffer

Reagent	Final concentration	Amount
Tris-HCl	10 mM	605.5 mg
SDS	0.05%	25 mg
Proteinase K [600 U/μL]	800 U/mL	66.67 μL
ddH2O	---	49.9 mL
Total	N/A	50 mL

Note: Sterilize by filtering using a 0.22 μm filter; store at 20°C–25°C for up to 6 months.

Basal Medium 1

Reagent	Amount (final concentration)	Comments
MCDB131	500 mL	Base medium
GlutaMax	5 mL (2 mM)	L-glutamine supplement
Sodium bicarbonate	750 mg (1.5 g/L)	Buffer
D-glucose	889 μL (10 mM)	Includes base medium glucose content
Fatty acid-free BSA	2.5 mg (0.5%)	Medium supplement
Total	506 mL

Note: Sterilize by filtering using a 0.22 μm filter; store at 4°C, protected from light, for up to 3 weeks.

Basal Medium 2

Reagent	Amount (final concentration)	Comments
MCDB131	500 mL	Base medium
GlutaMax	5 mL (2 mM)	L-glutamine supplement
Sodium bicarbonate	750 mg (1.5 g/L)	Buffer
Glucose	889 μL (10 mM)	Includes base medium glucose content
Fatty acid-free BSA	10 mg (2%)	Medium supplement
ITS-X	2.5 mL (0.5%)	Insulin-Transferrin-Selenium Ethanolamine: medium supplement
Total	509 mL

Note: Sterilize by filtering using a 0.22 μm filter; store at 4°C, protected from light, for up to 3 weeks.

Basal Medium 3

Reagent	Amount (final concentration)	Comments
MCDB131	500 mL	Base medium
GlutaMax	5 mL (2 mM)	L-glutamine supplement
Sodium bicarbonate	750 mg (1.5 g/L)	Buffer
Glucose	889 μL (10 mM)	Includes base medium glucose content
Fatty acid-free BSA	10 mg (2%)	Medium supplement
ITS-X	2.5 mL (0.5%)	Insulin-Transferrin-Selenium Ethanolamine: medium supplement
Heparin	500 μL (10 μg/mL)	Medium supplement
Zinc Sulfate	500 μL (10 μM)	Medium supplement
Penicillin/Streptomycin	5 mL (1x)	Antibiotics
Total	514 mL

Note: Sterilize by filtering using a 0.22 μm filter; store at 4°C, protected from light, for up to 3 weeks.

Stage 3 Supplement

Molecule	Final concentration	Stock volume
α-Amyloid precursor protein modulator	500 μM	80 μL
LDN-193189	250 μM	100 μL
Retinoic acid	2.5 mM	100 μL
SANT-1	625 μM	100 μL
DMSO	N/A	20 μL
Total	N/A	400 μL

Note: Do not filter; store at −20°C, protected from light, for up to 6 months.

Stage 4 Supplement

Molecule	Final concentration	Stock volume
LDN-193189	500 μM	200 μL
Retinoic acid	250 μM	10 μL
SANT-1	625 μM	100 μL
DMSO	N/A	90 μL
Total	N/A	400 μL

Note: Do not filter; store at −20°C, protected from light, for up to 6 months.

Stage 5 Supplement

Molecule	Final concentration	Stock volume
ALK5 Inhibitor	15 mM	200 μL
GC-1	1.5 mM	100 μL
GSiXX	150 μM	100 μL
LDN-193189	150 μM	100 μL
Retinoic acid	75 μM	5 μL
SANT-1	375 μM	100 μL
DMSO	N/A	61.7 μL
Total	N/A	666.7 μL

Note: Do not filter; store at −20°C, protected from light, for up to 6 months.

Stage 6 Supplement

Molecule	Final concentration	Stock volume
ALK5 Inhibitor	20 mM	200 μL
GC-1	2 mM	100 μL
GSiXX	200 μM	100 μL
LDN-193189	200 μM	100 μL
Total	N/A	500 μL

Note: Do not filter; store at −20°C, protected from light, for up to 6 months.

Citric acid stock solution

Molecule	Final concentration	Amount
Monohydrate citric acid	0.1 M	10.5 g
ddH2O	N/A	Up to 500 mL
Total	N/A	500 mL

Note: Store at 4°C for up to 3 weeks.

Sodium citrate stock solution

Molecule	Final concentration	Amount
Sodium citrate dihydrate	0.1 M	14.7 g
ddH2O	N/A	Up to 500 mL
Total	N/A	500 mL

Note: Store at 4°C for up to 3 weeks.

Citrate buffer solution (0.1 M) for Streptozotocin injection

Solution	Final concentration	Stock volume
Citric acid stock solution	47 mM	23.5 mL
Sodium citrate stock solution	53 mM	26.5 mL
Total	N/A	50 mL

Note: Prepare immediately before use, adjust the pH to 4.5, and sterilize by filtering using a 0.22 μm filter.

Step-by-step method details

The gene editing protocol begins with the design of guide RNAs (gRNAs) and primers for PCRs, along with the antibody screening. H1 human embryonic stem cells are then electroporated with Cas12a protein and gRNAs targeting the gene of interest. Post-electroporation, efficiency is verified using PCR, and single-cell clones are selected, expanded, and genotyped to confirm the presence of gene knockout. Validated clones are subsequently frozen and comprehensive quality control assessments are conducted. This initial phase spans approximately 11 week.

Following screening, the selected clones are differentiated into insulin-expressing β-like cells through a seven-stage in vitro protocol over 35 days. Each stage mirrors a specific developmental phase of the pancreatic endocrine lineage. This protocol is rigorously applied in parallel for both wild-type and knockout genotypes to minimize experimental variability. Before differentiation, stem cell cultures are expanded uniformly and seeded synchronously. Daily medium changes and timely passage to cell aggregates are performed to maintain consistency. The differentiation process involves the induction of definitive endoderm, the formation of pancreatic progenitors, and the generation of endocrine progenitors, culminating in the formation of spheroids enriched with maturing β-like cells. Upon completion of differentiation, the insulin-positive cell population and genotype-specific differences are analyzed.

Post-differentiation, stage 7 pancreatic islet-like spheroids (PTPRF^+/+ or PTPRF^−/−) are implanted under the kidney capsule of NOD/SCID mice to facilitate in vivo functional maturation over a 16-week period. Throughout this maturation phase, multiple quality control measures are implemented to verify that the β-like cells can secrete insulin in response to glucose stimulation. Following these assessments, the mice are treated with streptozotocin (STZ), a β-cell toxin, to induce diabetes. The maturity and functionality of the human β-like cells are confirmed if stem cell-derived pancreatic islet-like spheroids prevent the onset of STZ-induced diabetes. The entire process extends over approximately 20 weeks. Functional assessments of the grafts include metabolic tests such as glucose-stimulated insulin secretion and glucose tolerance tests to evaluate the therapeutic efficacy of the differentiated β-like cells.

gRNAs design

Timing: 1–2 days

Successful design of effective gRNAs is crucial to enable Cas12a to bind to the genomic locus of the targeted genes. The first goal is to select a range of candidate exons that, upon deletion, result in a truncation of the protein’s functional domain. Second, a pair of gRNAs for Cas 12a flanking the candidate exons are selected based on high efficiency and specificity for recognition of the predicted sequence. Several available gRNA designing tools can be used to select the best guides such as CRISPOR, CHOPCHOP, and Benchling.^19,26 Refer to the key resources table for the full list of software used.

• 1.Identify the genomic DNA sequence and messenger RNA sequence for the gene of interest in a human genome browser, such as the Ensembl.²⁷
• 2.Obtain the protein structure and domains to identify the functional units of the protein using resources like the UniProt²⁸ and SMART.²⁹
• 3.Ensure that the protein is expressed in the target cell line for optimal clone selection.
• 4.
  Select potential exons to be deleted following the next sequential requirements.³⁰

  • a.
    The exon must encode a predicted functional domain in silico.

    CRITICAL: This guarantees the loss of function of the protein. For this protocol, the phosphatase catalytic domain (PTPc) exons were targeted; for PTPRF exons 23–34; and for PTPRK exons 16–30 are identified.

  • b.
    The exon must be conserved across the annotated protein-coding transcripts.

    CRITICAL: This ensures that all protein isoforms are targeted. For this protocol, PTPRF exons 23–34; and for PTPRK exons 16–21 were identified.

  • c.
    The exon must not contain annotated regulatory domains or evolutionarily conserved domains in the surrounding sequence.

    CRITICAL: This allows the specific targeting of the gene of interest without disrupting other genes. For this protocol, PTPRF exons 23–33; and PTPRK exons 19 and 20 were identified.

  • d.
    The number of base pairs in the exon must not be divisible by three.

    CRITICAL: This causes a transcriptional frameshift that produces a premature termination codon (PTC) in the downstream exon(s). For this protocol, PTPRF exons 23–25, 27–30, 32, and 33; and PTPRK exons 19 and 20 were chosen.

    Alternatives: To knockout a full gene, target one of the upstream exons shared between the different conserved transcripts.

• 5.
  Design a pair of gRNAs for Cas12a in the flanking introns of the selected potential exons with the following parameters.

  • a.
    Choose the most updated reference genome: GRCh38.
  • b.
    Choose the protospacer adjacent motif (PAM) sequence for Cas12a: TTTV (V = A, C, or G) grants higher specificity than TTTT.
  • c.
    Select 23 base pairs for the guide length.

    Note:Integrated DNA Technologies (IDT) recommends 21 base pairs for optimal activity, but we choose a longer guide to prioritize specificity over activity to avoid off-targets.

  • d.
    Select a pair that matches the following criteria.

    • i.
      Target the same strand.
    • ii.
      Have a high predicted efficiency to determine if the guide can be used to cut effectively.
    • iii.
      Have a high off-target score, avoiding guides with more than three mismatches in off-targets.

      Note: If mismatches cannot be prevented, avoid those located in exons that could knock out other proteins. Prioritize guides with fewer mismatches over the number of off-targets.

    • iv.
      Target the most upstream transcribed exon so that a larger part of the functional domain will be truncated.

      CRITICAL: The selected guides matching these criteria target exon 23 of PTPRF and exon 20 of PTPRK. Two gRNAs are designed for each gene: PTPRF 5’->3’: TCTGCCACACTGCTCAAGCCTCA and AGGAGCACAGAGAGGAGGGTTGG; and PTPRK 3’->5’: GCTAAGATAAGAAGCAGAGTAAA and AGCCAGTCAAGGTCTACTTAGAA (See Figures 1A and 1B; Table S1).

      Alternatives: A different approach is to use only a single gRNA to create the knockout. A gRNA must target the exon and have a high out-of-frame score to generate INDELs. This will likely produce a gene knockout caused by a frameshift mutation that will produce a PTC.

Figure 1.

CRISPR-Cas12a-mediated knockout and screening strategy for generating PTPRF^+/+, PTPRF^−/−, PTPRK^+/+, and PTPRK^−/− human H1-ES cell lines

(A and B) Schematics of protein structure along with CRISPR-Cas12a-mediated knockout strategy in H1-hESCs: (A), PTPRF. (B), PTPRK.

(C) Agarose gel showing optimization of different electroporation parameters for maximizing knockout efficiency for PTPRF: Clones Mix Electroporation Conditions: (1) 1,000 V, 20 ms, 3 pulses, CloneR, (2) 1,000 V, 20 ms, 3 pulses, CloneR2, (3) 1,400 V, 20 ms, 1 pulse, CloneR, (4) 1,400 V, 20 ms, 1 pulse, CloneR2, (5) 1,200 V, 30 ms, 1 pulse, CloneR, (6) 1,200 V, 30 ms, 1 pulse, CloneR2, NC: H1-hESCs (non-electroporated).

(D) Representative bright-field images of single-cell clone selection after Day 2 and Day 11 post-electroporation seeding for limiting dilution. Visible colonies marked in green are picked up after 11 days (Scale bar = 100 μm).

(E–H) Generation of PTPRF^+/+, PTPRF^−/−, PTPRK^+/+, and PTPRK^−/− human H1-ES cell lines. PCR analysis of genomic DNA from the selected ES cell clones (E). Original gel picture indicating the wild type (PTPRF^+/+, PTPRK^+/+), heterozygous (PTPRF^+/−, PTPRK^+/−) and homozygous full knock-out (PTPRF^−/−, PTPRK^−/−) clones. Confirmation of the deleted region by Sanger sequencing in selected PTPRF and PTPRK clones from the PCR analysis (F). Representative qRT-PCR demonstrates the absence of RNA in the selected PTPRF and PTPRK clones, n = 4; Mean ± SEM (G). Representative protein immunoblot demonstrates the absence of protein in the selected PTPRF and PTPRK clones (H). Statistical significance is denoted as ∗∗∗p<0.001.

(I) Characteristic morphology of H1 hESCs grown on Matrigel. The top images show perfect round stem cell colonies with tightly packed hESCs featuring well-defined sharp edges at 4× magnification (left pictures), and 10× magnification (right pictures). Note the individual cells within the colonies exhibiting prominent nucleoli and a high nucleus-to-cytoplasm volume ratio, particularly evident in the higher magnification (10X) image. The bottom images show the sub-optimal spontaneously differentiating colonies at 4× and 10× magnification. The black circled regions with white arrows indicate spontaneously differentiated colonies (Scale bar = 100 μm).

Primer design

Timing: 1–2 days

Following gRNAs selection, three sets of primers are designed for further characterization of edited clones. Primers for genomic PCR-based screening are used as the first approach to determine the transfection efficiency of the clone mix and to differentiate between the three different single-cell clones (wild-type, heterozygous, or knockout). Primers for sequencing are used to verify the location of the cut in the deleted allele(s) and to ensure that the wild-type alleles have not been edited. Primers for qPCR are used to confirm the absence of gene expression at mRNA level.

Note: Design primers for genomic PCR based on the reference sequence of the selected exon and flanking regions using Primer3³¹ or Primer-BLAST.²³ Ensure the lowest maximum self-complementarity and lowest maximum pair complementarity to avoid the formation of primer dimers.

• 6.Design a primer pair (forward and reverse) flanking the deleted region with a minimum distance of 200 base pairs from the predicted cut region and a preferred maximum product length of 1,000 base pairs (See Table S1 for genomic PCR primers).
• 7.Design a primer pair (forward and reverse) inside the deleted region (See Table S1 for genomic PCR primers).

Note: Primers binding inside the deleted region should preferably bind to the Cas12a cutting site, to discard wild-type clones with INDELs produced by Cas12a cutting and DNA reassembly (See Figures 1A and 1B).

Note: It is recommended to design at least two sets of each primer pair for genomic PCR. The primers should be validated, and the best pair selected before Cas12a gene editing. Effective genomic PCR primer pairs will facilitate the verification of editing efficiency and single-cell clone screening by PCR.

• 8.Design primers for sequencing using the PCR product from the previous Step 6 as a template. Select one primer upstream of the 5′ cut and another downstream of the 3′ cut.

CRITICAL: Primers should be at least 50 base pairs away from the predicted cut sites to obtain clear results at the cut sites during Sanger sequencing. (See Table S1 for sequencing primers).

• 9.
  Design primer pairs for qPCR using Primer-BLAST. One primer must bind to the selected exon to verify gene editing, and the other primer should bind to a neighboring exon.

  Note: Primers spanning exon junctions are recommended for optimal cDNA amplification. Prioritize primers with the lowest maximum self-complementarity and lowest maximum pair complementarity.

  • a.
    Design standard primers to generate the standard curve for absolute qPCR quantification (see Table S1 for standard primers).

    Note: The recommended PCR product size is between 250 and 500 base pairs.

  • b.
    Design qPCR primer pairs to measure the mRNA expression of the targeted genes (see Table S1 for qPCR primers).

    CRITICAL: These primers should be located inside the region of the standard primers. The recommended PCR product size is between 70 and 200 base pairs.

Antibody validation of the targeted protein

Timing: 2–3 days

The absence of the protein in the generated knockout clones is validated by western blotting and immunofluorescence. A specific antibody for immunofluorescence is critical for selecting only single-cell clones. After clone selection, occasionally a marginal proportion of cells from other clone(s) might exist in presumed single-cell clones. Additionally, presumed heterozygous single-cell clones can be a mixture of wild-type, heterozygous, and knockout cells in varying proportions.

• 10.Search for specific antibodies that bind to the target protein and are suitable for both western blotting and immunofluorescence analysis.

Note: Preferably choose those that specifically bind to an epitope located in the deleted region or downstream of the deleted region.

• 11.Verify the specificity of the antibodies using western blotting and immunofluorescence.

Note: It is recommended that the specificity of the antibodies is validated before gene editing. Performing a knockdown of the desired protein in human stem cells can be suitable for antibody validation.

Transfection of Cas12a and gRNA by electroporation

Timing: 4 days

To achieve high transfection efficiency and cell viability during gene editing, H1 stem cells are electroporated using the Neon transfection system. Electroporation allows the two Cas12a/gRNA ribonucleoprotein (RNP) complexes to enter the cell. These complexes recognize CRISPR sequences and produce desired cuts that result in the excision of the targeted DNA region. After excision, microhomology-mediated end-joining (MMEJ) reassembles the genomic DNA, resulting in a knockout gene without INDELs at the cut site.

• 12.Day −3: Precoat two 3.5-cm dishes, six wells of a 48-well plate, and three 10-cm dishes with Matrigel hESC-Qualified Matrix using 150–200 μL per cm² of culture vessel.

Note: To improve cell attachment and survival, the Matrigel (hESC-Qualified) Matrix is used instead of standard Matrigel during the electroporation and limiting dilution steps. The dilution factor for reconstitution of the Matrigel Matrix is lot-dependent; therefore, the correct dilution must be ensured according to the manufacturer’s guidelines.

• 13.Split the H1 cells into two 3.5-cm dishes, using mTeSR Plus medium.
• 14.Day −2 & −1: Replace the medium with 1.5 mL of fresh mTeSR Plus.
• 15.
  Day 0: Once the cells have reached 80% confluence, prepare all the necessary material for electroporation.

  • a.
    4 h before electroporation, add 1.5 mL of fresh mTeSR Plus with 1:10 CloneR to the cells.
  • b.
    Pre-warm DPBS, 0.5 mM EDTA, Accutase, mTeSR Plus, and R and E buffers from the electroporation kit to 20°C–25°C for 1 h.
  • c.
    Add 500 μL of mTeSR Plus with 1:10 of CloneR to six wells of the 48-well plate. Place the plate in a 37°C humidified incubator with 5% CO₂ concentration for 30 min.
  • d.
    Dilute the gRNAs in TE buffer to a final concentration of 100 mM and store at 4°C until use; do this for both gRNAs.

    Note: For longer storage, store at −20°C for up to 1 year, and limit freeze-thaw cycles.

  • e.
    Prepare Cas12a Electroporation enhancer with a final concentration of 100 mM and store at 4°C.

    • i.
      Prepare 10.8 mM Electroporation enhancer working solution adding 0.54 μL of 100 mM Electroporation enhancer solution into 4.46 μL of TE buffer in a 500 μL tube.

      Note: For the electroporation and limiting dilution steps, we recommend using CloneR instead of the ROCK inhibitor used in the other steps. During electroporation optimization, we found that this improved cell attachment and survival, resulting in better cell recovery and a higher proportion of knockout cells.

• 16.
  Prepare the Cas12a/gRNA RNP complex with the Electroporation enhancer working solution.

  • a.
    Mix 0.6 μL of Cas12a and 0.5 μL of gRNA in a 500 μL tube.
  • b.
    Prepare one tube for each gRNA, mix, and swirl.
  • c.
    Incubate at 20°C–25°C for 15–20 min to allow the formation of the Cas12a/gRNA RNP complex.
  • d.
    After the incubation, add the first Cas12a/gRNA RNP complex to the second Cas12a/gRNA RNP complex.
  • e.
    Add 1 μL of 10.8 mM Electroporation enhancer working solution and mix gently.

Note: During the incubation, proceed to the next step (17).

• 17.
  Prepare the cells for electroporation.

  • a.
    Wash each dish with 2 mL of 0.5 mM EDTA.
  • b.
    Add 1 mL of Accutase.
  • c.
    Incubate at 37°C for 4–5 min.
  • d.
    Neutralize Accutase by adding 1 mL of mTeSR Plus with 1:10 CloneR.
  • e.
    Detach the cells using a cell scraper.
  • f.
    Dissociate into single cells with gentle pipetting using a 1 mL micropipette.
  • g.
    Transfer the cell suspension to a 15 mL tube.
  • h.
    Centrifuge at 250 × g for 3 min.
  • i.
    Remove the supernatant and add 1 mL of DPBS containing calcium and magnesium.
  • j.
    Resuspend the cells with a 1 mL micropipette.
  • k.
    Pass the cells through a 40 μm strainer.
  • l.
    Count the cells and verify their viability.

    Note: For effective electroporation, we recommend a cell viability above 95%.

  • m.
    After counting, transfer 1 million viable cells to a new 1.5 mL tube.
  • n.
    Centrifuge at 250 × g for 3 min.
  • o.
    Gently remove the maximum amount of supernatant without disturbing the cell pellet.
  • p.
    Resuspend the cell pellet in 60 μL of R buffer (1 million cells/60 μL).
• 18.
  Electroporation.

  • a.
    Add the cell suspension to the Cas12a/gRNA+Electroporator enhancer solution (Step 16.d), gently mix, and resuspend.
  • b.
    Place 3 mL of E buffer into the Neon tube and load it into the electroporation device.
  • c.
    Attach the 10 μL Neon pipette tip to the Neon pipette, according to the manufacturer’s instructions.
  • d.
    Pipette 10 μL of the cell solution.
  • e.
    Place the pipette into the Neon tube.
  • f.
    Electroporate the cells under the following conditions:

    • i.
      1,400 V, 20 ms, and 1 pulse.
    • ii.
      1,200 V, 30 ms, and 1 pulse.
    • iii.
      1,000 V, 20 ms, and 3 pulses.
  • g.
    Immediately after electroporation, add the 10 μL from the Neon pipette into a well of the 48-well plate, adding the cell suspension drop by drop around the well to distribute the cells evenly.
  • h.
    Place the plate in a humidified incubator at 37°C with 5% CO₂ concentration.

Note: Depending on the gRNAs, different electroporation conditions may result in higher transfection efficiency and cell survival. One electroporation mix can be used to electroporate for six different times to select the best conditions. Therefore, it is recommended to seed an extra well per condition to check the editing efficiency of the different electroporation conditions (See Figure 1C).

Note: For non-specialist readers, we recommend viewing the detailed descriptive videos on the Thermo Fisher Scientific website for guidance on the use and optimization of the Neon electroporation system³².

Verify gene editing efficiency and single-cell isolation

Timing: 3–4 days

Next, editing efficiency needs to be validated by PCR and agarose gels, expecting more than 30% intensity of the knockout band compared with the total amplified DNA (see Figure 1C). After confirming efficient gene editing, we perform limiting dilution seeding of single cells to obtain single-cell clones. The time interval for this step can vary depending on cell recovery after electroporation.

Note: If editing efficiency is below 30%, the number of clones to screen would be large, laborious, and time-consuming. In this case, it is recommended to optimize the electroporation conditions.

• 19.The day after electroporation wash the wells once with pre-warmed DPBS and add 500 μL of mTeSR Plus with 1:10 CloneR.
• 20.Change the medium every day with 500 μL of fresh pre-warmed mTeSR Plus without CloneR.

Note: Wash with pre-warmed DPBS if there is significant cell death.

• 21.
  If extra wells are seeded: two days after electroporation, extract the genomic DNA (gDNA) and check the genomic editing efficiency by PCR:

  • a.
    Wash twice with DPBS.
  • b.
    Add 10 μL of gDNA lysis buffer.
  • c.
    Scrape the well using a pipette tip and transfer the supernatant to a 500 μL tube.
  • d.
    Wash the well with 10 μL of gDNA lysis buffer and transfer it to the same tube.
  • e.
    Resuspend thoroughly by pipetting.
  • f.
    Centrifuge at 500 × g for 15 s.
• 22.
  Proceed to gDNA extraction.

  • a.
    Place the tube with the cell lysates in a thermo-block at 37°C, shaking at 500 rpm for 1 h.
  • b.
    Inactivate the enzyme at 80°C for 30 min.
  • c.
    Centrifuge at 5,000 × g for 10 min at 4°C.
  • d.
    Transfer the supernatant to a new tube without disturbing the cell pellet.
  • e.
    Check the gDNA concentration using a Nanodrop spectrophotometer.
  • f.
    Adjust the concentration to 100 ng/μL with RNase-free H₂O, if possible.
• 23.Run PCR and agarose gel electrophoresis to determine editing efficiency.

PCR reaction master mix

Reagent	Amount (1x)
DNA template	1 μL
MyTaq Red DNA Polymerase	0.2 μL
10 μM genomic outside forward primer	0.3 μL
10 μM genomic outside reverse primer	0.3 μL
5× MyTaq buffer	2 μL
ddH2O	6.2 μL

Touchdown PCR cycling conditions

Steps	Temperature	Time	Cycles
Initial Denaturation	95°C	3 min	1
Denaturation	95°C	15 s	35
Annealing	64°C (−0,1°C/cycle)	15 s
Extension	72°C	15 s
Final extension	72°C	2 min 30 s	1
Hold	8°C	∞

• 24.Allow the cells to reach 70–80% confluence, generally 3–4 days after electroporation.
• 25.
  Split the cells for the limiting dilution passage.

  Note: It is recommended to use three 10-cm dishes, using the best electroporation condition(s).

  • a.
    Add 9 mL of mTeSR Plus with 1:10 CloneR to 10-cm dishes and equilibrate in an incubator.
  • b.
    Wash the cells in a 48-well plate with 500 μL of 0.5 mM EDTA.
  • c.
    Add 500 μL of Accutase to each well.
  • d.
    Incubate at 37°C for 4–5 min.
  • e.
    Neutralize Accutase with 500 μL of mTeSR Plus with 1:10 CloneR.
  • f.
    With a 1 mL micropipette, gently detach the cells and dissociate them into single cells.
  • g.
    Place the cells in a 1.5 mL tube.
  • h.
    Centrifuge at 250 × g for 3 min.
  • i.
    Aspirate the supernatant without disturbing the cell pellet.
  • j.
    Resuspend the cell pellet in 1 mL of mTeSR Plus with 1:10 CloneR.
  • k.
    Pass the cells through a 40 μm strainer.
  • l.
    Count cells and measure cell viability.
  • m.
    Seed 2,000 live cells per 10-cm dish.

    CRITICAL: While seeding the cells, dilute the cell suspension to add at least 200 μL drop-by-drop across the 10-cm dish.

  • n.
    Incubate in a humidified incubator at 37°C with 5% CO₂ concentration.

    CRITICAL: Redistribute the cells by rocking the dish back and forth and then left to right once it is in the incubator. Proper dissociation and distribution are necessary to obtain isolated single-cell colonies.

    Note: The remaining cells can be collected to perform gDNA extraction (Step 22) and check the genome editing efficiency if no extra wells were seeded.

    Alternatives: Single-cell clone isolation can be performed using fluorescent-assisted cell sorting (FACS) or automated systems.

Single-cell clone selection

Timing: 1 week

After limiting dilution seeding, single-cell clones are selected and expanded to validate clones for wild-type, heterozygous, and knockout genotypes. Here single-cell clones are marked and manually sorted in 96-well plates.

• 26.Replace 5 mL of the medium every day in the 10-cm dishes with 5 mL of fresh mTeSR Plus.
• 27.1–2 days after seeding: Mark the visible single-cell colonies. Select small, rounded, compact, and isolated colonies (See Figure 1D).
• 28.Allow the cells to grow until the marked colonies are approximately 2 mm², generally for 5–11 days. Select the small, rounded colonies (See Figure 1D).
• 29.Add 250 μL of mTeSR Plus per well to 96-well plates and place the plates in an incubator.

Note: It is recommended to alternate between 10-cm dishes and use several 96-well plates to minimize the time the cells are outside the incubator. This will facilitate colony attachment, ensure sufficient cell distribution and survival, and reduce the risk of contamination during manipulation. Picking 100 single-cell colonies should be sufficient to obtain viable gene-edited clones.

• 30.Pick the colonies under sterile conditions using a microscope in the laminar flow hood; with a 200 μL micropipette, scratch and pick the marked colonies using the minimum volume possible.
• 31.Transfer the colonies to the pre-warmed 96-well plates and gently resuspend 5–6 times with the 200 μL micropipette to ensure colony dissociation.
• 32.Incubate in a humidified incubator at 37°C with 5% CO₂ concentration.

Single-cell clone expansion

Timing: 2 weeks

Once the clones reach confluence, they are expanded to 24-well plates and then to 3.5-cm dishes. Clones can reach confluence at varying rates, which can prolong the expansion steps. At the first passage, cells that do not detach during splitting are lysed, and the genotype is confirmed by PCR. Once the genotype is confirmed, RNA and protein can be collected for qPCR and western blotting, respectively, in subsequent passages.

• 33.Replace the medium with 300 μL of mTeSR Plus every day until the clones are ready for passage, usually 5–6 days after seeding. The clones are ready when they have reached 80% confluence, large colonies have formed, or cells have grown on top of the colonies.

Note: Cells should be monitored daily using a microscope to check for contamination and spontaneous differentiation. If cells show more than 25% spontaneous differentiation, they should be passaged using EZ-LiFT. Please refer to the troubleshooting section.

• 34.
  On the day of passage, split the cells from the 96-well plates to the 24-well plates.

  • a.
    Add 400 μL of mTeSR Plus per well to 24-well plates and place them in an incubator for 30 min.
  • b.
    Wash the cells with 300 μL of 0.5 mM EDTA. Wash for an additional time if there is significant cell death.
  • c.
    Incubate with 300 μL of 0.5 mM EDTA for 3–4 min at 20°C–25°C.
  • d.
    Remove the EDTA and add 100 μL of mTeSR Plus.
  • e.
    Gently detach the cells by resuspension 7–8 times.
  • f.
    Add the 100 μL of cell suspension to the new 24-well plate, dropwise around the wells to redistribute the colonies.
  • g.
    Place the 24-well plates in a humidified incubator at 37°C with 5% CO₂ concentration.
• 35.
  Use cells that are not detached during splitting in the 96-well plate to perform genomic DNA extraction:

  • a.
    Add 200 μL of DPBS to the wells from the passaged cells in the 96-well plates.
  • b.
    Scrape thoroughly with a micropipette tip.
  • c.
    Collect the cell suspension and transfer it to labeled 1.5 mL tubes.
  • d.
    Centrifuge at 500 × g for 5 min.
  • e.
    Remove the supernatant and store the pellet at −20°C or add directly 20 μL of gDNA lysis buffer and follow the gDNA extraction protocol (Step 22).
• 36.Replace the medium of the 24-well plates with 500 μL per well of fresh mTeSR Plus every day until the clones are 80% confluent or have large colony formation, approximately 4–5 days after seeding.
• 37.Check the clones in the 24-well plate using a microscope for confluence, degree of differentiation, or any contamination.
• 38.
  Once the clones reach 80% confluence, split the cells from a 24-well plate into a 3.5-cm dish and prepare a 24-well plate for protein extraction.

  • a.
    Prepare one 3.5-cm dish with 1 mL of mTeSR Plus and a well of a 24-well plate with 400 μL of mTeSR Plus per clone and pre-warm for 30 min in an incubator.
  • b.
    Label one 1.5 mL tube for each clone to be passaged for RNA extraction.
  • c.
    Wash the cells with 800 μL of 0.5 mM EDTA.
  • d.
    Incubate the cells with 500 μL of 0.5 mM EDTA for 3–4 min.
  • e.
    Remove the EDTA and add 500 μL of mTeSR Plus.
  • f.
    Gently detach the cells by pipetting up and down 6–7 times.
  • g.
    Add 400 μL of the cell suspension to the 3.5-cm dish, dropwise around the well to redistribute the colonies well.
  • h.
    Add the remaining 100 μL to the 24-well plate.
  • i.
    Incubate in a humidified incubator at 37°C with 5% CO₂ concentration.
• 39.
  From cells that did not detach in the original 24-well plate, perform RNA extraction to check mRNA expression of the target gene and pluripotency markers.

  • a.
    Wash the wells from the 24-well plate with 500 μL of cold DPBS.
  • b.
    Add 100 μL of RNA lysis/binding buffer.
  • c.
    Scrape with a micropipette tip to collect the cells and transfer the suspension to a 1.5 mL tube.
  • d.
    Wash the well with 50 μL of RNA lysis/binding buffer and add it to the 1.5 mL tube, vortex for 15 s.
  • e.
    Immediately after collection, put the tube on ice and store at −80°C.

Note: If previous gDNA extraction was not successful (Step 35, i.e., low DNA concentration), collect cells for genotype confirmation with PCR before proceeding with RNA extraction.

• 40.Replace the medium with fresh mTeSR Plus every day, 1.5 mL for 3.5-cm dishes and 500 μL for 24-well plates. When the clones reach 80% confluence, typically 4–5 days after seeding, are ready to be frozen, split, or used for protein extraction.

Freezing clones and protein extraction

Timing: 30 min per clone

At the end of the expansion, the clones are frozen and the last pellet for western blotting is collected. Once all the clones have been frozen, quality controls can be performed.

• 41.Freeze the cells following the freezing guidelines.
• 42.
  Collect cells from the 24-well plates for protein extraction.

  • a.
    Wash the wells with 500 μL of cold DPBS.
  • b.
    Add 70 μL of protein lysis buffer, scrape the cells with the pipette tip, and transfer the supernatant to a 1.5 mL tube.
  • c.
    Repeat the previous step (b) with 30 μL of protein lysis buffer.
  • d.
    Store the lysate at −20°C until processing.

Note: If the previous pellet (Step 39) was used for gDNA instead of qPCR, the cells in the plate can be collected in DPBS and divided into two 1.5 mL tubes. After centrifugation, the cell pellet can be stored at −80°C for RNA extraction for qPCR or at −20°C for protein extraction for western blotting.

Pause Point: Clones can remain frozen in liquid nitrogen until genotyping, mRNA profiling, and western blotting are completed for all clones. Proceed with further quality controls once at least three clones exhibit consistent expression of the desired characteristics (matching WT, Heterozygous, or Homozygous knockout results for DNA, mRNA, and protein analyses).

Quality controls of the selected clones

Timing: variable

To verify the generated clones, several quality controls are performed. The genotype is assessed by genomic PCR, Sanger sequencing, RT-qPCR, and western blotting. Furthermore, the quality of the clones is confirmed by immunofluorescence assays, karyotyping, and embryoid body formation.

• 43.Perform a PCR on the samples collected at Step 35 to assess the genotype of the clones following the provided instructions (Step 23) (See Figure 1E).

Note: Differences in band size observed in the agarose gel of the genomic PCR product can help predict deletions and INDELs at the cut site, aiding in the identification of the first set of suitable clones.

• 44.
  Prepare samples for Sanger sequencing using the PCR product from Step 43 and the sequencing primer(s) (See key resources table).

  • a.
    Purify the PCR product with a PCR clean-up kit.
  • b.
    Follow the sequencing service requirements for the sample preparation (See Figure 1F).

Note: The DNA sequence must be checked to exclude wild-type clones with alleles that have INDELs and ensure that the targeted alleles are deleted in the knockout clones.

• 45.Transcribe the mRNA collected in (Step 39) to cDNA using the manufacturer’s instructions.
• 46.Perform a RT-qPCR using the qPCR primers (See key resources table) (See Figure 1G).

Note: RT-qPCR is performed to verify that the edited clones resulted in mRNA deficiency of the targeted gene.

• 47.Perform western blotting using the pellet collected in (Step 42) (See Figure 1H).

Note: Western blotting is performed to verify that the edited clones resulted in protein deficiency of the targeted gene.

Thawing test of the clones

Timing: 3–4 days

After thawing and seeding, the attachment capacity and viability of the clones are verified by the number of attached colonies and the presence of floating dead cells.

Note: Additional quality controls include assessing the morphological structure of the cells, identifying any spontaneously differentiated cells, and evaluating the shape and growth of the colonies (Figure 1I). These parameters are crucial for detecting changes in the cellular structure, pluripotency status, and proliferation rate.

CRITICAL: Clones should maintain similar characteristics to the original H1 ES cell line. This is particularly true for wild-type clones in which the targeted gene is not edited. Similarly, it is not expected that the PTPRF and PTPRK knockout clones influence these parameters.

• 48.Thaw one cryovial of the selected clones following the thawing guidelines.
• 49.Replace the medium every day with 1.5 mL of fresh mTeSR Plus until the cells reach 80% confluence.

Note: Check daily for effective cell recovery. The cells should exhibit a normal growth rate and no differentiation. Depending on the initial cell density upon freezing, the cells should achieve 60–100% confluence (with an ideal target of 80%) after 3 days of seeding.

• 50.Split the cells following the splitting guidelines, using a cell scraper to detach all the cells.
• 51.
  Seed the cells into the following 3.5-cm dishes.

  • a.
    One 3.5-cm dish for seeding into an 8-well culture slide to check for pluripotency markers and expression of the protein of interest by immunofluorescence staining.
  • b.
    Two 3.5-cm dishes for karyotyping.
  • c.
    One 3.5-cm dish for embryoid body formation.
  • d.
    Nine 3.5-cm dishes for freezing and creating a stock.

CRITICAL: A Mycoplasma test is performed before freezing to exclude any contaminated clones.

• 52.Place the dishes in a humidified incubator at 37°C with 5% CO₂ concentration.
• 53.Replace the medium every day with 1.5 mL of fresh mTeSR Plus.

Immunofluorescence staining

Timing: 3–4 days

To verify that the clones are single cells with the correct genotype, immunofluorescence staining is performed. Additionally, pluripotency markers are verified by immunofluorescence as all clones must maintain their pluripotent state throughout the gene editing process.

Note: Immunofluorescence staining targeting the deleted protein should indicate the expression of the targeted protein in wild-type clones, no expression in knockout clones, and reduced expression in heterozygous clones.

CRITICAL: Clones must exhibit uniform expression of the targeted protein because a combination of different genotypes can be misinterpreted as single-cell clones.

• 54.Once the cells reach 80% confluence, prepare an 8-well culture slide with 250 μL of mTeSR Plus per well and pre-warm in a 37°C incubator.
• 55.
  Follow the splitting guidelines.

  • a.
    Seed 100 μL of the cells resuspended in mTeSR Plus into each well of the 8-well culture slide.
  • b.
    Place the slide in a humidified incubator at 37°C with 5% CO₂ concentration.
• 56.Cultivate the cells for 1 or 2 days until there are separated colonies of 100–400 cells (200–500 μm²).
• 57.Fix the cells with 4% paraformaldehyde.
• 58.Perform immunofluorescence of the protein of interest (PTPRF or PTPRK) and pluripotency markers (OCT4A, NANOG, TRA1-60, and SSEA4). See Figures 2A and 2B.

Note: The slides can be stored at 4°C after fixation, adding 400 μL of DPBS to the wells.

Figure 2.

Characterization of PTPRF^+/+, PTPRF^−/−, PTPRK^+/+, and PTPRK^−/− human H1 embryonic stem cell lines

(A) Representative immunofluorescence images showing the immunostaining for the P-domain of PTPRF and PTPRK comprising a catalytically active D1 domain and a pseudophosphatase D2 domain (Scale bar = 50 μm).

(B) Representative immunofluorescence images for pluripotency markers OCT4, NANOG, TRA1-60, and SSEA4 for PTPRF and PTPRK clones. Nuclei are visualized with DAPI (Scale bar = 50 μm).

(C) Representative images of normal 46XY karyotype visualized with G-banding for the PTPRF and PTPRK clones.

(D) Representative immunofluorescence images of embryoid bodies for PTPRF and PTPRK clones. SOX17 is used as an endoderm marker, β-III-tubulin as a marker of ectoderm, and Vimentin as a marker of mesoderm. Nuclei are visualized with DAPI (Scale bar = 50 μm).

Preparation of cells for karyotyping

Timing: 1 day

Chromosomal abnormalities, such as aneuploidy and structural abnormalities, are common after gene editing. These can occur due to the double-strand cuts produced by the gene editing machinery and the stress conditions that the stem cells undergo.

Note: Successful clones must have unaltered chromosomal integrity to ensure that the quality of the chromosomes is not compromised. Identifying and excluding clones with aberrant chromosomal profiles is essential to ensure the reliability of gene-edited clones.

• 59.When the cells seeded in Step 51.b reach 80% confluence, wash the dishes once with 1.5 mL of DPBS.
• 60.Add 1.5 mL of mTeSR Plus medium with 15 μL of Colcemid (final concentration 0.1 μg/mL) per 3.5-cm dish.

Note: It is recommended to prepare two dishes and select the dish with better cell morphology and less cell detachment for subsequent steps.

• 61.Incubate at 37°C for 3 h in a humidified incubator.
• 62.Remove the medium containing Colcemid.
• 63.
  Add 1.5 mL of DPBS carefully to avoid detaching any cells and collect the cells.

  • a.
    Transfer the DPBS to a 15 mL tube containing 5 mL of DMEM/F-12.
  • b.
    Add 1 mL of Accutase per dish.
  • c.
    Incubate at 37°C for 4–5 min.
  • d.
    Add 1 mL of DMEM/F-12 to neutralize Accutase.
  • e.
    Detach the cells by gently pipetting to generate a suspension of single cells.
  • f.
    Add the cells to the 15 mL tube containing DMEM/F-12 and DPBS.

Note: Following Colcemid treatment, DPBS is preferred over EDTA for washing to enhance cell survival before using the downstream enzymatic action of Accutase for single-cell dissociation.

• 64.Centrifuge at 250 × g for 3 min.
• 65.Aspirate the supernatant, leaving 0.2–0.5 mL of volume left. Gently flick the tube until the clumps are no longer visible.
• 66.
  Treat the cells with a hypotonic solution.

  • a.
    Add 3 mL of 75 mM KCl pre-warmed at 37°C, dropwise against the tube wall while gently flicking the tube.
  • b.
    Slowly incline the tube to a horizontal position to mix the solutions.
  • c.
    Move the tube to a vertical position and add 2 mL of KCl 75 mM against the tube wall facing down to collect the cells at the bottom of the tube.
  • d.
    Incubate 10 min at 37°C.
  • e.
    Add 3 drops of fresh cold fixative solution (methanol/glacial acetic acid 3:1) and invert the tube gently once.
  • f.
    Centrifuge at 250 × g for 3 min.
• 67.
  Fix the cells with fixative solution.

  • a.
    Add 3 mL of fixative solution, dropwise, against the tube wall while gently flicking the tube.
  • b.
    Slowly incline the tube to a horizontal position to mix the solutions.
  • c.
    Move the tube to a vertical position and add 2 mL of fixative solution against the tube wall facing down to collect the cells at the bottom of the tube.
  • d.
    Incubate for 10 min at 20°C–25°C.
  • e.
    Centrifuge at 250 × g for 3 min.
  • f.
    Aspirate the supernatant, leaving approximately 0.2–0.5 mL of volume.
• 68.
  Wash the cells.

  • a.
    Gently flick the tube and add 5 mL of fresh fixative solution against the tube wall while gently flicking the tube.
  • b.
    Centrifuge at 300 × g for 5 min.

Note: Repeat washing at least 2 more times until the supernatant is clear.

• 69.After the last centrifugation, gently flick the tube and add 2 mL of fresh fixative solution against the tube wall while gently flicking the tube.
• 70.Store the tubes at 4°C until karyotyping. For this protocol, sample analysis was performed by the Center of Human Genetics at the Université Libre de Bruxelles (ULB). See Figure 2C.

Note: The tubes can be stored for weeks without affecting the karyotyping results.

Embryoid body formation

Timing: 2 weeks

Embryoid body formation evaluates early embryonic development and differentiation potential of stem cells and validates the formation of the three germ layers: endoderm, mesoderm, and ectoderm.

• 71.
  Once the 3.5-cm dish is 80% confluent, prepare two wells of an Aggrewell Microwell plate.

  • a.
    Add 1 mL of Anti-adherence Rinsing Solution per well.
  • b.
    Incubate at 20°C–25°C for 5 min.
  • c.
    Remove the Anti-adherence solution.
  • d.
    Add 1 mL of Embryoid body formation medium with 10 μM ROCK inhibitor.
  • e.
    Place the plate in a humidified incubator at 37°C with 5% CO₂ concentration.
• 72.
  Make a single-cell suspension.

  • a.
    Wash each 3.5-cm dish once with 1.5 mL of 0.5 mM EDTA.
  • b.
    Add 1 mL of Accutase.
  • c.
    Incubate at 37°C for 4–5 min.
  • d.
    Add 1 mL of Embryoid body formation medium with 10 μM ROCK inhibitor to neutralize the Accutase.
  • e.
    Detach the cells and generate a single-cell suspension by gentle pipetting.
  • f.
    Add the cells to a 15 mL tube containing 3 mL of Embryoid body formation medium supplemented with 10 μM ROCK inhibitor.
  • g.
    Centrifuge at 250 × g for 3 min.
  • h.
    Aspirate the supernatant and resuspend in 500 mL of Embryoid body formation medium with 10 μM ROCK inhibitor.
  • i.
    Pass the cells through a 40 μm cell strainer.
  • j.
    Count cells and measure cell viability.
  • k.
    Adjust the cell suspension to a concentration of 0.7–1 million cells per mL.
• 73.Add 1 mL of cell suspension to the respective wells, either wild-type or knockout, of the Aggrewell plate.
• 74.Place the plate in a humidified incubator at 37°C with 5% CO₂ concentration.
• 75.The next day: Aspirate 1 mL of medium and carefully add 1 mL of fresh pre-warmed Embryoid body formation medium without ROCK inhibitor.
• 76.Replace 1 mL of medium every other day with fresh pre-warmed Embryoid body formation medium without ROCK inhibitor.
• 77.After 5–7 days: Seed the embryoid bodies into three 8-well culture slides with 400 μL of Embryoid body formation medium.

Note: It is recommended to use three slides with 15–20 embryoid bodies per well. Select, count and seed bright (healthy) aggregates.

• 78.The next day: Replace the medium with fresh pre-warmed Embryoid body formation medium, use 400 μL per well.
• 79.Replace the medium with fresh medium every other day, 400 μL per well.
• 80.14 days after 8-well culture slide seeding, fix the cells with 4% paraformaldehyde.
• 81.Proceed with the staining protocol for the three germ layer markers (SOX17, VIMENTIN, and β-III TUBULIN). See Figure 2D.

Note: The slides can be stored at 4°C after fixation, adding 400 μL of DPBS to the wells.

Pause Point: Clones can be frozen and stored in liquid nitrogen until both a wild-type clone and a knockout clone have successfully passed all quality controls. Only then should the β-like cell differentiation process be initiated. For β-like cell differentiation, the wild-type and knockout clones are expanded to 10-cm dishes.

hPSC seeding for β-like cell differentiation

Timing: day −1, 2–4 h

The β-like cell differentiation, as illustrated in Figure 3A, is a 35-day-long process that begins with the formation of a monolayer of cells. This planar structure is established in Matrigel-coated 6-well plates. The day before differentiation begins, the cells are dispersed into single cells, counted, and then seeded to form a uniform monolayer.

Note: Only viable cells will attach to the Matrigel; thus, the number of live cells is used to calculate the number of cells per well.

Note: It is advisable to not work with more than one cell line at the same time in the laminar flow hood. Additionally, minimize the time that the cells are outside of the incubator.

• 82.Prepare the 6-well plates by adding 1 mL of mTeSR Plus with a final concentration of 10 μM ROCK inhibitor to each well and pre-warm in the incubator for 30 min.
• 83.
  Make a single-cell suspension.

  • a.
    Wash the cells with 8 mL of 0.5 mM EDTA per 10-cm dish.
  • b.
    Incubate the cells with 3 mL of Accutase per 10-cm dish for 4–5 min at 37°C.
  • c.
    Add 3 mL of mTeSR Plus to each dish and detach the cells by gentle pipetting.
  • d.
    Collect the cells in a 50 mL tube.
  • e.
    Wash the dishes with 2 mL of mTeSR Plus and add it to the same tube.
  • f.
    Invert the tube several times to achieve a homogeneous solution and take a small aliquot of the cell suspension for cell counting during centrifugation.

    • i.
      Count the cell number and assess the viability.
  • g.
    Centrifuge at 250 × g for 3 min.
  • h.
    Remove the supernatant and add 1 mL of mTeSR Plus with 10 μM ROCK inhibitor.
  • i.
    Resuspend the cells by gentle pipetting.
  • j.
    Gently add mTeSR Plus with 10 μM ROCK inhibitor to a final concentration of 1 million live cells per mL.
• 84.
  Collect cell pellets for western blotting and qPCR.

  • a.
    Collect 1 mL of cell suspension for western blotting and 500 μL of cell suspension for qPCR quality controls into 1.5 mL tubes.
  • b.
    Centrifuge at 500 × g for 5 min.
  • c.
    Remove the supernatant and resuspend the cells in 1.5 mL of DPBS.
  • d.
    Centrifuge at 500 × g for 5 min.
  • e.
    Remove the supernatant and store the western blotting pellet at −20°C and the qPCR pellet at −80°C until quality controls are performed.
• 85.Seed 250,000 live wild-type or knockout cells per well in three 8-well culture slides to ensure simultaneous differentiation and quality control checks.

Note: One 8-well culture slide will be fixed the day after seeding, the second 8-well culture slide will be fixed on day 4 to check definitive endoderm induction, and the third 8-well culture slide will be fixed on day 13 to check pancreatic endoderm induction. The square shape of culture vessels may influence differentiation efficiency, because monolayer abnormalities often occur at the corners, unlike in rounded vessels. This should be considered when evaluating differentiation efficiency.

Alternatives: Instead of immunofluorescence for quality control, FACS can be used to determine the percentage of different cell populations. For this, the cells need to be dispersed from the monolayer at the initial stages or aggregates at the final stages of differentiation.

• 86.Seed 2 million live cells per well into the pre-warmed 6-well plate.
• 87.Place the plates in a humidified incubator at 37°C with 5% CO₂ concentration.

CRITICAL: Place the plates in the incubator and evenly distribute the cells by rocking the plate back and forth and from left to right. Even cell distribution ensures monolayer formation.

Figure 3.

Characterization of PTPRF^+/+ and PTPRF^−/− H1-hESC during in vitro differentiation

(A) Schematic of PTPRF^+/+ and PTPRF^−/− H1 SC-β-like cell differentiation protocol. The first four stages (S1-S4) are conducted as monolayers in planar culture (2D). The subsequent three stages (S5-S7) are performed in static microwells (3D).

(B and C) Representative bright-field images showing the morphology and immunofluorescence images of differentiation stage-specific markers for PTPRF^+/+ and PTPRF^−/− clones: SOX17+ and OCT4- cells for definitive endoderm (B) and NKX6.1+ and PDX1+ for pancreatic endoderm (C) (Scale bar = 100 μm).

(D) Percentage viability of total cells at the end of Stage 4 (S4) and Stage 7 (S7) (n = 2, mean ± SEM).

(E) Representative bright-field image showing the morphology and size of Stage 5 PTPRF^+/+ and PTPRF^−/− aggregates differentiating into β-like cells in static microwells (Scale bar = 100 μm).

(F) Relative gene expression levels of PDX1 and NGN3 at Stage 5 (S5) and INS, GCG, and SST at Stage 6 (S6) and Stage 7 (S7). β-actin was used as an endogenous housekeeping gene to calculate ΔCt and normalized to undifferentiated PTPRF^+/+ H1-hESC to calculate ΔΔCt values and relative gene expression (n = 2, mean ± SEM).

(G) Representative immunofluorescence staining of differentiation stage β-like cells (S7) specific markers showing insulin-positive (INS+), glucagon-positive (GCG+), and somatostatin-positive (SST+) cells in PTPRF^+/+ and PTPRF^−/− in dispersed β-like cell spheroids (Scale bar = 50 μm). The number of INS+, GCG+, and SST+ cells is quantified with CellProfiler as a percentage of total cells. Nuclei are visualized with DAPI.

Induction of the definitive endoderm: Stage 1

Timing: days 0–4, 30 min per day

The first stage, definitive endoderm, is induced in a monolayer and plays a critical role in differentiation efficiency. Insufficient confluence, reduced cell viability, or medium over-acidification will compromise the efficiency of definitive endoderm differentiation. Both cell lines should start the differentiation on the same day.

Note: At this stage, increased cell death can be observed and should be monitored.

• 88.Day 0: Replace the medium with 2 mL of fresh mTeSR Plus without ROCK inhibitor for 2–3 h before starting the differentiation.

CRITICAL: If a cell monolayer has not yet fully formed, replace the media with 3 mL of mTeSR Plus without ROCK inhibitor and extend the incubation time. Carefully monitor the plates and start this step only when both wild-type and knockout cell lines show no gaps in the monolayer, preferably on the same day. If the confluent monolayer is not formed after 24 h of seeding, do not proceed with differentiation, as extended incubation can negatively affect its efficiency.

• 89.Fix the cells with 4% paraformaldehyde in one 8-well cell culture slide and confirm the pluripotent status by fluorescent staining for OCT4 and NANOG in wild-type and knockout cells.
• 90.Prepare fresh Day 0 medium for both cell lines and warm it to 37°C for 30 min.

Note: For this and subsequent steps, prepare 2 mL for each well in a 6-well plate and 400 μL for each well in an 8-well culture slide.

Day 0 Medium

Reagent	Final concentration	Amount
Basal Medium 1	---	10 mL
Activin A	100 ng/mL	1 μL
CHIR	5 μM	5 μL
Total		10 mL

• 91.Carefully remove the mTeSR Plus.
• 92.Wash the wells with 2 mL of pre-warmed DPBS per well.
• 93.Add 2 mL of pre-warmed Day 0 medium per well.
• 94.Incubate in a humidified incubator at 37°C with 5% CO₂ concentration.

CRITICAL: Maintain the cells in Day 0 medium for a minimum of 24 h. An efficient definitive endoderm is induced by CHIR during the first 24 h. A reduced incubation time with CHIR will negatively affect differentiation efficiency.

• 95.Day 1: Prepare fresh Day 1 medium for both cell lines and warm to 37°C for 30 min.

Day 1 Medium

Reagent	Final concentration	Amount
Basal Medium 1	---	10 mL
Activin A	100 ng/mL	1 μL
CHIR	0.5 μM	0.5 μL
Total	N/A	10 mL

• 96.Carefully remove the Day 0 medium and add 2 mL of pre-warmed Day 1 medium.

Note: If a large amount of cell death is observed, the wells should be washed with pre-warmed DPBS.

• 97.Return the plates to a humidified incubator at 37°C with 5% CO₂ concentration.
• 98.Day 2: Prepare fresh Day 2 medium for both cell lines and warm to 37°C for 30 min.

Day 2 Medium

Reagent	Final concentration	Amount
Basal Medium 1	---	10 mL
Activin A	100 ng/mL	1 μL
Total	N/A	10 mL

• 99.Carefully remove the Day 1 medium and add 2 mL of pre-warmed Day 2 medium.

Note: If a large amount of cell death is observed, the wells should be washed with pre-warmed DPBS.

• 100.Return the plates to a humidified incubator at 37°C with 5% CO₂ concentration.

Pancreatic progenitor development: Stages 2–4

Timing: days 4–9, 30 min per day

Pancreatic progenitor formation is induced in a planar structure and progresses through the development of the primitive gut tube (Stage 2), posterior foregut (Stage 3), and pancreatic endoderm (Stage 4).

Note: For these stages, the medium must be changed daily according to the instructions below.

CRITICAL: A low level of cell death and detachment during Stage 1 is expected. However, prolonged time in Stage 1 can result in excessive cell death, disruption of the monolayer, and halt the differentiation process. Therefore, it is advisable to perform the medium change for the subsequent stage as early and gently as possible on the morning of day 4.

• 101.
  Day 4: Collect cell pellets for quality controls, use one well per cell line.

  • a.
    Wash one well per cell line with 2 mL of cold DPBS.
  • b.
    Add 1.5 mL of cold DPBS, detach the cells using a cell scraper, and resuspend.
  • c.
    Transfer 1 mL to a 1.5 mL tube for western blotting and 500 μL to a 1.5 mL tube for qPCR.
  • d.
    Centrifuge at 500 × g for 5 min.
  • e.
    Remove the supernatant and store the western blotting pellet at −20°C and the qPCR pellet at −80°C until quality controls are performed.
• 102.Fix the cells in the second 8-well cell culture slide with 4% paraformaldehyde to confirm definitive endoderm induction by fluorescent staining for OCT4 and SOX17 (See Figure 3B).

CRITICAL: At the end of Stage 1, cells must not express OCT4 but should express SOX17 to efficiently differentiate into the pancreatic endoderm layer. A yield of >90% of SOX17-positive cells is expected. If lower efficiency is observed, evaluate the continuation of the differentiation process; if continued, the yield of insulin-producing cells will be proportionally lower.

• 103.Days 4–6: Prepare fresh Stage 2 medium daily for both cell lines and warm to 37°C for 30 min.

Stage 2 Medium

Reagent	Final concentration	Amount
Basal Medium 1	---	10 mL
Ascorbic Acid	250 mM	10 μL
FGF7	50 ng/mL	5 μL
Total	N/A	10 mL

• 104.Carefully remove the old medium and add 2 mL of pre-warmed Stage 2 medium.
• 105.Return the plates to a humidified incubator at 37°C with 5% CO₂ concentration.
• 106.Days 7–9: Prepare fresh Stage 3 medium daily for both cell lines and warm to 37°C for 30 min.

Stage 3 Medium

Reagent	Final concentration	Amount
Basal Medium 2	---	10 mL
Ascorbic Acid	250 mM	10 μL
FGF7	50 ng/mL	5 μL
Stage 3 Supplement	---	4 μL
Total	N/A	10 mL

• 107.Day 7: Collect cell pellets for quality controls; use one well per cell line (Step 101).
• 108.Carefully remove the old medium and add 2 mL of pre-warmed Stage 3 medium.
• 109.Return the plates to a humidified incubator at 37°C with 5% CO₂ concentration.
• 110.Days 9–12: Prepare fresh Stage 4 medium daily for both cell lines and warm to 37°C for 30 min.

Stage 4 Medium

Reagent	Final concentration	Amount
Basal Medium 2	---	9.9 mL
Ascorbic Acid	250 mM	10 μL
FGF7	50 ng/mL	5 μL
EGF	100 ng/mL	1 μL
Nicotinamide	10 mM	100 μL
Activin A (∗diluted 1:10)	10 ng/mL	1 μL
Stage 4 Supplement	---	4 μL
Total	N/A	10 mL

• 111.Day 9: Collect cell pellets for quality controls; use one well per cell line (Step 101).
• 112.Carefully remove the old medium and add 2 mL of pre-warmed Stage 4 medium.
• 113.Return the plates to a humidified incubator at 37°C with 5% CO₂ concentration.

Generation of endocrine progenitor aggregates: Stages 4–5

Timing: days 13–16, 2 h on day 13 and 1 h daily thereafter

After the formation of the pancreatic endoderm, endocrine progenitors are generated in 24-well Aggrewell Microwell plates. A 24-well Aggrewell Microwell plate contains approximately 1200 microwells (400 μm in size) per well, with an optimal cell density of 750–1000 cells per microwell, depending on the cell line. These steps are pivotal to increasing differentiation efficiency. This method to control the size of aggregates helps reduce hypoxia and consequently necrosis in the cluster core and normalizes the surface-to-volume ratio, which is critical for glucose sensing and insulin secretion.

CRITICAL: The cells are in suspension; therefore, careful handling is required. Additionally, only half of the volume should be removed to avoid disturbing or aspirating aggregates.

• 114.Day 13: Fix the cells of the 8-well slide with 4% paraformaldehyde to check the NKX6.1/PDX1 double-positive cells by immunofluorescence staining. See Figure 3C.

CRITICAL: Efficient pancreatic progenitor induction should be assessed before continuing the differentiation and it is indicated by a yield of more than 70% double-positive cells.

• 115.
  Prepare fresh Stage 5 medium∗ for both cell lines and warm to 37°C for 30 min.

  • a.
    Make Stage 5 medium containing heparin and ROCK inhibitor (Stage 5 medium∗) for use in the first 24 h after seeding the cells for aggregate formation.

Note: Prepare 2 mL of Stage 5 medium∗ per Aggrewell, 1.5 mL for pellets, and 400 μL per well of an 8-well culture slide required for quality control.

CRITICAL: This step must be performed for wild-type and knockout cell lines on the same day.

Stage 5 Medium∗ with heparin and ROCK inhibitor

Reagent	Final concentration	Amount
Basal Medium 3	---	9.9 mL
Betacellulin	20 ng/mL	2 μL
Glucose	20 mM	40 μL
Stage 5 Supplement	---	6.67 μL
Heparin	15 μg/mL	5 μL
Rock Inhibitor Y-27632	10 μM	10 μL
Total	N/A	10 mL

• 116.
  Add 1 mL of Anti-Adherence Rising Solution per well in an Aggrewell plate.

  • a.
    Gently pipette the anti-adherence solution into the microwells.
  • b.
    Verify using a microscope that no air bubbles are formed in the microwells.
  • c.
    Incubate for 5 min at 20°C–25°C.
  • d.
    Remove the solution and store it in a sterile tube.

    Note: The anti-adherence solution should be stored at 20°C–25°C and can be re-used up to 3 times.

  • e.
    Add 1 mL of Stage 5 medium∗ to each well of the Aggrewell plate and pre-warm the plate in the incubator.

    CRITICAL: Microbubbles in the microwells should be removed, either by centrifugation or by pipetting the anti-adherence solution over the bubbles. Carefully remove as many bubbles as possible, as they disrupt the deposition of suspended cells into the microwells. Disrupted deposition can lead to the formation of cell clumps and tube-like structures, hindering proper aggregate formation and even distribution in the Aggrewell plate. The presence of microbubbles should be checked after adding Stage 5 medium∗ and removed if necessary.

• 117.Prepare an 8-well culture with 200 μL of Stage 5 medium∗ per well and pre-warm in an incubator.
• 118.
  Make a single-cell suspension.

  • a.
    Wash the cells in the 6-well dishes twice with 1.5 mL of 0.5 mM EDTA per well.
  • b.
    Add 1 mL Accutase to the wells.
  • c.
    Incubate the cells for 4–5 min at 37°C.
  • d.
    Use a microscope to confirm the readiness of cells for detachment by observing a distinct white outline around the cells.
  • e.
    Add 1 mL of MCDB131 medium to the wells to inactivate Accutase.
  • f.
    Detach the cells by gentle pipetting without touching the bottom of the well.

    CRITICAL: Do not pipet aggressively up and down or for a prolonged time. Cells that do not detach are not ready to continue the differentiation protocol and must be discarded.

  • g.
    Collect the cell suspension in a 50 mL tube.
  • h.
    Centrifuge at 250 × g for 3 min.
  • i.
    Gently resuspend the cell pellet in 1 mL of Stage 5 medium∗ using a micropipette.
  • j.
    Dilute the cell suspension with 4 mL of Stage 5 medium∗.

    Note: It is recommended to not strain the cells at this point for cell counting, as this might lead to excessive stress and reduced viability. Only strain them with a 40 μm filter if the presence of large clumps after resuspension is observed.

  • k.
    Count cells and measure cell viability cells (See Figure 3D).
  • l.
    Resuspend the cells in Stage 5 medium∗ at a concentration of 1 million cells per mL.

    Note: It is important to have cell viability as high as possible. If the measured cell viability is below 80%, resuspend the cells at a concentration of 1.2 million cells per ml and add 1 mL to each Aggrewell.

• 119.Seed 1 million cells per well in the pre-warmed Aggrewell plate (∼1200 microwells; 833 cells/microwell).
• 120.Seed 200,000 cells per well in the 8-well chamber slide.
• 121.Return the plates to a humidified incubator at 37°C with 5% CO₂ concentration, avoiding any movements that may disturb the evenly distributed cells.
• 122.Collect cell pellets for western blotting and qPCR (Step 84).
• 123.Day 14: Fix the cells in the 8-well cell culture slide with 4% paraformaldehyde and confirm the induction of pancreatic endoderm by fluorescent staining for NKX6.1 and PDX1.

Note: To accurately quantify the induction of pancreatic endoderm, performing an additional quality control directly from cells in planar culture is recommended. Relying on cells seeded for quality control on day −1 in the 8-well chamber slide can result in misestimation of PDX1 and NKX6.1 positive cells due to variations in the shape of the culture vessels and differences in differentiation efficiencies compared to a 6-well plate.

• 124.
  Days 14–17: Prepare fresh Stage 5 medium daily for both cell lines and pre-warm to 37°C for 30 min.

  • a.
    Prepare 1 mL for each well in the Aggrewell plate.

Stage 5 Medium

Reagent	Final concentration	Amount
Basal Medium 3	---	10 mL
Betacellulin	20 ng/mL	2 μL
Glucose	20 mM	40 μL
Stage 5 Supplement	---	6.67 μL
Total	N/A	10 mL

• 125.Verify the formation of aggregates using a microscope (See Figure 3E).

Note: The aggregates should be formed the next day or within a maximum of 2 days. Low cell viability may lead to the lack of a clear edge or a proper aggregate structure.

CRITICAL: Once aggregates are well formed, verify each well for the presence of cell clumps and tube-like structures. These structures can attach to the aggregates, leading to the loss of viable aggregates. If present, place the Aggrewell plate on a microscope under a laminar flow hood and remove the structures using a 1 mL micropipette. Gently remove as little medium as possible and avoid disturbing the surrounding aggregates. If the aggregates do not present a clear shape, wait one more day to remove the structures.

• 126.Slowly aspirate the previous day’s medium, leaving 1 mL in each well.
• 127.Gently add 1 mL of fresh pre-warmed medium, pipetting very slowly on the wall of the well without disturbing the aggregates.

CRITICAL: Medium exchange should be performed using a pipette-aid at the slowest speed every time, positioning the pipette at an almost horizontal angle. In Aggrewell plates, the aggregates do not adhere to the surface, and excessive flow during medium exchanges may remove or cluster them. This leads to aggregate clumping, resulting in the overall loss of viable aggregates and a lower yield of β-like cells.

• 128.Return the plates to a humidified incubator at 37°C with 5% CO₂ concentration.

Endocrine maturation: Stages 6–7

Timing: days 17–35, 1 h per day

In the last two stages of differentiation, the cells express insulin, but further maturation in vivo is required to reach full functionality. At the end of each stage, pellets are taken to perform western blotting and qPCR quality controls. At the end of differentiation, some spheroids are dispersed into single cells to confirm endocrine cell identity (See Figure 3F).

Note: At this point the medium can be changed every 2 days if it is not excessively acidified, this can be observed in the yellow color of the medium.

• 129.Day 17: Collect the spheroids from 1 to 2 Aggrewells per genotype, depending on the coverage, into 1.5 mL tubes for western blotting and qPCR quality controls, following the pellet collection steps (Step 84).

Note: Remove 1 mL of medium before collecting the spheroids by pipetting up and down, add approximately 1,000 aggregates to the western blotting tube and 500 aggregates to the qPCR tube.

• 130.
  Days 17–24: Prepare fresh Stage 6 medium for both cell lines and pre-warm to 37°C for 30 min.

  • a.
    Prepare 1 mL for each well in the Aggrewell plate.

Stage 6 Medium

Reagent	Final concentration	Amount
Basal Medium 3	---	10 mL
Glucose	20 mM	40 μL
Stage 6 Supplement	---	5 μL
Total	N/A	10 mL

• 131.Carefully aspirate 1 mL of medium.
• 132.Gently add 1 mL of fresh pre-warmed medium without disturbing the spheroids.
• 133.Return the plates to a humidified incubator at 37°C with 5% CO₂ concentration.
• 134.Day 25: Collect the spheroids from 1 to 2 Aggrewells per genotype for quality controls, (step 129).
• 135.
  Days 25–34: Prepare fresh Stage 7 medium for both cell lines and pre-warm to 37°C for 30 min.

  • a.
    Prepare 1 mL for each well in the Aggrewell plate.

Stage 7 Medium

Reagent	Final concentration	Amount
Basal Medium 3	---	10 mL
GC-1	1 μM	1 μL
Trolox	10 μM	1 μL
JNK Inhibitor	20 μM	2 μL
RSV	75 μM	3.33 μL
R428	2 μM	2 μL
N-Acetylcysteine	1 mM	100 μL
Total	N/A	10 mL

• 136.Carefully aspirate 1 mL of medium.
• 137.Gently add 1 mL of fresh pre-warmed medium without disturbing the spheroids.
• 138.Return the plates to the humidified incubator at 37°C with 5% CO₂ concentration.
• 139.Day 35: Collect the spheroids from 1 to 2 Aggrewells per genotype for quality controls (Step 129).
• 140.
  Select 1–2 wells for immunofluorescence quality control and disperse the spheroids.

  • a.
    Prepare an 8-well culture with 200 μL of Stage 7 medium with 10 μM ROCK inhibitor per well and pre-warm in the incubator.
  • b.
    Collect the spheroids in a 15 mL tube.
  • c.
    Centrifuge at 50 × g for 1 min.
  • d.
    Wash twice with 2 mL of 0.5 mM EDTA.
  • e.
    Centrifuge at 50 × g for 1 min.
  • f.
    Remove the EDTA and add 1 mL of Accumax.
  • g.
    Incubate for 4 min at 37°C.
  • h.
    Gently pipet to disrupt the spheroids.
  • i.
    Incubate again for 4 min at 37°C.
  • j.
    Pipet very gently.

    Note: If clumps are visible after 8 min of incubation with Accumax, increase the incubation time by a maximum of 4 min.

  • k.
    Add 1 mL of Stage 7 medium with 10 μM ROCK inhibitor.
  • l.
    Pipet gently.
  • m.
    Centrifuge at 250 × g for 3 min.
  • n.
    Discard the supernatant.
  • o.
    Resuspend in Stage 7 medium with 10 μM ROCK Inhibitor.
  • p.
    Strain the cells using a 40 μm strainer.
  • q.
    Count cells and measure cell viability (See Figure 3D).
  • r.
    Seed 200,000 cells per well in two 8-well cell culture slides.
  • s.
    After 24 h, fix the cells with 4% paraformaldehyde in the cell culture slides.
• 141.Confirm the presence of endocrine cells by immunofluorescence staining for insulin, glucagon, and somatostatin (See Figure 3G).
• 142.The other wells can be used for implantation under the murine kidney capsule or for any other in vitro characterization.

Implantation under the kidney capsule

Timing: 1 h per mouse

After in vitro differentiation, stage 7 pancreatic islet-like spheroids (PTPRF^+/+ or PTPRF^−/−) are implanted under the kidney capsule for 16 weeks of in vivo maturation. Quality controls confirm the β-like cell’s ability to secrete insulin in response to glucose. At the end of this period, the mice should respond to glucose normally. They are then treated with STZ to induce diabetes. Successful prevention of STZ-induced hyperglycemia confirms the maturity and functionality of the β-like cells (see Figure 4A).

Note: The surgeries are performed by two individuals: the surgeon and the surgical assistant.

• 143.Gently pipette up and down the medium to collect approximately 3,000 stage 7 PTPRF^+/+ or PTPRF^−/− spheroids and place them in separate 15 mL tubes. Wash the wells with 1 mL of DPBS and add the wash solution to the corresponding tubes.

Note: Usually, 3 Aggrewells of a 24-well plate should yield 3,000 spheroids, with an expectation of 1,000 spheroids per Aggrewell, assuming medium exchange was executed properly. When a lower number of spheroids are observed in the Aggrewell plate, calculate accordingly the number of wells needed to obtain 3,000 spheroids for each genotype.

• 144.Spin down for 1 min at 50 × g.
• 145.Carefully remove the supernatant without disturbing the spheroid pellet.

Note: Do not remove all supernatant to avoid spheroid loss. Leave approximately 100 μL of DPBS above the spheroid pellet.

CRITICAL: All material must be sterile, and aseptic conditions should be maintained during all the processes due to the high susceptibility to infections of the NOD-SCID mice.

• 146.
  Load the spheroids (PTPRF^+/+ or PTPRF^−/−) into separate polyethylene tubing segments.

  • a.
    Cut polyethylene tubing (PE-50/10) into sections of 15–20 cm.
  • b.
    Insert the narrow end of a gel-loading pipette tip into one end of the tubing.
  • c.
    Aspirate all cells with DPBS with a 200 μL micropipette.
  • d.
    Transfer the suspension into the gel-loading pipette tip attached to the tubing.
  • e.
    When the spheroids are settled in the tip, connect a 200 μL micropipette to the gel-loading pipette tip.
  • f.
    Use the 200 μL micropipette to push the spheroids into the tubing. Ensure all the spheroids are in the tubing without exiting on the other end.
  • g.
    Bend the tubing in a “U” shape and secure it into a 1 mL syringe barrel with the open ends facing upwards. Place the syringe barrel inside a 50 mL centrifuge tube and close it.
  • h.
    Repeat for the other genotype. Centrifuge the 50 mL centrifuge tubes (containing the spheroids inside polyethylene tubing within a syringe barrel) at 300 × g for 3 min.

Note: After centrifugation, the spheroids should have formed one compact mass in the tubing without bubbles or liquid separating them. If this is not the case, flick the tubing to remove the bubbles and centrifuge again. A compact cluster of spheroids facilitates the implantation.

• 147.Keep the spheroids on ice to reduce cell death.
• 148.
  Prepare the surgical area using heating pads and a sterilizer for surgical tools.

  • a.
    Place one heating pad in the surgical area next to the mouse anesthesia mask.
  • b.
    Allow the sterilizer to heat up to 200°C.

Note: Place other heating pad under a recovery cage for post-operative recovery.

• 149.Anaesthetize the mouse in an isoflurane chamber with 5% isoflurane in oxygen at a gas flow rate of 0.4–0.6 L per minute.
• 150.Verify that the mouse is anaesthetized using the toe pinch reflex.
• 151.Place the mouse on the surgical heating pad, resting on its right flank and with its snout in the mouse anesthesia mask. Adjust the concentration of isoflurane to 2%.

Note: Importantly, each mouse may react differently to the anesthesia. Carefully monitor the mouse’s pinch reflex and breathing, adjust the isoflurane concentration accordingly.

• 152.Apply ophthalmic gel on the mouse’s eyes to keep them hydrated.
• 153.Shave the left abdominal flank of the mouse and remove all hair from the surgical area.
• 154.Clean the operating site with Iso-Betadine Germicide Soap with a circular motion.
• 155.Disinfect the skin with Iso-Betadine Dermicum.

Note: The combination of Iso-Betadine Germicide Soap and Iso-Betadine Dermicum guarantees a well-disinfected area for the operation.

• 156.
  Find the spleen on the abdominal flank for the externalization of the kidney.

  • a.
    Make a transversal incision in the skin in one cut to avoid uneven edges.
  • b.
    Using a pair of blunt dissection scissors and forceps, separate the skin from the peritoneal muscle using scissors.
  • c.
    With a new pair of sterile scissors, make a transversal incision in the peritoneal muscle.

    Note: Remove the fat before making the incision if the peritoneum is not clearly visible.

  • d.
    Locate the kidney inside the body by carefully enlarging the incision.

    Note: The location of the kidney is dorsal to the spleen, close to the spine.

  • e.
    Apply gentle pressure with the thumb on the abdomen and the index finger on the dorsal spine to externalize the kidney with one hand.
  • f.
    Gently lift the kidney using a pair of blunt forceps at the incision site.
  • g.
    Fix the kidney outside the body by clamping the skin at the dorsal side of the incision site.
  • h.
    Hold the kidney in the desired position using a pair of small forceps.

    CRITICAL: Keep the kidney well hydrated during the operation by frequently applying DPBS with a cotton swab.

• 157.
  Make a “pocket” under the kidney capsule to contain the spheroids.

  • a.
    Use a needle to make a small incision in the kidney capsule on the caudolateral side of the kidney.
  • b.
    Use a DPBS-humidified sterile gel-loading pipette tip to enter under the kidney capsule through the incision.
  • c.
    Gently separate the capsule from the kidney with the gel-loading pipette tip, moving the end of the tip while having it static at the incision point.
  • d.
    Remove the gel-loading pipette tip.
• 158.
  Prepare the tubing with the spheroids.

  • a.
    Attach a Hamilton pipette to the tubing.
  • b.
    Cut the tubing tip at a 30° angle using a surgical steel blade.

    Note: Cutting the tube at a broader angle can produce a sharper tip, increasing the risk of tearing the kidney capsule or puncturing the kidney.

  • c.
    Apply pressure with the Hamilton pipette and check the flow of the spheroids.
  • d.
    Push the spheroids close to the end of the tubing.
• 159.Humidify the tubing with DPBS and insert it into the “pocket” under the kidney capsule.
• 160.Insert the tubing as far as possible without breaking the capsule.
• 161.The surgical assistant should apply slight pressure on the Hamilton pipette under the guidance of the surgeon.
• 162.As the spheroids are deposited into the “pocket,” gently move the tubing to distribute the spheroids on the ventral-lateral side of the kidney.
• 163.Once all the spheroids are under the kidney capsule, release the pressure from the Hamilton pipette.
• 164.Carefully withdraw the tubing from the kidney capsule, minimizing any loss of spheroids.
• 165.Cauterize the incision in the kidney capsule.
• 166.Apply extra DPBS with a cotton swab.
• 167.Release the clamp on the skin.
• 168.Return the kidney to the abdominal cavity carefully without disturbing the implanted spheroids.
• 169.Suture the abdominal incision with sterile absorbable sutures.
• 170.Suture the skin incision with nylon sutures.
• 171.Apply Iso-Betadine Germicide Soap to clean the areas around the wound, avoiding the incision site.
• 172.Disinfect the wound with Iso-Betadine Dermicum and apply aluminum spray.

Note: Aluminium spray provides open wounds with a protective layer. Keeping the wound clean will ensure faster healing and less scarring. Additionally, mice dislike the taste of the aluminum spray, which deters them from biting the surgical area.

• 173.Administer 400 μL of pre-warmed DPBS intraperitoneally.
• 174.Administer 200 μL of 50 mg/g of Buprenorphine subcutaneously.
• 175.Return the animal to a pre-warmed cage for recovery.
• 176.Perform (Steps 149–175) for implanting the spheroids for the other genotype.
• 177.Closely monitor the first animal that underwent surgery until it is fully awake.
• 178.Add syrup containing paracetamol to a final concentration of 3.5 mg/mL to the drinking water.
• 179.Place some food pellets on the bedding of the cage to facilitate eating post-surgery.
• 180.Keep the mice in separate cages for a week to ensure complete wound healing.

Note: After this period, return the mice to their co-housed littermates and replace water with paracetamol with regular water (See Figures 4B–4T).

Figure 4.

Detailed procedure for the implantation of PTPRF^+/+ and PTPRF^−/− H1-hESC-derived β-like cells under the kidney capsule of NOD/SCID Mice

(A) Schematic representation showing the data points and sampling procedure post-implantation of H1-hESC-derived β-like islet cells under the kidney capsule of non-obese diabetic severe combined immunodeficient (NOD/SCID) mice.

(B–T) Implantation of differentiated β-like cells under the kidney capsule. Preparation and loading of spheroids in polyethylene (PE) tubing (B-F). Preparation of the implantation PE tubing with the gel-loading tip (black arrow points toward the spheroids) (B). A pipette is used to push the spheroid cell suspension inside the PE tubing from the gel-loading tip (the black arrow points toward the spheroids) (C). PE tubing containing spheroid cell suspensions is placed inside syringe barrels within 50 mL tubes for centrifugation of both wild-type (WT) and knockout (KO) samples (D). PE tubing with the compact spheroid mass at the bottom (black arrow) (E). Close-up view of the PE tubing with the compact spheroid mass at the bottom (black arrow) (F). Surgical procedure (G-T). Anesthetized mouse positioned for surgery (G). Incision made at the surgical site to access the kidney (H-J). Application of DPBS on externalized kidney and exposed kidney for implantation (K-L). The needle tip is used to make a small incision on the kidney capsule (M). Using a gel-loading pipette tip, a space below the kidney capsule is created (N). PE tubing containing the spheroids is inserted in the space below the kidney capsule (O). The surgical assistant carefully pushes the spheroids using a Hamilton pipette (P). Close-up view of the implanted kidney (black arrow points toward the spheroids) (Q). Sutures securing the abdominal incision (R). Surgical area post skin-suturing (S). Mouse recovering post-surgery with a protective covering over the surgical site (T).

Implantation quality control 1

Timing: 8 weeks post-implantation, 10 min per mouse

Basal blood levels of human C-peptide at 8 weeks indicate the secretion of human insulin in mice implanted with PTPRF^+/+ or PTPRF^−/− islet-like spheroids.

• 181.Using sterile scissors, remove 1–2 mm of the tip of the mouse tail.
• 182.
  To collect blood, gently compress the tail between the thumb and index finger in a proximal to distal movement, repeat this movement until a droplet of blood forms at the tip of the tail.

  • a.
    Collect blood droplets using EDTA-coated capillary tubes.
  • b.
    Collect approximately 10 drops, close the tube, invert it and keep at 4°C.
  • c.
    Centrifuge at 5,000 × g for 10 min at 4°C in a precooled centrifuge.
  • d.
    Transfer the supernatant to a 500 μL tube.
  • e.
    Freeze the samples for later processing or continue directly to perform human C-peptide ELISA.

Note: EDTA-coated capillary tubes are used to avoid coagulation. If drawing blood from several mice, temporarily store the tubes at 4°C after collection.

• 183.Perform human C-peptide ELISA according to the manufacturer’s instructions.

Implantation quality controls 2 and 3

Timing: 12 and 16 weeks after implantation, 6 h fasting + 1 h of measurements

At 12 and 16 weeks after implantation, a combination of glucose tolerance test (GTT) and glucose-stimulated insulin secretion (GSIS) is performed to assess the maturity of the PTPRF^+/+ or PTPRF^−/− β-like cells.

• 184.Fast the mice for 6 h.

Note: During this experiment, the mice are separated into individual cages. This enables an efficient monitoring of the mice and reduces variation due to the coprophagic behavior of the mice during fasting.

• 185.Measure the blood glycemia.
• 186.Collect the blood from the tail as described in Implantation quality control 1.
• 187.Inject 200 μL of glucose solution (2 mg/g of body weight) in pre-warmed DPBS intraperitoneally.
• 188.Measure the glycemia at 7.5-, 15-, 30-, and 60-min after glucose injection.
• 189.Collect blood from the tail vein as described before at 30- and 60-min after glucose injection.
• 190.Perform ELISA to measure the human C-peptide concentration (See Figures 5A and 5B).

CRITICAL: Human C-peptide release in response to glucose is a key marker for β-like cell maturity. The blood glucose levels of mice implanted with the β-like cells gradually decrease from the typical normoglycemic levels in mice (8 mM) to human levels (4 mM) within 3 months, suggesting that the grafted cells can efficiently control the blood glucose levels of implanted mice. Proceed to the next step only once these cells are mature and respond appropriately to the glucose stimulus.

Figure 5.

Characterization of PTPRF^+/+ and PTPRF^−/− H1-hESC-derived β-like cells after implantation

(A) Schematics showing the protocol for studying glucose homeostasis and H1-hESC-derived β-like islet cell function in implanted mice by glucose tolerance test (GTT) and glucose-stimulated insulin secretion (GSIS).

(B) Blood glucose levels and circulating human C-peptide during GTT-GSIS of fasted PTPRF^+/+ and PTPRF^−/− implanted mice pre-STZ treatment at 16 weeks post-implantation (fasted blood glucose levels in the implanted mice decreased to human levels (4 mM) after 16 weeks), representative result of two independent experiments.

Diabetes induction by STZ injection

Timing: When the β-like cells reach maturity, 15 min per mouse

To validate if the implanted PTPRF^+/+ or PTPRF ^−/− β-like cells can replace pancreatic function, endogenous β cells are ablated through STZ injection. The toxic effects of STZ strongly affect rodent β cells, whereas human β cells exhibit a high level of resistance to STZ. Two moderate-dose injections of STZ are used to reduce the toxicity of one high dose and to ensure complete depletion of the endogenous β cells.

Note: One week of recovery time is required between injections to improve mouse survival.

• 191.Measure the body weight and the glycemia of the mice.
• 192.Weigh the necessary amount of STZ for a solution with the final concentration of 30 mg/mL in a 1.5 mL tube.
• 193.Reconstitute STZ with cold 0.1 M citrate buffer to achieve a concentration of 150 μg/g body weight for injection into the mouse, with a final volume of 200 μL.

CRITICAL: The efficacy of STZ decreases drastically over time. The injection must be administered no longer than 5 min after reconstitution. It is recommended to fast the mice for 6 h before STZ administration to reduce competition between STZ and glucose for low-affinity GLUT2 transporters on β cells.

• 194.Inject STZ into the mouse intraperitoneally, into the abdominal cavity.
• 195.Return the mice to their cages with regular food pellets and access to 10% sucrose water.

Note: A moderate dose of STZ can lead to a rapid release of large quantities of insulin due to the sudden destruction of β cells. Consequently, this can lead to fatal hypoglycemia, which can be mitigated by administering 10% sucrose water.

• 196.Monitor the animal’s general health condition and start measuring glycemia and body weight daily.
• 197.After 3 days, replace 10% sucrose water with regular water if the blood glucose level is above 3 mM.
• 198.7 days after the first STZ injection repeat the process (Steps 191–197) and inject STZ a second time.

Nephrectomy of the engrafted kidney

Timing: 1 week after the last STZ injection, 45 min per mouse

If the mice remain normoglycemic after two injections of STZ, the in vitro generated β-like cells maintain normoglycemia. The kidneys with the graft are removed from the mice to validate the effects of the β-like cells and for further experiments.

• 199.Perform the same steps as at the beginning of the implantation operation to externalize the kidney (Steps 148–156).
• 200.Carefully isolate the renal artery, renal vein, and ureter from other tissues and clamp using a pair of bulldog forceps.
• 201.Using absorbable sutures, make a loop around the renal artery, renal vein, and ureter and ligate these structures.
• 202.Ensure a tight knot to prevent bleeding.
• 203.Cut the renal artery, vein, and ureter between the kidney and the knot.
• 204.Place the grafted kidney in a tube containing DPBS and store at 4°C.
• 205.Release the bulldog forceps.
• 206.Follow the same steps for suturing and immediate post-operative care as in the implantation operation (Steps 169–180).
• 207.
  Collect samples of kidney grafts (PTPRF^+/+ and PTPRF^−/−).

  • a.
    Cut a piece of the graft for qPCR and western blotting. Snap-freeze the sample and store it at −80°C.
• 208.Fix the rest of the graft and kidney for immunofluorescence staining with 4% paraformaldehyde for 48 h.
• 209.Follow-up with the mice by measuring body weight and blood glucose levels daily after nephrectomy.
• 210.Euthanize the mouse once diabetes induction is confirmed by three consecutive daily measurements of hyperglycemia or 1-week post-nephrectomy (See Figures 6A–6Q).

Figure 6.

Nephrectomy and analysis of implanted kidney with PTPRF^+/+ and PTPRF^−/− H1-hESC-derived β-like cells

(A–P) Nephrectomy of the kidney implanted with differentiated β-like cells under the kidney capsule. Isolation and positioning the implanted kidney for the nephrectomy procedure (A–C). Kidney fully exteriorized, ready for surgery (D). Hydration of the kidney with DPBS to maintain tissue viability (E). Stabilization of the kidney using forceps (F). Isolation of the renal artery, renal vein, and ureter from other tissues (G). Clamping the renal artery, vein, and ureter with bulldog forceps (H–J). Ligation of the renal artery, vein, and ureter using absorbable sutures (K). Ensuring tight knots to prevent bleeding (L). Cutting the renal artery, vein, and ureter between the kidney and knot (M). Excised kidney showing the implantation site (N). Suturing the abdominal incision post-nephrectomy (O). Final sutures securing the surgical site, ensuring proper closure and promoting healing (P).

(Q) Blood glucose pre- and post-implanted kidney removal in random-fed STZ-induced diabetic mice; normoglycemia in S7-SC-β-like cell spheroid implants was lost upon graft removal, representative result of several independent experiments.

(R) Immunofluorescence image showing insulin-positive (INS+), glucagon-positive (GCG+), and somatostatin-positive (SST+) cells at 20 weeks post-implantation (Scale bar = 100 μm).

Immunostaining of implanted spheroids

Timing: 4 days

Immunostaining of the grafted pancreatic islet-like cell spheroids after nephrectomy serves as a crucial analytical technique for evaluating the success and functionality of implanted cells. This process involves using specific antibodies to detect and visualize cellular markers that indicate the identity, differentiation status, and functional maturity of the β-like cells. Additionally, immunostaining helps assess the integration and survival of the graft within host tissue.

• 211.Process the fixed grafts with a tissue processor (Leica TP120).
• 212.Embed kidney grafts in paraffin blocks, positioning the graft tilted, facing the outer side of the block.
• 213.Using a microtome, cut sections of 7 mm and place them in SuperFrost Plus Adhesion slides. Keep the slides warm for 24 h until the section is fully attached.
• 214.Deparaffinate the sections through 3 xylene washes for 5 min.
• 215.
  Rehydrate the sections through consecutive washes.

  • a.
    2 min with 100% ethanol.
  • b.
    2 min with 90% ethanol.
  • c.
    1 min with 70% ethanol.
  • d.
    30 s with dH₂O.
• 216.Unmask the antigenic sites, placing the slides into Hellendahl staining dish with sodium citrate buffer, and heat in a microwave until boiling. Keep boiling for 10 min.

Note: Fill all the spaces of the Hellendahl dish with slides to avoid the formation of large bubbles during boiling.

• 217.Let the slides cool to 20°C–25°C, remove the sodium citrate buffer, and incubate for 5 min with dH₂O.
• 218.Retrieve a slide from the dH₂O and quickly dry it with paper tissue without touching the samples.

CRITICAL: Avoid sample dehydration throughout the entire process, minimizing the time that the samples are not covered with liquid.

• 219.Circle the slices of tissue with a hydrophobic pen and let it dry for 1 min.
• 220.Wash the samples twice with DPBS for 5 min.
• 221.Incubate with 100–150 μL of DPBS + 0.5% Triton X-100 buffer for 1 min.

Note: Check the circles for leakage of DPBS, circle again with the hydrophobic pen if needed.

• 222.Remove the buffer and block the samples with 100–150 μL of DPBS + 0.5% Tween-20 + 5% milk buffer for 15 min.
• 223.Remove the buffer and block for 45 min with 100–150 μL of DPBS + 0.5% Tween-20 + 5% Normal Donkey Serum buffer in a wet chamber.
• 224.Remove the buffer and incubate with primary antibody solution (insulin/glucagon/somatostatin) for 14–18 h at 4°C in a wet chamber.

Alternatives: Incubation with primary antibody solution can be carried out for 2 h at 20°C–25°C instead.

• 225.Remove the primary antibody solution and wash 3 times with DPBS for 5 min.
• 226.Incubate with secondary antibody solution for 1 h in the dark, at 20°C–25°C in a wet chamber.
• 227.Wash 3 times with DPBS for 5 min.
• 228.Add 1 small drop on top of each sample of Vectashield mounting medium with DAPI and put a microscope coverslip.

Note: It is recommended to add a drop of nail polish on the corners to avoid movement of coverslip, and to remove bubbles that might appear on the sample by softly pushing them away with a micropipette tip.

• 229.Store the slides at 4°C in the dark until microscopy assessment.
• 230.Take pictures with a fluorescent microscope (See Figure 6R).

Expected outcomes

The expected outcome of this protocol is the successful generation of functionally mature hPSC-derived β-like cells with targeted knockouts of PTPs (e.g., PTPRF or PTPRK). Post gene editing, the average distribution of clones is anticipated to be approximately 50% wild-type (PTPRF^+/+ and PTPRK^+/+), 40% heterozygous (PTPRF^+/− and PTPRK^+/−), and 10% knockout (PTPRF^−/− and PTPRK^−/−). Genomic PCR results will be used for preliminary clone selection, followed by Sanger sequencing to confirm genotypes. Wild-type clones should exhibit an intact sequence without any INDELs, whereas knockout clones should have clear sequences identifying the deleted exon. Any small alteration at the cut site in the intronic region can affect exon recognition,³³ and exon skipping can occur, resulting in a non-functional protein. This principle also applies to the wild-type allele of heterozygous clones. Knockout clones must have a clear sequence to properly identify the deleted exon, because INDELs and different cut sites may be present in either of the two alleles. If these errors occur during reassembly by the endogenous DNA repair system, interpretation of the sequencing results may be challenging. RT-qPCR and western blotting analyses will confirm gene expression at the mRNA and protein levels, with wild-type clones showing unaltered expression, heterozygous clones showing half expression, and knockout clones showing no expression. Further quality control checks will include assessment of pluripotency marker expression to ensure suitability for further differentiation and confirmation of chromosomal integrity by karyotyping.

The differentiation of the edited clones into pancreatic islet-like spheroids, using the established 7-stage protocol, should yield a high percentage of insulin-positive cells, which is indicative of effective β-like cell differentiation. Immunofluorescence analysis is expected to show that approximately 30–60% of the spheroid cells are insulin-expressing β-like cells, 1–5% are glucagon-expressing α-like cells, less than 1% are somatostatin-expressing δ-like cells, and 1–5% are polyhormonal cells. In the current protocol, the differentiation efficiency is expected to be similar between wild-type and PTPRF knockout cells, yielding 35% and 38% insulin-positive cells, respectively. Insulin-positive cells can vary among differentiations depending on the efficiency of endocrine progenitor formation. Maintaining high cell viability is necessary throughout differentiation. More than 80% of viable cells should be detected during cell counting at the end of endocrine induction (Stage 4) and β-like cell maturation (Stage 7). Similar cell viability was observed between wild-type and PTPRF knockout cells (≅90% at Stage 7).

In vivo, the implanted pancreatic islet-like cell spheroids should maintain glucose homeostasis in NOD/SCID mice, as evidenced by basal blood levels of human C-peptide and GSIS. Mice should remain normoglycemic even after STZ injection, demonstrating the functional maturity of the β-like cells. Post-implantation analyses could include FACS, single-cell RNA sequencing, or reaggregation experiments to further provide insights into the specific contributions of different cell types within the grafts.

The successful execution of this protocol will not only provide a robust model for studying the roles of PTPs (PTPRF and PTPRK in the current protocol) and other putative genes in β-cell development and related metabolic diseases but also potentially inform targeted gene therapies for diabetes.

Limitations

Gene editing can lead to deleterious effects when the targeted gene is altered or when disrupts key cellular mechanisms. These effects include diminished cell viability, the inability to maintain stem cell pluripotency, and the presence of genetic or chromosomal mutations within the cells. Specific importance should be placed on thoroughly selecting the genomic locus and the gene to be edited.

This protocol was optimized for H1 human embryonic stem cells. Previous studies have demonstrated that different cell lines exhibit varying responses to electroporation and differentiation to β-like cells, resulting in diverse outcomes.

This protocol was performed using the Neon Transfection System. The pulse voltage, pulse width, and number of pulses were tested and optimized using this equipment and cell line. The use of other electroporation machines may be feasible but would require proper adjustments in buffers, electroporation conditions, and the concentration of Cas12a/gRNA RNP complexes. After electroporation, cells must have high cell viability.

After β-like cell differentiation, 30–60% efficiency of insulin-positive β-like cells should be observed. Human embryonic stem cells and human induced pluripotent stem cells are advantageous models for studying the effects of gene deletions on the differentiation process and insulin expression. While β-like cells organized in spheroids can reach functionality, they do not fully resemble human islet cells.

β-like cell differentiation generates insulin-positive cells along with other endocrine cells, differentiating cells, and other cellular types. Therefore, the effects observed in vivo cannot be attributed only to the β-like cells, as the contributions of other cell types should be considered. Further analysis of the cells and/or graft should be performed to determine effects of the different cell types. FACS, single-cell RNA-seq, or reaggregation experiments could provide insights into the effects of cell-type-specific knockout.

Troubleshooting

Problem 1

Low attachment and growth rate of cells. The coating and medium in which stem cells are maintained affect their ability to attach and grow efficiently and may facilitate spontaneous differentiation.

Potential solution

Each cell line may require a distinct method for maintenance and passaging. These guidelines should be available upon purchase of the cell line. H1 stem cells can be maintained in mTeSR Plus or Essential 8 medium. Pre-equilibrating the plates with medium in an incubator before splitting can ameliorate cell recovery.

Problem 2

Low percentage of gene-edited cells after determining the transfection efficiency by PCR in the clone mix. This can be caused by low electroporation efficiency, a low survival rate of cells in which the membrane has been effectively electroporated, or the low viability of cells carrying the knockout allele.

Potential solution

To increase the effectiveness of electroporation, the first approach is to modify the voltage, duration, and number of pulses during electroporation. To increase the viability of electroporated cells, they should be returned to the pre-warmed recovery medium and placed in an incubator as soon as possible. The reduced viability of knockout cells may be caused by alterations of genomic regulatory regions or by off-targets, both of which could affect important genes for cell survival. This can be amended through new exon selection and/or guide design to reduce cell proliferation and viability.

Problem 3

Difficulties determining the cutting site in edited clones. This process can be challenging because the cut site can be different for each allele, and INDELs can appear randomly.

Potential solution

Sometimes, it is necessary to know where the cut is produced and if INDELS have appeared. Using the reverse primer for sequencing can help identify the cut site in the downstream intron of the deleted exon. To check the sequence in heterozygous clones, it is recommended to purify the two bands separately from the agarose gel and sequence the alleles separately.

Problem 4

High number of differentiated cells in stem cell culture. Low confluence at passaging, improper handling of the cells while splitting, and non-methodical maintenance are three common avoidable reasons that causes stress in stem cells, leading to spontaneous differentiation of iPSCs/hESCs. This can be common throughout single-cell clone expansion.

Potential solution

If the percentage of differentiated cells is low, the differentiated cells can disappear after regular splitting. When the percentage of differentiated cells exceeds 25%, splitting using EZ-LiFT is recommended, follow the manufacturer’s instructions. This solution can recover the culture through selective detachment of non-differentiated stem cells.

Problem 5

Synchronize the differentiation start for both genotypes. A gene deletion may impact the attachment and/or proliferation rates of cells, posing challenges to starting differentiation simultaneously.

Potential solution

The crucial step in reducing the differentiation variability among genotypes is to initiate differentiation at the same time and to pass through the differentiation steps synchronously and in the same manner. Adjust the number of cells seeded in the expansion to start differentiation with stem cell cultures during the exponential growth phase. If cells attach differently to the plates, seed accordingly to have the same number of cells at the start of differentiation, this should not affect the outcome. When a severe difference between genotypes is observed, an inducible CRISPR mechanism could be set up to knockout the cells upon differentiation.

Problem 6

Aggregate clumps can form during differentiation stages 5, 6, and 7. The aggregates are not attached to the plate; thus, aggressive pipetting can push them out of the microwells into other wells, where they can merge. This can lead to the formation of aggregate clumps and a decrease in differentiation efficiency.

Potential solution

Medium exchange in the Aggrewell plate requires more precision and stability than in the previous stages. The pipette should be set to release the medium at a low and uniform speed, 30–45 s per Aggrewell is recommended. A gentle, even flowing stream while replacing the medium is required to avoid aggregates overflowing into the well. Always keep the plates horizontal and move them carefully.

Problem 7

There may be difficulties while introducing the spheroids into the PE-50 tubing. Additionally, bubbles can form between the spheroids within the tubing. PE-50 tubing is used to collect the spheroids and implant them in mice because it has the correct size to hold spheroids of up to 1,000 cells and transfer them to the “pocket” under the mouse kidney capsule without damaging it. If the spheroids are larger due to protocol changes or poor maintenance, the tubing might be too narrow to hold the spheroids.

Potential solution

A larger caliber tubing is needed when the spheroids do not enter the tubing or do not form a uniform column. If using a larger caliber tubing, extra precaution is necessary when implanting the spheroids as it is easier to tear the kidney capsule or puncture the kidney.

Problem 8

During nephrectomy, the kidney can attach to other organs, which presents another challenge to the procedure. During kidney healing, scar tissue may cover part of the kidney, and attach to the spleen, muscle, or intestine.

Potential solution

When the kidney heals into other organs, this is usually due to poor hydration during implantation. Ensure that the kidney is always well hydrated when exposed and apply extra DPBS after reintroducing the kidney in its proper position. During nephrectomy, the separation of the kidney from the attached organs must be performed with caution to prevent damage. If excessive bleeding occurs, cauterize the area to stop the bleeding and apply DPBS.

Problem 9

The following day(s) after STZ injection, it is common that the body weight and glycemia levels of the mice decrease below the previous basal levels. STZ is mainly metabolized in the liver, but 20% is metabolized and/or excreted by the kidney. Moderate doses of STZ can cause gastrointestinal problems, hepatotoxicity, and nephrotoxicity. These secondary effects can impede the recovery of mice, complicating their normal hydration and nutrition.

Potential solution

To facilitate recovery, in mice with glycemia below 3 mM, 2 mg of glucose per gram of body weight diluted in 400 μL of pre-warmed DPBS can be injected intraperitoneally. In addition, placing food at the floor level to facilitate food intake can alleviate the strain of STZ injection and promote recovery.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Esteban Gurzov (esteban.gurzov@ulb.be).

Technical contact

Javier Negueruela (javier.negueruela.escudero@ulb.be).

Materials availability

Guide RNAs and oligonucleotide sequences used in this study are found in the Table S1.

Data and code availability

This study did not generate/analyze datasets or code.

Acknowledgments

We thank Madalina Popa, Erick Arroba, and Anne Van Praet (Université libre de Bruxelles) for excellent technical support and the Otonkoski laboratory (University of Helsinki) for their assistance in the development of the protocol. This work was supported by a European Research Council (ERC) Consolidator grant METAPTPs (GA817940) and a JDRF Career Development Award (CDA-2019-758-A-N). V.V. is supported by a Fonds National de la Recherche Scientifique (FNRS) PhD Aspirant scholarship. S.T. is supported by a Fonds National de la Recherche Scientifique (FNRS) Televie grant. E.N.G. is a Research Associate of the FNRS, Belgium. The graphical abstract and schematic figures were created with the aid of BioRender.

Author contributions

All authors contributed to the development and optimization of the protocol and figures. J.N., V.V., and A.D. researched the data. E.N.G. is the guarantor of this work and, as such, has full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Declaration of interests

The authors declare no competing interests.