Skip to main content
BMC Biotechnology logoLink to BMC Biotechnology
. 2024 Sep 18;24:62. doi: 10.1186/s12896-024-00890-1

Anti-inflammatory potential of aspergillus unguis SP51-EGY: TLR4-dependent effects & chemical diversity via Q-TOF LC-HRMS

Soad Nasr 1,2,#, Abdelhameed S Dawood 1,#, Amal Mosad Ibrahim 3, Mohamed S Abdel-Aziz 4, Walid Fayad 5, Anwar Abdelnaser 1,, Faten K Abd EL-Hady 3
PMCID: PMC11411751  PMID: 39294631

Abstract

Inflammation serves as an intricate defense mechanism for tissue repair. However, overactivation of TLR4-mediated inflammation by lipopolysaccharide (LPS) can lead to detrimental outcomes such as sepsis, acute lung injury, and chronic inflammation, often associated with cancer and autoimmune diseases. This study delves into the anti-inflammatory properties of “Aspergillus unguis isolate SP51-EGY” on LPS-stimulated RAW 264.7 macrophages. Through real-time qPCR, we assessed the expression levels of pivotal inflammatory genes, including iNOS, COX-2, TNF-α, and IL-6. Remarkably, our fungal extracts significantly diminished NO production and showed noteworthy reductions in the mRNA expression levels of the aforementioned genes. Furthermore, while Nrf2 is typically associated with modulating inflammatory responses, our findings indicate that the anti-inflammatory effects of our extracts are not Nrf2-dependent. Moreover, the chemical diversity of the potent extract (B Sh F) was elucidated using Q-TOF LC-HRMS, identifying 54 compounds, some of which played vital roles in suppressing inflammation. Most notably, compounds like granisetron, fenofibrate, and umbelliprenin were found to downregulate TNF-α, IL-1β, and IL-6 through the NF-κB signaling pathway. In conclusion, “Aspergillus unguis isolate SP51-EGY”, isolated from the Red Sea, Egypt, has been unveiled as a promising TLR4 inhibitor with significant anti-inflammatory potentials, presenting novel insights for their potential therapeutic use in inflammation.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12896-024-00890-1.

Keywords: Aspergillus unguis SP51-EGY, TLR4, Anti-inflammatory, Macrophages, Q-TOF LC-HRMS

Graphical abstract

graphic file with name 12896_2024_890_Figa_HTML.jpg

Supplementary Information

The online version contains supplementary material available at 10.1186/s12896-024-00890-1.

Introduction

After injury or infection, an innate immune response arises in the body, leading to inflammation. Inflammation is considered a complex defense machinery to repair tissues in the body [1]. The first line of defense to eradicate infections is macrophages. Toll-like receptors (TLRs) signaling pathways are activated by macrophages via lipopolysaccharide (LPS) with TLR4 ligates. This serves as an activating signal which leads to the initiation of intracellular pathways [2]. The first inflammatory response involves the release of prostaglandins, histamine, and nitric oxide (NO) by inducible nitric oxide synthase (iNOS), which results in vasodilation, increased blood flow, and recruitment of leukocytes. Following activation of immune cells, pro-inflammatory cytokines like interleukin-6 (IL-6), interleukin-1 (IL-1), and tumor necrosis factor-alpha (TNF-α) escalate leukocyte permeability in the vascular regions by increasing leukocyte adhesion to endothelial cells. Homeostasis is necessary during inflammation as prolonged inflammation could lead to serious health issues [2, 3]. In addition, the nuclear factor erythroid 2-related factor 2 (Nrf2) is the primary redox homeostasis regulator. Nrf2 plays a crucial role in protecting cells from inflammation and oxidative stress by regulating the expression of phase II detoxification enzymes and oxidative stress response proteins, such as heme oxygenase-1 (HO-1), and oxidative stress-induced growth inhibitor 1 (OSGIN1) [4, 5].

Natural products have been used since the beginning of time for healing applications. Currently, natural products are being used for the treatment of inflammatory diseases. Previously discovered herbal extracts have been shown to have key effects on TLR4 signaling pathways, a significant pathway for a pro-inflammatory response in the body [6]. In addition, natural extracts have been shown to employ their anti-inflammatory effects by regulating the expression of pro-inflammatory cytokines in LPS-induced inflammatory response [7].

Marine-associated fungi have an excellent provenance for secondary metabolites, many of which have diverse biological activities and highly complicated structures, making them hard to provide economically via chemical synthesis [8]. Furthermore, marine microorganisms can be cultured easily, which spreads high reproducibility and is a continual source of natural products [9]. The Aspergillus genus contains more than 300 species that live in a variety of habitats, of which the marine-derived species produce variable structures of secondary metabolites, like alkaloids, phenolics, terpenoids, and peptides with prominent biological effects such as cytotoxic, antimicrobial, and anti-inflammatory activities [10]. However, little is known about the chemical constituents and biological activities of “Aspergillus unguis isolate SP51-EGY” from the Red Sea, except that our previous work reported its antidiabetic effect [11]. Liquid chromatography-high-resolution mass spectrometry (LC-HRMS) is the dominant way to attain pure natural products for structure elucidation and evolution into therapeutic agents. In recent years, LC-HRMS use in natural product chemistry has grown in popularity, allowing for various analytical platforms for non-targeted, targeted, and suspect screening. LC-HRMS provides valuable structural input for detecting and exploring chemical substances identified from natural products [12].

This study aimed to find the highly effective anti-inflammatory fungal extract and to identify its secondary metabolites using LC-HRMS, which plays an essential role in determining accurate masses and is used for comprehensive analysis in both positive and negative ionization modes to identify chemical compositions. This study proved that LC-HRMS is an efficacious and powerful analytical appliance for characterizing most of the identified compounds of “Aspergillus unguis isolate SP51-EGY” from Red Sea, Egypt.

Materials and methods

Materials

The RAW 264.7 cell line was purchased from the American Type Culture Collection (ATCC TIB-71; RRID: CVCL_0493). LPS (Escherichia coli O111:B4) was purchased from Sigma-Aldrich (St. Louis, MO, USA). QIAzol Lysis Reagent and Nuclease-free water were obtained from Qiagen (Hilden, Germany). Dimethyl Sulfoxide (DMSO), Methanol, Chloroform, Isopropanol, and Ethanol were of HPLC grade and were all purchased from SERVA (Heidelberg, Germany). Cyclooxygenase-2 (COX-2) Polyclonal Antibody, Mouse TNF-α, and Mouse IL-6 ELISA Kits were purchased from Elabscience (Wuhan, China). Dulbecco’s Modified Eagle Medium (DMEM), Phosphate Buffered Saline (PBS), Fetal Bovine Serum (FBS), Penicillin-Streptomycin (Pen/Strep), (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT), Griess Reagent Kit, RevertAid First Strand cDNA Synthesis Kit, PowerUp™ SYBR™ Green Master Mix, mRNA primers (iNOS, COX-2, TNF-α, IL-6, COX-2 and GAPDH), Pierce™ BCA Protein Assay Kit, Pierce™ 20X TBS Tween™ 20 Buffer, Blocker™ BSA (10X) in PBS, GAPDH Polyclonal Antibody, Goat Anti-Rabbit IgG (H + L) Secondary Antibody, Horseradish Peroxidase (HRP)-conjugated, and Pierce™ ECL Western Blotting Substrate were all purchased from Thermo Fisher Scientific (Waltham, MA, USA). Cell Lysis Buffer (10X), Protease Inhibitor Cocktail (100X), and Prestained Protein Marker, Broad Range (11–190 kDa) were purchased from Cell Signaling (Danvers, MA, USA). Heme Oxygenase-1 (HO-1), Oxidative Stress-Induced Growth Inhibitor-1 (OSGIN1) mRNA primers were ordered from Synbio Technologies (Monmouth Junction, NJ, USA).

Sponge materials and molecular identification of the fungal isolate

The Sponge (Agelas sp.) was gathered from the coast of Hurghada, Red Sea, Egypt (Shaab al-Ariq latitude, N 27° 25ˊ 08.9˝, E 33° 51ˊ 0.5). Sponge sample was used according to Aboutabl et al. [11]. The fungus was identified as “Aspergillus unguis isolate SP51-EGY”. The sequence has been deposited in GenBank with the name Aspergillus unguis isolate SP51-EGY and accession number KM203831.1 [11].

Screening media and preparation of fungal extracts

For the fungus cultivation, four different broth media (A, B, C, and D) were used. The media were made up of the following components (g/L): Medium A (Sabouraud broth) contains dextrose (20 g/L) and peptone (10 g/L); Medium B (Nutrient broth) contains peptone (5 g/L), beef extract (1 g/L), yeast extract (2 g/L), and sodium chloride (6 g/L); Medium C (Potato dextrose broth) contains dextrose (20 g/L) and potato-infusion (200 g/L); Medium D (Malt extract broth) contains yeast extract (3 g/L) and malt extract (17 g/L). Secondary metabolite ethyl acetate extracts from static and shake conditions were abbreviated as: Sh F (shake filtrate) extract, Sh Cell (shake mycelia) extract, St F (static filtrate) extract, and St Cell (static mycelia) extract.

Cell culture

RAW 264.7 cells were cultured in a 5% CO2 humidified incubator at 37 °C in DMEM supplemented with 10% heat-inactivated FBS and 1% Pen-Strep (100 units/mL penicillin, and 100 µg/mL streptomycin).

Determination of NO production using Griess method

RAW 264.7 cells were cultured in a 96-well plate for 2 h at a seeding density of 1 × 106 cells/mL. The cells were then stimulated with LPS (10 ng/mL) and co-treated with different fungal extracts at concentration of 10 µg/mL for 24 h. The NO production in the cell culture medium was determined using the Griess method through mixing 150 µL of the culture supernatant from each well with 130 µL of deionized water and 20 µL of Griess reagent and incubating for 30 min in the dark at room temperature as previously described [13]. The absorbance was measured at 548 nm using SPECTROstar® Nano microplate reader (BMG LABTECH, Germany). NO concentration in each sample was eventually calculated using a NaNO2 standard curve.

Determination of cytotoxicity using MTT assay

To confirm that the anti-inflammatory effect of the fungal extracts was not a result of cytotoxicity, MTT colorimetric assay was performed. On the 96-well plate containing cultured RAW 264.7 macrophages from the Griess experiment, MTT solution was added (1 mg/mL) for 2 h at 37oC. MTT solution was then discarded and a volume of 100 µL of DMSO was added in order to solubilize the formed formazan crystals. The absorbance was measured at 540 nm using SPECTROstar® Nano microplate reader. Cell viability percentage was then determined relative to the control group.

Isolation of total RNA

RAW 264.7 cells were seeded at a density of 1 × 106 cells/mL in 6-well plates and incubated overnight. The cells were then stimulated with LPS (10 ng/mL) and co-treated with different fungal extracts at concentration of 10 µg/mL for 6 h. Total RNA was extracted from the cells using QiAzol lysis reagent. An amount of 1 µg of RNA from each sample was used to synthesize the cDNA using RevertAid First Strand cDNA Synthesis Kit according to manufacturer’s protocol. cDNA was stored in -20 oC for further use in mRNA expression analysis.

Determination of inflammatory mRNA expression levels using quantitative real-time polymerase chain reaction (qPCR)

The qPCR was used for the determination of inflammatory mRNA expression levels. The cDNA was mixed with forward and reverse primers (Table 1), maxima SYBR green mix, and nuclease free water. The inflammatory genes selected for this experiment are: iNOS, COX-2, TNF-α, and IL-6. All mRNA expression levels were normalized to endogenous control (GAPDH) and the 2−ΔΔCT method was used to evaluate the relative fold mRNA expression levels. The qPCR analysis was performed using ABI Prism 7500 system (Applied Biosystems) under the following conditions: initial holding stage at 95 °C for 10 min, followed by 40 PCR cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. Primer design generation was done using NCBI Primer-Blast tool (Table 1).

Table 1.

mRNA sequences used for qPCR

Target mRNA Primer sequence (5′–3′) Tm
iNOS Forward: GGAACCTACCAGCTCACTCTGG 63
Reverse: TGCTGAAACATTTCCTGTGCTGT 60
COX-2 Forward: CTCACGAAGGAACTCAGCAC 58
Reverse: GGATTGGAACAGCAAGGATTTG 58
TNF-α Forward: GAACTCCAGGCGGTGCCTAT 63
Reverse: TGAGAGGGAGGCCATTTGGG 63
IL-6 Forward: GATGCTACCAAACTGGATATAATCAG 55
Reverse: CTCTGAAGGACTCTGGCTTTG 58
HO-1 Forward: CACAGATGGCGTCACTTCGTC 60
Reverse: GTGAGGACCCACTGGAGGAG 62
OSGIN1 Forward: CGGTGACATCGCCCACTAC 62
Reverse: GCTCGGACTTAGCCCACTC 62
GAPDH Forward: CTTTGTCAAGCTCATTTCCTGG 57
Reverse: TCTTGCTCAGTGTCCTTGC 58

Determination of mRNA expression levels of Nrf2-driven ARE genes HO-1 and OSGIN1 in LPS-stimulated RAW 264.7 macrophages.

The qPCR primers for Nrf2-driven ARE Genes HO-1 and OSGIN1 were used to determine whether the anti-inflammatory activity of the fungal extracts was associated with Nrf2 signaling pathway. The qPCR reactions were subjected to the same thermocycling conditions as the previous experiment. All mRNA expression levels were normalized to endogenous control (GAPDH) and the 2−ΔΔCT method was used to evaluate the relative fold mRNA expression levels.

Quantification of the pro-inflammatory cytokine protein levels using enzyme-linked immunosorbent assay (ELISA)

Protein expression levels of the pro-inflammatory cytokines, TNF-α and IL-6, were quantified by pre-coated ELISA plates (Elabscience®) according to the manufacturer’s protocol. RAW 264.7 cells were seeded in 6-well plates (1 × 106 cells/mL) and incubated overnight. The cells were then stimulated with LPS (10 ng/mL) and co-treated with different fungal extracts at concentration of 10 µg/mL for 24 h. After incubation, the supernatants were collected, centrifuged at 1000× g for 20 min at 4 °C and then transferred to new microcentrifuge tubes to analyze the level of TNF-α and IL-6 proteins secreted into the cell culture medium. The supernatant was diluted in a ratio of 1:100 for TNF-α and 1:20 for IL-6 in buffered sample diluent. The absorbance was measured at 450 nm using SPECTROstar® Nano microplate reader.

Western blotting

Protein expression level of COX-2 was determined using Western blotting. RAW 264.7 cells were seeded in 6-well plates (1 × 106 cells/mL) and incubated overnight. The cells were then stimulated with LPS (10 ng/mL) and co-treated with different fungal extracts at concentration of 10 µg/mL for 24 h. Total proteins were extracted from the cells using cell lysis buffer containing a protease inhibitor cocktail, and the protein concentration was measured using Pierce™ BCA Protein Assay Kit. Western blotting was performed using a standard protocol. Briefly, proteins (10 µg) were separated by 10% SDS-PAGE and transferred to a PVDF membrane. After blocking with 5% non-fat dry milk in TBST for 1 h at room temperature, the membrane was incubated with primary antibodies; anti-COX-2 antibody (1:1000 dilution), and anti-GAPDH antibody (1:2500 dilution) overnight at 4 °C. After washing three times with TBST, the membrane was incubated with HRP-conjugated secondary antibody (1:15000 dilution) for 1 h at room temperature. Protein bands were visualized with Pierce™ ECL Western Blotting Substrate using ChemiDoc MP Imaging System (Bio-Rad Laboratories, CA, USA).

Q-TOF LC-HRMS spectroscopy analysis

For chromatographic separation, a 6530 Q-TOF LC/MS (Agilent Technologies) equipped with an autosampler (G7129A), a Quat. Pump (G7104C), and a Column Comp (G7116A) were used at the Faculty of Pharmacy, Fayoum University. The injection volume was set at 5 L. The analytes were separated on an Agilent Technologies Zorbax RP-18 column (dimensions: 150 mm 3 mm, dp = 2.7 m) at a flow rate of 0.3mL/min. ESI was used to obtain mass spectra in (+) and (-) ionization modes with a capillary voltage of 4500 V. The mass spectra were recorded in the 50–3000 m/z range. The gas temperature and drying gas flow were 200 OC and 8 L/min, respectively. The skimmer and fragmentator voltages were set at 65 and 130 V, respectively, and collision energy was 10 V. The nebulization pressure was 58psig. Elution was with Solvent A (Water 0.1%formic acid) and Solvent B (Acetonitrile 0.1%formic a), the flow rate was 0.3mL/min. Gradient elution started with 2% B, reaches 10% B at 15 min and 20% B at 35 min, 50% B at 60 min, 70% B at 80 min and then 100% B at 100 min.

Statistical analysis

Statistical significance between groups was determined using one-way analysis of variance (ANOVA) followed by Student–Newman–Keuls post hoc test, where P-value < 0.05 was considered statistically significant. The data from three independent experiments are presented as the mean ± standard error of the mean (SE). Comparative analysis between experimental groups was performed using SigmaPlot (Version 14.0; Systat Software, Chicago, IL, USA).

Results and discussion

Determination of NO production in LPS-stimulated RAW 264.7 macrophages

Macrophages play a key role in the innate immune response [14, 15]. LPS, a major component in the cell wall of gram-negative bacteria can induce the production of inflammatory mediators, and is frequently used to evaluate the anti-inflammatory effects of drugs [16]. The production of inflammatory mediators including NO is increased in LPS-stimulated macrophages. NO is a bioactive signaling molecule which has a key role in modulating the inflammatory response [17]. Therefore, the anti-inflammatory effect of the fungal extracts was evaluated using LPS-stimulated RAW 264.7 macrophages. The NO production in the cell culture medium was determined using the Griess method and according to the measured NaNO2 standard curve. It was shown that NO production was significantly increased in the cell culture medium of LPS-stimulated macrophages (19.8 µM) compared to the control (11.2 µM).

As for the extracts in medium (A-D), NO production was significantly reduced in all samples in medium A and C in comparison to LPS-stimulated cells. As for medium B, only Sh F and St Cell extracts significantly reduced NO production, resulting in levels of 12.9 µM and 14.4 µM, respectively, in comparison to LPS-stimulated cells, and for medium D, Sh F and Sh Cell extracts significantly reduced NO production, resulting in levels of 7.2 µM and 6.8 µM, respectively, in comparison to LPS-stimulated cells (Fig. 1). These results validate that some of the fungal extracts have significant effect on reducing NO production in LPS-stimulated RAW 264.7 cells and highlight the potential anti-inflammatory effect on RAW 264.7 cells [18].

Fig. 1.

Fig. 1

Measurement of NO production of extracts found in medium (A-D) on RAW 264.7 macrophages. After treatment of LPS-stimulated RAW 264.7 macrophages (1 × 106 cells/mL) with 10 µg/mL of extracts in medium (A-D) and cultured overnight. NO production in the cell culture medium was measured using the Griess method. LPS-stimulated cells only showed high significance in comparison to control. All extracts in medium A and medium C showed a significant decrease in NO production in comparison to LPS-stimulated cells. However, Sh Cell and St F extracts in medium B and St F and St Cell in medium D did not show any significant decrease in comparison to LPS-stimulated cells. Results are presented as the mean ± SE (n = 3). Statistical significance was calculated by one-way ANOVA followed by Student–Newman–Keuls post-hoc test. $ P < 0.05 vs. control cells. * P < 0.05 vs. LPS-stimulated cells

To ensure that the observed NO reduction was not due to a reduction in cell viability, MTT assay was used to measure the cytotoxicity of RAW 264.7 macrophages after treatment with the extracts (medium A-D). Our results showed that no cytotoxicity was observed at the tested concentrations on the cultured cells. As a result, the reduction in NO production observed in the LPS-stimulated cells after treatment with the extracts was not due to cytotoxicity. The anti-inflammatory effect of these extracts was further experimented on to assess their anti-inflammatory effect using the same concentration (10 µg/mL) of NO production (Fig. 2).

Fig. 2.

Fig. 2

Measurement of cytotoxicity on RAW 264.7 macrophages using MTT assay. After treatment of LPS-stimulated cells with 10 µg/mL of extracts found in medium (A-D) and cultured overnight, cell viability was determined using MTT assay. All extracts in medium (A-D) did not show any cytotoxicity on RAW 264.7 cells. Results are presented as the mean ± SE (n = 3). Statistical significance was calculated by one-way ANOVA followed by Student–Newman–Keuls post-hoc test. $ P < 0.05 vs. control cells. * P < 0.05 vs. LPS-stimulated cells

Determination of mRNA expression levels of the pro-inflammatory markers iNOS, COX-2, TNFα, and IL-6 in LPSstimulated RAW 264.7 macrophages

During inflammation, the immune system triggers the production of pro-inflammatory cytokines (TNF-α, IL-6), as well as enzymes (iNOS, COX-2) [19]. Current research is emphasizing the exploration of bioactive compounds with the capacity to suppress the production of these inflammatory mediators. Natural products are gaining attention as potent and safe anti-inflammatory agents, owing to their capability to modulate gene expression of diverse inflammatory mediators, thus offering promising avenues for therapeutic intervention [20]. Hence, to investigate the anti-inflammatory activities of the fungal extracts, the mRNA expression level of iNOS, COX-2, TNF-α, and IL-6 was determined using qPCR (Fig. 3). Overall, eight samples from the different extraction media, with the highest anti-inflammatory action as evidenced by Griess assay, were selected for further anti-inflammatory studies. The results from qPCR further confirmed our previous results obtained from the Griess analysis. For LPS-stimulated macrophages, significant upregulation was observed for iNOS, COX-2, TNF-α, and IL-6 mRNA levels compared to the control. After treatment with the fungal extracts, the mRNA expression levels were significantly reduced. For the iNOS mRNA expression levels, significant reduction was observed for Sh F and St Cell in medium B, and Sh Cell in medium C (Fig. 3A). As for COX-2 mRNA expression levels, all samples in medium (A-D) showed a highly significant reduction in COX-2 expression in comparison to LPS-stimulated macrophages (Fig. 3B). Furthermore, the following samples showed significant reduction in TNF-α mRNA expression levels: Sh F in medium A, Sh F and St Cell in medium B, Sh Cell in medium C, and Sh F in medium D. However, St F (medium A), St F (medium C) and Sh Cell (medium D) did not show any significant reduction in TNF-α mRNA expression levels (Fig. 3C). Finally, for IL-6 mRNA expression levels, all 8 samples in all extraction medium (medium A-D) showed a highly significant reduction in IL-6 mRNA expression levels in comparison to LPS-stimulated macrophages (Fig. 3D). Our findings are in agreement with the results reported by Anh et al. indicating that nitrogen-containing secondary metabolites from Aspergillus unguis showed anti-inflammatory activity by suppressing the production of NO and the expression of iNOS and IL-6 in LPS-stimulated RAW 264.7 macrophages [21]. In a previous study conducted by Cao et al., it has also been demonstrated that sterols isolated from Aspergillus unguis inhibited the production of inflammatory mediators, including NO and IL-6, along with downregulation of iNOS and IL-6 expressions in LPS-stimulated RAW 264.7 macrophages [22].

Fig. 3.

Fig. 3

Expression levels of iNOS, COX-2, TNF-α, and IL-6 mRNA in LPS-stimulated RAW 264.7 macrophages. Fungal extracts in medium A-D (10 µg/mL) were used for treatment of LPS-stimulated RAW 264.7 macrophages (LPS concentration: 10 ng/mL). The mRNA levels of iNOS, COX-2, TNF-α and IL-6 were measured using qPCR by the comparative method (2−ΔΔCT). Results are presented as the mean ± SE (n = 3). Statistical significance was calculated by one-way ANOVA followed by Student–Newman–Keuls post-hoc test. $ P < 0.05 vs. control cells. * P < 0.05 vs. LPS-stimulated cells

Determination of mRNA expression levels of Nrf2-driven ARE genes HO-1 and OSGIN1 in LPS-stimulated RAW 264.7 macrophages

The Nrf2-antioxidant response element (ARE) signaling pathway, which is recognized as a key regulatory system maintaining the intracellular redox homeostasis, also has a role in reducing inflammation [4]. The Nrf2-ARE activity can be attributed to modulating the expression of antioxidant and detoxifying enzymes, such as HO-1 and OSGIN1 [23, 24]. Additionally, recent studies demonstrated a correlation between the expression of inflammatory mediators, the NF-κB pathway, macrophage metabolism, and the Nrf2/ARE system [25]. To examine whether the inhibitory effect of the selected fungal extracts on LPS-mediated inflammation in RAW 264.7 macrophages was related to activation of the Nrf2-driven genes, the mRNA expression levels of HO-1 and OSGIN1 was analyzed by qPCR. Our data showed no significant upregulation in HO-1 and OSGIN1 mRNA expression between control, LPS-stimulated cells, and treated groups in mediums A-D. This is an indication that both HO-1 and OSGIN1 are not affected by any of the treatments (Fig. 4). These results propose that the anti-inflammatory effects of the fungal extracts are Nrf2-independent.

Fig. 4.

Fig. 4

Expression levels of Nrf2-driven ARE genes, HO-1 (A) and OSGIN1 (B) mRNA in LPS-stimulated RAW 264.7 macrophages. Fungal extracts in medium A-D (10 µg/mL) were used for treatment of LPS-stimulated RAW 264.7 macrophages (LPS concentration: 10 ng/mL). The mRNA levels of HO-1 and OSGIN1 was measured using qPCR by the comparative method (2−ΔΔCT). Results are presented as the mean ± SE (n = 3). Statistical significance was calculated by one-way ANOVA followed by Student–Newman–Keuls post-hoc test. $ P < 0.05 vs. control cells. * P < 0.05 vs. LPS-stimulated cells

Determination of protein levels of the pro-inflammatory cytokines TNFα and IL-6 in LPSstimulated RAW 264.7 macrophages

Cytokines are key signaling proteins, which are produced to regulate the interactions between different cell types involved in the immune response [26]. Cytokines are mainly produced by phagocytic cells and natural killer (NK) cells during innate immune responses, while they are mostly secreted by lymphocytes and antigen-presenting cells (APCs) during adaptive immune responses. Therefore, cytokines coordinate the crosstalk between the innate and adaptive immune systems. Among these, TNF-α and IL-6 are the major pro-inflammatory cytokines involved in the inflammatory response [27, 28]. In the present study, the protein expression levels of the pro-inflammatory cytokines TNF-α and IL-6, were assessed by ELISA. This was to confirm that the anti-inflammatory responses observed on the mRNA level carried through to the protein level. A concentration of 10 ng/mL of LPS significantly increased the pro-inflammatory response of RAW 264.7 macrophages as indicated by the elevated protein levels of the assessed cytokines (Fig. 5). However, at concentration of 10 µg/mL of the selected fungal extracts (Sh F and St Cell in medium B and Sh Cell in medium C), significant reduction was observed in protein levels of the pro-inflammatory cytokines TNFα and IL-6 in LPSstimulated RAW 264.7 macrophages.

Fig. 5.

Fig. 5

Determination of protein levels of the pro-inflammatory cytokines TNF-α and IL-6 in the cell culture medium of the LPS-stimulated RAW 264.7 macrophages using ELISA. The selected fungal extracts (Sh F and St Cell in medium B and Sh Cell in medium C) showed a significant reduction of the LPS-stimulated upregulation of the pro-inflammatory cytokines TNF-α (A) and IL-6 (B). Results are presented as the mean ± SE (n = 3). Statistical significance was calculated by one-way ANOVA followed by Student–Newman–Keuls post-hoc test. $ P < 0.05 vs. control cells. * P < 0.05 vs. LPS-stimulated cells

Determination of protein expression of COX-2 using western blotting

The iNOS induction in relation to COX-2 has been formerly reported in previous studies. In this context, it was shown that selective COX-2 inhibitors reduce COX-2-mediated generation of prostacyclin (PGI2). Moreover, PGI2 was demonstrated to induce iNOS expression, resulting in the production of NO. Thus, it is likely that the fungal extracts might have reduced NO production via a selective inhibition of COX-2 [29]. A concentration of 10 ng/mL of LPS significantly increased the pro-inflammatory response of RAW 264.7 macrophages as indicated by the elevated protein levels of COX-2 (Fig. 6). However, at concentration of 10 µg/mL of the selected fungal extracts (Sh F and St Cell in medium B and Sh Cell in medium C), significant reduction was observed in COX-2 protein levels in LPSstimulated RAW 264.7 macrophages.

Fig. 6.

Fig. 6

Western immunoblots and derived graphical illustration of the protein expression level for COX-2 in selected fungal extracts (Sh F and St Cell in medium B and Sh Cell in medium C). Results are presented as the mean ± SE (n = 2). Statistical significance was calculated by one-way ANOVA followed by Student–Newman–Keuls post-hoc test. $ P < 0.05 vs. control cells. * P < 0.05 vs. LPS-stimulated cells

Q-TOF LC-HRMS spectroscopy analysis

LC-MS coupled with QTOF is a cutting-edge analytical technique for identifying unknown bioactive compounds in natural product extracts. The key to obtaining pure natural products for structure elucidation and development into therapeutic agents is liquid chromatography-high-resolution mass spectrometry (LC-HRMS).

Based on the results of medium B extract (Sh F) represented by its significant anti-inflammatory effects, prompted us to investigate its chemical composition with Q-TOF LC-HRMS spectroscopy analysis. In our study, the chemical composition of a highly bioactive extract (Sh F) from medium B was elucidated using Q-TOF LC-HRMS analysis. All compounds were identified depending on their m/z value from MS spectra in both positive and negative ionization modes ([M + H]+/[M-H], Fig. 7), using an Agilent LC/MS Mass Hunter Qualitative Software for preliminary identification, then confirmed from many other libraries databases (Figs. 8 and 9). In positive and negative ionization modes, Q-TOF LC-HRMS identified a total of 33 and 21 compounds, respectively (Table 2A, 2B).

Fig. 7.

Fig. 7

Total compound chromatogram (TCC) of Q-TOF LC-HRMS analysis of (B Sh F extract) for the fungus “A. unguis isolate SP51-EGY”; A = in positive, B = in negative ionization mode

Fig. 8.

Fig. 8

LC-Q-TOF mass spectrum (ESI+) of peptides and their proposed fragmentation patterns in positive-ion mode. A = Isoleucyl-Alanine, [M + H]+with m/z202) shows product ions with m/z185 by the loss of H2O, which further dissociated to produce a fragment ion at m/z129 and 86 due to elimination of (C3H5O2) ,(C4H6NO3), respectively. B = L-isoleucyl-L-proline[M + H]+with m/z228), started the formation of a fragment ion at m/z210 by the loss of H2O, which further dissociated to produce a fragment ion at m/z86 due to the loss of the(C6H8NO3)

Fig. 9.

Fig. 9

Proposed fragmentation pathways of main fragment ions for Angiotensin IV on the basis Q-TOF LC-MS/MS spectra in positive ionization mode [M + H]+ ions (A) and negative ionization mode [M − H] ions (B). See details produced five characteristic fragment ions at m/z698.3222, at m/z551.2648, at m/z399.2646 at m/z265.1774 and at m/z72.0826 for (A). Moreover, three characteristic fragment ions at m/z432.2448, at m/z221.0835 and at m/z112.9869 were formed for (B)

Table 2.

Characterization of secondary metabolites from “A. Unguis isolate SP51-EGY” fungal extract by Q-TOF LC-HRMS analysis (A = positive, B = negative ionization mode)

Proposed Compounds
[A]
RT
(min)
Molecular Formula Molecular
Weight
(m/z)
Fragment ions Mass Error
(ppm)
Ionization
ESI (+)
Reference
Peptides
1 Isoleucyl-Alanine 23.528 C9 H18 N2 O3 202.1323 185.1284, 156.9625, 86.0971 -0.57 [M-H2O + H]+ [48]
2 L-isoleucyl-L-proline 27.265 C11 H20 N2 O3 228.1483 211.1450, 183.0928 -0.9 [M-H2O + H]+ HMDB0011174
3 L-phenylalanyl-L-proline 31.723 C14 H18 N2 O3 262.1327 245.1293, 217.1071 -0.92 [M-H2O + H]+ HMDB0011177
4 L-prolyl-L-phenylalanine 33.901 C14 H18 N2 O3 262.1329 245.1295, 217.1013, 70.0663, 60.0840 -1.12 [M-H2O + H]+ HMDB0011179
5

Angiotensin IV

[H-Val-Tyr-Ile-His-Pro-Phe-OH]

53.456 C40 H54 N8 O8 774.4077 775.4149, 676.3474, 497.2835, 399.2646, 265.1774, 236.1617, 72.0820 -1.58 [M + H]+ [48]
6 Histidinyl-Cysteine 100.8 C9 H14 N4 O3 S 258.0784 241.0754, 223.0647 0.99 [M-H2O + H]+ [48]
7 Cysteinyl-Histidine 101.92 C9 H14 N4 O3 S 258.0785 241.0754,223.0647 0.47 [M-H2O + H]+

HMDB0028777

[48]

Fatty acids
8 (2E,4E)-2,7-Dimethyl-2,4-octadienedioic acid 44.577 C10 H14 O4 198.0896 181.0863, 156.1209, 129.0530, 115.9653, 95.9737, -1.93, [M-H2O + H]+ [48]
9 Methyl 18,18-dibromo-9E,17 -octadecadien-5,7-diynoate 88.605 C19 H24 Br2 O2 442.0157 443.0238, 425.2169, 352.3414, -3.22 [M + H]+ (CFM-ID)
10 8,12-octadecadienoic acid 89.069 C18 H32 O2 280.2422 280.2654, 263.2383, 95.0864 -6.97 [M-H2O + NH4]+ [49]
11 Butyl butyrate 93.044 C8 H16 O2 144.1161 145.1229, 127.1128 -7.1 [M-H2O + H]+ [48]
12 Valproic acid 94.929 C8 H16 O2 144.1161 127.1129, -1.1 [M-H2O + H]+ [50]
Amides
13 Palmitic amide 92.832 C16 H33 N O 255.2579 256.2615, 124.0879 -6.11 [M + H]+ [48]
14 Oleamide 94.533 C18 H35 NO 281.2736 282.2808, 127.1128 -1.75 [M + H]+ [49]
15 N-oleoyl alanine 95.485 C21 H39 N O3 353.2946 352.3416, 336.2913, 282.2807, 127.1128 -4.53 [M-H2O + H]+ [49]
16 Sphingosine 95.547 C18 H37 N O2 299.2837 282.2807, 124.0879 -4.34 [M-H2O + H]+ MassBank of Japan (https://www.mssj.jp/), HMDB0000252
17 D-erythro-Sphingosine C-20 100.6 C20 H41 N O2 327.3154 352.3413, 310.3121, 309.3143, 284.2964, -5.16 [M-H2O + H]+ (CFM-ID)
18 Stearamide 100.9 C18 H37 N O 283.2891 284.2965, 223.0648, 124.0877, 116.1076 -5.73 [M + H]+ [48]
19 Anandamide (20:l, n-9) 101.57 C22 H43 NO2 353.3311 336.3268, 317.3032, 223.0646,100.0765 -4.87 [M-H2O + H]+

HMDB0031678

[48]

20 Stearoylethanolamide 101.61 C20 H41 N O2 327.315 310.3121, 284.2964, 124.0878 -3.85 [M-H2O + H]+ [48]
Triglycerides
21 MG(16:0/0:0/0:0) 95.338 C19 H38 O4 330.2785 353.2683, 331.2892, 313.2755 -4.49 [2 M + Na]+ HMDB0011533 (CFM-ID)
22 2-(14,15-Epoxyeicosat-rienoyl) Glycerol 102.5 C23 H38 O5 394.2735 352.3412, 285.0956, 223.0674 -3.87 [M-H2O + H]+ [48]
23 Triricinolein (triglyceride) 137.45 C57 H104 O9 932.7694 951.7786, 933.7768, 657.5075, 519.1396, 321.2411, 285.0956 -1.44 [M + NH4]+ [48]
Others
24

Lyciumoside IV

[acyclic diterpene glycoside]

55.225 C38 H64 O16 776.4243 759.4209, 380.2147, 315.1830 -6.29 [M-H2O + H]+

HMDB0033499

[48]

25 Hydroxy ibuprofen 62.635 C13 H18 O3 222.1267 227.1053, 205.1232, 187.1127, 157.0480 -4.8 [M-H2O + Na]+ [48]
26 trans-Resveratrol 68.579 C14 H12 O3 228.0797 233.0583, 211.0765, 197.9894, 185.0427 -4.63 [M-H2O + Na]+ [48]
27 Eszopiclone 80.271 C17 H17 Cl N6 O3 388.1059 411.0957, 389.1132, 371.1047, 352.3411, 129.0533 -2.27 [M + Na]+ [48]
28 Zopiclone 82.176 C17 H17 Cl N6 O3 388.1058 411.0954, 389.1133, 371.1094, 352.3410, 129.0532 -1.8 [M + Na]+ [48]
29 Methenolone 89.075 C20 H30 O2 302.2237 302.2472, 167.0564 0.87 [M-H2O + NH4]+

HMDB0041928

[48]

30 2,4,6-Triethyl-1,3,5-trithiane 101.92 C9 H18 S3 222.0574 223.0647, 124.0877 -0.36 [M + H]+ [48]
31 Rifamycin O 125.81 C39 H47 N O14 753.2991 772.2763, 667.1737, 519.1405, 223.0647 0.78 [M-H2O + K]+ (CFM-ID)
32 Uroporphyrin I 139.85 C40 H38 N4 O16 830.2347 848.2731, 832.2411, 758,2226 -7.73 [M + NH4]+ [48]
33 Vitisifuran A 150.31 C56 H40 O12 904.252 124.0877 0.02 [M + NH4]+

HMDB0034785

[48]

Proposed Compounds

[B]

RT

(min)

Molecular Formula

Molecular

Weight

( m/z )

Fragment ions

Mass Error

(ppm)

Ionization

ESI (-)

Reference
Peptides
1 5-Methoxy-DL-tryptophan 33.421 C12 H14 N2 O3 234.1019 215.0841, 112.9868 -6.04 [M-H2O-H] [48]
2 Angiotensin IV 53.428 C40 H54 N8 O8 774.4093 433.256, 221.129, 114.056 -3.67 [M + HCOO] Manually confirmed
3 Se- Adenosylseleno-homo- cysteine 84.53 C14 H20 N6 O5 Se 426.0666 407.0482 ,248.9631 5.41 [M-H2O-H]

HMDB0011117

[48]

Fatty acids
4 Isopropyl 3-(3,4-dihydroxy phenyl)-2-hydroxypropanoate 43.097 C12 H16 O5 240.1013 221.0835, 112.9868 -6.51 [M-H2O-H] [48]
5 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid 44.172 C12 H16 O5 240.1014 238.9334, 221.0836 -6.86 [M-H2O-H]

HMDB0061112

[48]

6 (2E,4E)-2,7-Dimethyl-2,4-octadienedioic acid 44.529 C10 H14 O4 198.0907 198.0907,179.0728 -7.66 [M-H2O-H]

HMDB0034099

[48]

7 18,18-dibromo-9E,17-octadecadien-5,7-diynoic acid 77.759 C18 H24 Br2 O2 428 426.9936, 248.9628 -3.18 [M-H] (CFM-ID)
8 9R,10 S-dihydroxy-stearic acid 95.305 C18 H36 O4 316.2636 316.2636, 112.9869 -2.2 [M + CH3COO]-

HMDB0302281

[49]

Triglyceride
9 MG(0:0/18:0/0:0) [monoglyceride] 101.66 C21 H42 O4 358.3105 403.3084,358.3105 -5.98 [M + HCOO]

[48]

HMDB0011535

10 Triricinolein (triglyceride) 137.32 C57 H104 O9 932.772 ,297.2455, -4.24 [M + HCOO]

HMDB0038061

[48]

Halogenated, phenolic compounds and glycosides
11 5-Hydroxythalidomide 60.829 C13 H10 N2 O5 274.0607 255.0447, -1.71 [M-H2O-H]

HMDB0013871

[48]

12 Granisetron 63.003 C18 H24 N4 O 312.1955 293.1776 -1.69 [M-H2O-H] [48]
13 Sulfasalazine 67.065 C18 H14 N4 O5 S 398.0692 398.0692,371.1158 -0.71 [M + HCOO -H2O]

HMDB0014933

[49]

14 Fenofibric acid 68.719 C17 H15 Cl O4 318.0679 359.0714, -6.4 [M + CH3COO - H2O]

HMDB0252207

MassBank of Japan (https://www.mssj.jp/)

15 Umbelliprenin [coumarin] 72.239 C24 H30 O3 366.2186 383.1782, 347.2017, 248.9632, 112.9868 2.49 [M + Cl -H2O] [48]
16

Alpha-CEHC

(alpha-Carboxyethylhydroxy-chroman)

74.282 C16 H22 O4 278.1537 277.1464, 248.6929 -6.31 [M-H] [48]
17 4-Dodecylbenzenesulfonic acid 82.422 C18 H30 O3 S 326.1936 325.1863, 293.1811, -6.24 [M-H] [49]
18 Nafcillin 82.982 C21 H22 N2 O5 S 414.1253 459.1240, 415.0301, 325.1864, -0.36 [M + HCOO] [48]
19 Persicachrome 95.311 C25 H36 O3 384.2641 384.2641,365.2487 2.31 [M-H2O-H]

HMDB0036425

[48]

20 Lyciumoside IV, [acyclic diterpene glycoside] 55.207 C38 H64 O16 776.4251 803.4128,776.4251 -7.3 [M + HCOO-H2O]

HMDB0033499

[49]

21 Piceid (Resveratrol glycoside) 66.684 C20 H22 O8 390.1336 390.1336, 371.1158 -5.53 [M-H2O-H]

HMDB0031422

[48]

Q-TOF LC-HRMS analysis [positive ionization mode

According to our findings, the positive ionization mode was primarily characterized by the identified ions of peptides, fatty acids, amides, triglycerides, and others.

Peptides

The application of Q-TOF-MS/MS enabled the discovery of seven potentially bioactive peptides, including two isoleucyl-containing peptides, two phenylalanyl-containing peptides, two Histidinyl-Cysteine isomers, and the polypeptide “Angiotensin IV.” Their retention times (RT) were at 23.528, 27.265, 31.723, 33.901, 100.8, 101.92 and 53.456 min, respectively, and with molecular weights: 202.1323, 228.1483, 262.1327, 262.1329, 258.0784, 258.0785 and 774.4077 m/z, respectively. The Q-TOF-MS/MS product ions of these peptides are given in (Table 2A).

Structural fragmentation study of peptides

For isoleucyl-alanine and L-isoleucyl-L-proline; the complementary ions produced by the cleavage of the amino-alkyl group’s carbonyl C-C bond result in the characteristic fragment ion protonated “2-methylbutan-1-amine” with 86 m/z (C5H12N), Fig. 8).

Angiotensin IV has the molecular formula C40 H54 N8 O8. The positive and negative ion modes of its precursor [M + H]+ and [M-H] ions have m/z 775.4149 and 773.4022, respectively, with (RT) 53.456 and 53.428 min (Table 2A, 2B). The protonated and deprotonated angiotensin IV characteristic fragment ions were observed and identified in Fig. (9 A, 9B) (10 A, 10B).

Fig. 10.

Fig. 10

Comparison of the fragmentation pattern of the MS/MS spectrum demonstrated that (A) Protonated Angiotensin IV molecule give more informative and more intense peaks than do (B) deprotonated Angiotensin IV molecule

The MS/MS spectrum in positive ionization mode shows three distinct pathways for fragmentation.

  • Pathway1: producing the characteristic product ion at the m/z 399.2646 [M + H − C20H30N3O4]+.

  • Pathway 2: showing fragments ions at m/z 265.1774 [M + H − C26H35N6O5]+, m/z 72.0826 [m/z 265.1774(C14H19N2O3) - C10H10NO3]+.

  • Pathway 3: showing fragments ions at m/z 698.3222 [M + H − C6H5]+and at 551.2648 [698.3222(C34H49N8O8)- C4H9- C6H5O] +.

The data from the MS3 spectrum of Angiotensin IV could further confirm this conclusion (Figs. 10A and 9A, Table 2A). On the other hand, Angiotensin IV fragmentation in the negative ionization mode is followed by two pathways (Fig. 9B). Due to the loss of [M-H-C27H35N6O6-CH3], its characteristic minor fragment ion was observed at 221.0835 m/z in the first fragmentation pathway. Second fragmentation pathway: further fragmentation of precursor ion resulted in daughter ions at 432.2448 m/z due to loss of [M-H- C6H5O-C3H7-C10H10NO3-H2N] and 112.9869 m/z due the loss of [(C16H26N5O2)] from the fragment 432.2448[ (C21H34N6O4)] (Figs. 10B and 9B, Table 2B). The dissociation pattern of protonated Angiotensin IV [M + H]+molecule consists essentially of five peaks in positive mode and three peaks in deprotonated Angiotensin IV [M-H] molecule in Negative mode. (Figure 9A and B). Protonated Angiotensin IV molecules produce more informative and intense peaks than deprotonated Angiotensin IV molecules (Fig. 9A and B, Table 2A, 2B).

Bioactive peptides have been shown to have anti-inflammatory effect in macrophages by inhibiting the NO/iNOS and PGE2/COX-2 pathways while suppressing the production of pro-inflammatory cytokines such IL-1β and TNF-α [30]. When THP-1 cells were stimulated with TNF-α, Cysteine and Histidine reduced NF-κB activity [31]. It was confirmed that the polypeptide “Angiotensin IV” repressed inflammation in the brains of rats with chronic cerebral hypoperfusion (CCH), as it significantly reduced the levels of TNF-α, IL-1β, IL-6 and IL-12 in the brains of rats with CCH (CCH) [32].

Fatty acids

The use of Q-TOF-MS/MS allowed the identification of potential bioactive polyunsaturated fatty acids ; (2E,4E)-2,7-Dimethyl-2,4-octadienedioic acid, at m/z 198.0896 [M + H]+ (C10 H14 O4) (Rt 44.577 min), DB Diff. (-1.93); Methyl-18,18-dibromo-9E,17-octadecadien-5,7-diynoate, at m/z 442.0157 [M + H]+ (C19 H24 Br2 O2) (Rt 88.605 min) DB Diff. (-3.22); 8,12-Octadecadienoic acid at m/z 280.2422 [M + H]+ (C18 H32 O2) (Rt 89.069 min) DB Diff. (-6.97), in addition to Valproic acid at m/z 144.1161 [M + H]+ (C8 H16 O2) (Rt 94.533 min) DB Diff. (-1.75) (Table 2A).

In-vitro, saturated fatty acids (SFAs) were found to directly stimulate inflammatory gene expression via TLR4 signaling. The relative potency of various (SFAs) varied with chain length, with lauric acid (12:0) having the highest activity, whereas myristic acid (14:0) and stearic acid (18:0) having surprisingly little pro-inflammatory activity. Unlike SFAs, monounsaturated- fatty acids (MUFAs) and polyunsaturated fatty acids (PUFAs) did not activate TLR4 signaling. These researchers were able to demonstrate that pretreatment of cells for 3 h with a variety of PUFAs or oleic acid (18:1) significantly reduced the subsequent pro-inflammatory effect of lauric acid treatment. They went on to demonstrate that PUFAs’ ability to inhibit inflammatory responses induced by LPS or lauric acid was dependent on TLR4 [33]. Valproic acid (VPA) inhibits the CD45highF4/80low macrophage subset as well as the production of pro-inflammatory cytokines/chemokines such as CXCL1, IL-5, IL-6, and IL-10. (VPA) specifically decreased tissue NF-кB2 p100 protein [34].

Amides

In Q-TOF LC-HRMS positive ionization mode analysis, eight amides were identified (Table 2A).

Anti-inflammatory activity has previously been reported for oleamide and anandamide (20:l, n-9).

The identified constituents were found at m/z 281.2736 [M + H]+ (C18 H35 NO) (Rt 94.533 min) DB Diff. (-1.75) and at m/z 353.3311[M + H]+ (C22 H43 NO2) (Rt 101.57 min) DB Diff. (-1.72), respectively.

Fatty acid amides, played critical roles in inflammation suppression [35]. Oleamide suppressed LPS-induced iNOS and COX-2 mRNA in RAW 264.7 cells, as well as inflammatory cytokines; TNF-α, IL-1β and IL-6 [36]. Anandamide inhibited NO and IL-6 release by LPS-stimulated J774 macrophages, as well as IL-12 and IL-23 production and increased IL-10 production by activated microglia via JNK and ERK1/2 activation and NF-κB [37].

Other compounds

In addition; ten other compounds were identified, three of which were previously reported to have anti-inflammatory effect; Hydroxy-ibuprofen, at m/z 222.1267 [M + H]+ (C13 H18 O3) (Rt 62.635 min) DB Diff. (-1.07), Resveratrol at m/z 228.0797 [M + H]+ (C14 H12 O3) (Rt 68.579 min) DB Diff. (-1.06) and Rifamycin-O at m/z 753.2991 [M + H]+ (C39 H47 N O14) (Rt 125.81 min) DB Diff. (0.59) (Table 2A).

Hydroxy Ibuprofen is an Ibuprofen metabolite. Ibuprofen is an anti-inflammatory agent with IC50s of 13 M and 370 M for COX-1 and COX-2, respectively [38]. Resveratrol was a potent inhibitor of the NO and cytokine release in activated macrophages and microglia [39]. Rifamycin-O also antagonized TNF-α and LPS-induced NF-κB activities and inhibited IL1β-induced synthesis of inflammatory chemokine, IL8 [40].

Q-TOF LC-HRMS analysis [negative ionization mode

Furthermore, negative ionization mode was mainly characterized by the identification of fatty acids, phenolic and glycoside compounds (Table 2B).

Peptides

Two peptides were only identified in negative ionization mode: Angiotensin IV and Se-Adenosylseleno-homocysteine. In addition, the amino acid; 5-methoxy-DL-Tryptophan with Rt (33.421 min), M Wt. (m/z 234.1019, C12 H14 N2 O3), DB Diff. (-6.04) was identified (Table 2B). 5-methoxy-DL-Tryptophan reduces LPS-induced expression of COX-2, TNF-α, IL-1β, and IL-6 in RAW 264.7 macrophages [41].

Fatty acids

Five fatty acids were identified, one of which was Isopropyl-3-(3,4-dihydroxyphenyl)-2-hydroxypropanoate (IDHP); with Rt (43.097 min), M Wt. (m/z 240.1013, C12 H16 O5), DB Diff. (-6.51) (Table 2B). (IDHP) drastically reduced NO, TNF-α, and IL-1β production in LPS-induced BV-2 cells and rat primary microglia. IDHP also suppressed LPS-induced iNOS, TNF-α, and IL-1β mRNA expression [42].

Halogenated, phenolic compounds and glycosides

Furthermore, eleven compounds were identified in negative ionization mode, from which the followings : Granisetron, Rt (63.003 min), M Wt.( m/z 312.1955, C18 H24 N4 O), DB Diff. (-1.69), Fenofibric acid, Rt (68.719 min), MWt.(m/z 318.0679, C17H15ClO4), DB Diff. (-6.4), Umbelliprenin, Rt (72.239 min), M Wt.( m/z 366.2186, C24 H30 O3), DB Diff. (2.49), Alpha-CEHC, Rt ( 74.282 min), M Wt.( m/z 278.1537, C16 H22 O4), DB Diff. (-6.31) and Piceid, Rt (66.684 min), M Wt.( m/z 390.1336, C20 H22 O8), DB Diff. (-5.53) (Table 2B), were previously reported to have anti-inflammatory activity.

The amide “Granisetron” significantly reduced TNF-a, IL-6, HMGB1, and NF-kB. It also reduced the expression of the receptor for advanced glycation end, TLR4, in liver tissue, as well as pyroptosis, by decreasing NLRP3, IL-1β, and caspase-1 [43]. Fenofibrate decreases the expression and secretion of TNF-α, IL-1β, and IL-6 via the NF-κB signaling pathway, making them therapeutic targets for attenuating inflammation in hepatic pathological progression [44].

Umbelliprenin (UMB), a natural sesquiterpene coumarin, may reduce inflammation by lowering IL-17 levels in the blood. UMB exerts its anti-inflammatory effects by modulating distinct cytokine release/inhibition types [45]. Alpha-CEHC is a vitamin E derivative that reduces LPS-induced gene expression of TNF-α, IL-1β, IL-6, and iNOS. While high concentrations increased gene expression in peritoneal macrophages [46]. Studies in rat models have indicated that vitamin E exhibits anti-inflammatory properties by suppressing IL-1 and IL-6. Vitamin E has also been shown to inhibit COX-2, the enzyme involved in inflammatory reactions [47]. Piceid is a Resveratrol glycoside: Resveratrol inhibited NO and cytokine release in activated macrophages and microglia [39].

Conclusions

The intricate interplay of TLR4 in immune responses underscores its dual role as both protector and potential provocateur. Malfunctioning TLR4 signaling can inadvertently amplify immune responses, thereby inducing conditions like sepsis, acute lung injury, and pathological chronic inflammation, often linked to cancer and autoimmune maladies. Central to this inflammatory response is the production of NO by iNOS, which triggers the subsequent activation TNF-α, and IL-6. Notably, this study delved into the potential Nrf2-dependency of the anti-inflammatory properties of “Aspergillus unguis isolate SP51-EGY” extracts, revealing their effects to be independent of Nrf2 modulation. A significant modulation in the expression of inflammatory markers, such as iNOS, COX-2, TNF-α, and IL-6 was observed using real-time qPCR. The extract labeled (B Sh F) was particularly potent in this regard. Further chemical profiling of this extract via Q-TOF LC-HRMS unveiled a rich tapestry of 54 bioactive compounds, with several playing pivotal roles in inflammation suppression. Key compounds such as granisetron, fenofibrate, and umbelliprenin were shown to attenuate inflammatory pathways, particularly the NF-κB signaling cascade. Marine-associated fungi, like the “Aspergillus unguis isolate SP51-EGY” from the Red Sea, have emerged as bounteous reservoirs of secondary metabolites, displaying diverse biological activities and intricate structures. This study not only underscores the potential of LC-HRMS as a formidable analytical tool but also highlights the pressing need for further research into the bioaccessibility, bioavailability, and toxicological profiles of these fungal extracts. Future endeavors should also encompass animal model studies, paving the way for the potential therapeutic commercialization of these promising extracts.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (1,000.2KB, docx)

Acknowledgements

Not applicable.

Abbreviations

COX-2

Cyclooxygenase-2

ELISA

Enzyme-linked immunosorbent assay

HO-1

Heme oxygenase 1

iNOS

Inducible nitric oxide synthase

IL-1

Interleukin-1

IL-6

Interleukin-6

LPS

Lipopolysaccharide

LC-HRMS

Liquid chromatography-high-resolution mass spectrometry

NO

Nitric oxide

Nrf2

Nuclear factor erythroid 2–related factor 2

NF-κB

Nuclear factor-kappa B

OSGIN1

Oxidative stress induced growth inhibitor 1

PUFAs

Polyunsaturated fatty acids

qPCR

Quantitative real-time polymerase chain reaction

TLRs

Toll-Like Receptors

TNF-α

Tumor necrosis factor alpha

UMB

Umbelliprenin

Author contributions

S.N., A.S.D., A.M.I., M.S.A., W.F., A.A., and F.K.A.E. contributed to the study conception and design. Material preparation, data collection, and analysis were performed by S.N. and A.S.D. LC/MS/MS part is interpreted, discussed, and written by F.K.A.E. and A.M.I. S.N., and A.S.D. wrote the first draft of the manuscript, and all authors commented on previous versions. S.N., A.S.D., A.M.I., M.S.A., W.F., A.A., and F.K.A.E. read and approved the final manuscript.

Funding

This work was financially supported by a Bartlett Fund for Critical Challenges, an ASRT grant to A.A., and the bilateral projects within the Executive Program of Scientific and Technological Cooperation between the Arab Republic of Egypt and the Italian Republic under Project No. [A2-12-15] to F.K.A.E.

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

The raw data supporting the conclusions of this article will be made available by the authors, without unjustified reservation.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Soad Nasr and Abdelhameed S. Dawood contributed equally to this work and share first authorship.

References

  • 1.Chen L, Deng H, Cui H, Fang J, Zuo Z, Deng J, et al. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget. 2017;9(6):7204–18. 10.18632/oncotarget.23208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Saleh HA, Yousef MH, Abdelnaser A. The anti-inflammatory properties of Phytochemicals and their effects on epigenetic mechanisms involved in TLR4/NF-κB-Mediated inflammation. Front Immunol. 2021;12. 10.3389/fimmu.2021.606069. https://www.frontiersin.org/articles/. [DOI] [PMC free article] [PubMed]
  • 3.Newton K, Dixit VM. Signaling in Innate immunity and inflammation. Cold Spring Harb Perspect Biol. 2012;4(3):a006049. 10.1101/cshperspect.a006049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mohan S, Gupta D. Crosstalk of toll-like receptors signaling and Nrf2 pathway for regulation of inflammation. Biomed Pharmacother. 2018;108:1866–78. 10.1016/j.biopha.2018.10.019. [DOI] [PubMed] [Google Scholar]
  • 5.Sukkar MB, Harris J. Potential impact of oxidative stress induced growth inhibitor 1 (OSGIN1) on airway epithelial cell autophagy in chronic obstructive pulmonary disease (COPD). J Thorac Disease. 2017;9(12):4825–7. 10.21037/jtd.2017.10.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Schink A, Neumann J, Leifke AL, Ziegler K, Fröhlich-Nowoisky J, Cremer C, et al. Screening of herbal extracts for TLR2- and TLR4-dependent anti-inflammatory effects. PLoS ONE. 2018;13(10):e0203907. 10.1371/journal.pone.0203907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Tasneem S, Liu B, Li B, Choudhary MI, Wang W. Molecular pharmacology of inflammation: Medicinal plants as anti-inflammatory agents. Pharmacol Res. 2019;139:126–40. 10.1016/j.phrs.2018.11.001. [DOI] [PubMed] [Google Scholar]
  • 8.Wu B, Wiese J, Labes A, Kramer A, Schmaljohann R, Imhoff JF. Lindgomycin, an unusual antibiotic polyketide from a Marine Fungus of the Lindgomycetaceae. Mar Drugs. 2015;13(8):4617–32. 10.3390/md13084617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Youssef FS, Ashour ML, Singab ANB, Wink M. A comprehensive review of bioactive peptides from Marine Fungi and their biological significance. Mar Drugs. 2019;17(10):559. 10.3390/md17100559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Razzaghi-Abyaneh M, Rai M, Razzaghi-Abyaneh M, Rai M. The genus aspergillus - pathogenicity, mycotoxin production and industrial applications. 2022. 10.5772/intechopen.94793. [Accessed 3rd February 2023].
  • 11.Aboutabl ME, Maklad YA, Abdel-Aziz MS, El-Hady FKA. In vitro and in vivo studies of the antidiabetic potential of Red Sea sponge-associated fungus aspergillus unguis isolate SP51-EGY with correlations to its chemical composition. J Appl Pharm Sci. 2022;12,(8):165–78. 10.7324/JAPS.2022.120817. [Google Scholar]
  • 12.Aydoğan C. Recent advances and applications in LC-HRMS for food and plant natural products: a critical review. Anal Bioanal Chem. 2020;412(9):1973–91. 10.1007/s00216-019-02328-6. [DOI] [PubMed] [Google Scholar]
  • 13.Dawood AS, Sedeek MS, Farag MA, Abdelnaser A. Terfezia boudieri and terfezia claveryi inhibit the LPS/IFN-γ-mediated inflammation in RAW 264.7 macrophages through an Nrf2-independent mechanism. Sci Rep. 2023;13(1):10106. 10.1038/s41598-023-35612-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wynn TA, Chawla A, Pollard JW. Macrophage biology in development, homeostasis and disease. Nature. 2013;496(7446):445–55. 10.1038/nature12034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Watanabe S, Alexander M, Misharin AV, Budinger GRS. The role of macrophages in the resolution of inflammation. J Clin Investig. 129(7): 2619–28. 10.1172/JCI124615 [DOI] [PMC free article] [PubMed]
  • 16.Kwon DH, Cha HJ, Choi EO, Leem SH, Kim GY, Moon SK, et al. Schisandrin A suppresses lipopolysaccharide-induced inflammation and oxidative stress in RAW 264.7 macrophages by suppressing the NF-κB, MAPKs and PI3K/Akt pathways and activating Nrf2/HO-1 signaling. Int J Mol Med. 2018;41(1):264–74. 10.3892/ijmm.2017.3209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Joo T, Sowndhararajan K, Hong S, Lee J, Park SY, Kim S, et al. Inhibition of nitric oxide production in LPS-stimulated RAW 264.7 cells by stem bark of Ulmus pumila L. Saudi J Biol Sci. 2014;21(5):427–35. 10.1016/j.sjbs.2014.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Xu J, Yi M, Ding L, He S. A review of anti-inflammatory compounds from Marine Fungi, 2000–2018. Mar Drugs. 2019;17(11):636. 10.3390/md17110636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Nguyen TQC, Duy Binh T, Pham TLA, Nguyen YDH, Thi Xuan Trang D, Nguyen TT, et al. Anti-inflammatory effects of Lasia spinosa Leaf Extract in Lipopolysaccharide-Induced RAW 264.7 macrophages. Int J Mol Sci. 2020;21(10):3439. 10.3390/ijms21103439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Elsayed EA, El Enshasy H, Wadaan MAM, Aziz R, Mushrooms. A potential natural source of anti-inflammatory compounds for medical applications. Mediat Inflamm. 2014;2014:e805841. 10.1155/2014/805841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Anh CV, Yoon YD, Kang JS, Lee HS, Heo CS, Shin HJ. Nitrogen-Containing secondary metabolites from a deep-sea fungus aspergillus unguis and their anti-inflammatory activity. Mar Drugs. 2022;20(3):217. 10.3390/md20030217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Cao VA, Kwon JH, Kang JS, Lee HS, Heo CS, Shin HJ. Aspersterols A–D, ergostane-type sterols with an unusual Unsaturated Side Chain from the Deep-Sea-Derived Fungus Aspergillus Unguis. J Nat Prod. 2022;85(9):2177–83. 10.1021/acs.jnatprod.2c00398. [DOI] [PubMed] [Google Scholar]
  • 23.Brennan MS, Matos MF, Richter KE, Li B, Scannevin RH. The NRF2 transcriptional target, OSGIN1, contributes to monomethyl fumarate-mediated cytoprotection in human astrocytes. Sci Rep. 2017;7(1):42054. 10.1038/srep42054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chen XL, Dodd G, Thomas S, Zhang X, Wasserman MA, Rovin BH, et al. Activation of Nrf2/ARE pathway protects endothelial cells from oxidant injury and inhibits inflammatory gene expression. Am J Physiol Heart Circ Physiol. 2006;290(5):H1862–70. 10.1152/ajpheart.00651.2005. [DOI] [PubMed] [Google Scholar]
  • 25.Saha S, Buttari B, Panieri E, Profumo E, Saso L. An overview of Nrf2 Signaling Pathway and its role in inflammation. Molecules. 2020;25(22):5474. 10.3390/molecules25225474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Abdulkhaleq LA, Assi MA, Abdullah R, Zamri-Saad M, Taufiq-Yap YH, Hezmee MNM. The crucial roles of inflammatory mediators in inflammation: a review. Veterinary World. 2018;11(5):627–35. 10.14202/vetworld.2018.627-635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Turner MD, Nedjai B, Hurst T, Pennington DJ. Cytokines and chemokines: at the crossroads of cell signalling and inflammatory disease. Biochim et Biophys Acta (BBA) - Mol Cell Res. 2014;1843(11):2563–82. 10.1016/j.bbamcr.2014.05.014. [DOI] [PubMed] [Google Scholar]
  • 28.Germolec DR, Shipkowski KA, Frawley RP, Evans E. Markers of inflammation. In: DeWitt JC, Rockwell CE, Bowman CC, editors. Immunotoxicity testing: methods and protocols. New York, NY: Springer; 2018. pp. 57–79. 10.1007/978-1-4939-8549-4_5. [Accessed 25th December 2021]. [Google Scholar]
  • 29.Ghanim AM, Girgis AS, Kariuki BM, Samir N, Said MF, Abdelnaser A, et al. Design and synthesis of ibuprofen-quinoline conjugates as potential anti-inflammatory and analgesic drug candidates. Bioorg Chem. 2022;119:105557. 10.1016/j.bioorg.2021.105557. [DOI] [PubMed] [Google Scholar]
  • 30.Lee SH, Lee H, Kim JC. Anti-inflammatory effect of water extracts obtained from doenjang in LPS-stimulated RAW 264.7 cells. Food Sci Technol. 2019;39:947–54. 10.1590/fst.15918. [Google Scholar]
  • 31.Hasegawa S, Ichiyama T, Sonaka I, Ohsaki A, Hirano R, Haneda Y, et al. Amino acids exhibit anti-inflammatory effects in human monocytic leukemia cell line, THP-1 cells. Inflamm Res. 2011;60(11):1013–9. 10.1007/s00011-011-0362-1. [DOI] [PubMed] [Google Scholar]
  • 32.Wang QG, Xue X, Yang Y, Gong PY, Jiang T, Zhang YD. Angiotensin IV suppresses inflammation in the brains of rats with chronic cerebral hypoperfusion. J Renin-Angiotensin-Aldosterone Syst. 2018;19(3):1470320318799587. 10.1177/1470320318799587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Fritsche KL. The science of fatty acids and inflammation. Adv Nutr. 2015;6(3). 10.3945/an.114.006940. 293S-301S. [DOI] [PMC free article] [PubMed]
  • 34.Seet LF, Toh LZ, Finger SN, Chu SWL, Wong TT. Valproic acid exerts specific cellular and molecular anti-inflammatory effects in post-operative conjunctiva. J Mol Med. 2019;97(1):63–75. 10.1007/s00109-018-1722-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Barata PHS, Sarquis ÍR, Carvalho HO, Barros AS, Rodrigues AB, Galue-Parra AJ, et al. Chemoenzymatic synthesis and anti-inflammatory activity of fatty acid Amides prepared from Bertholletia excelsa (Brazil Nut) triglycerides. J Braz Chem Soc. 2020;31:1557–65. 10.21577/0103-5053.20200041. [Google Scholar]
  • 36.Moon SM, Lee SAh, Hong JH, Kim JS, Kim DK, Kim CS. Oleamide suppresses inflammatory responses in LPS-induced RAW264.7 murine macrophages and alleviates paw edema in a carrageenan-induced inflammatory rat model. Int Immunopharmacol. 2018;56:179–85. 10.1016/j.intimp.2018.01.032. [DOI] [PubMed] [Google Scholar]
  • 37.Rahaman O, Ganguly D. Endocannabinoids in immune regulation and immunopathologies. Immunology. 2021;164(2):242–52. 10.1111/imm.13378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.He Y, Langenhoff AAM, Sutton NB, Rijnaarts HHM, Blokland MH, Chen F, et al. Metabolism of Ibuprofen by Phragmites australis: Uptake and Phytodegradation. Environ Sci Technol. 2017;51(8):4576–84. 10.1021/acs.est.7b00458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Steiner N, Balez R, Karunaweera N, Lind JM, Münch G, Ooi L. Neuroprotection of Neuro2a cells and the cytokine suppressive and anti-inflammatory mode of action of resveratrol in activated RAW264.7 macrophages and C8–B4 microglia. Neurochem Int. 2016;95:46–54. 10.1016/j.neuint.2015.10.013. [DOI] [PubMed] [Google Scholar]
  • 40.Rosette C, Agan FJ, Rosette N, Moro L, Mazzetti A, Hassan C, et al. Rifamycin SV exhibits strong anti-inflammatory in vitro activity through pregnane X receptor stimulation and NFκB inhibition. Drug Metab Pharmacokinet. 2019;34(3):172–80. 10.1016/j.dmpk.2019.01.002. [DOI] [PubMed] [Google Scholar]
  • 41.Wang YF, Hsu YJ, Wu HF, Lee GL, Yang YS, Wu JY, et al. Endothelium-derived 5-Methoxytryptophan is a circulating anti-inflammatory molecule that blocks systemic inflammation. Circul Res. 2016;119(2):222–36. 10.1161/CIRCRESAHA.116.308559. [DOI] [PubMed] [Google Scholar]
  • 42.Wang S, Wang H, Jing H, Wang S, Kang L, Gao X, et al. Anti-inflammatory effects of isopropyl 3-(3, 4-dihydroxyphenyl)-2-hydroxypropanoate, a novel metabolite from danshen, on activated microglia. Chin J Physiol. 2012;55(6):428–34. 10.4077/cjp.2011.amm045. [DOI] [PubMed] [Google Scholar]
  • 43.Aboyoussef AM, Mohammad MK, Abo-Saif AA, Messiha BAS. Granisetron attenuates liver injury and inflammation in a rat model of cecal ligation and puncture-induced sepsis. J Pharmacol Sci. 2021;147(4):358–66. 10.1016/j.jphs.2021.08.005. [DOI] [PubMed] [Google Scholar]
  • 44.Won TW. Fenofibrate, a peroxisome proliferator-activated receptor α-agonist, blocks lipopolysaccharide-induced inflammatory pathways in mouse liver. Korean J Hepato-Biliary-Pancreatic Surg. 2013;17(3):89. 10.14701/kjhbps.2013.17.3.89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Shirani K, Iranshahi M, Askari VR, Gholizadeh Z, Zadeh AA, Zeinali M, et al. Comparative evaluation of the protective effects of oral administration of auraptene and umbelliprenin against CFA-induced chronic inflammation with polyarthritis in rats. Biomed Pharmacother. 2021;139:111635. 10.1016/j.biopha.2021.111635. [DOI] [PubMed] [Google Scholar]
  • 46.Qureshi AA, Reis JC, Papasian CJ, Morrison DC, Qureshi N. Tocotrienols inhibit lipopolysaccharide-induced pro-inflammatory cytokines in macrophages of female mice. Lipids Health Dis. 2010;9(1):143. 10.1186/1476-511X-9-143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Dar KB, Khan IS, Amin S, Ganie AH, Bhat AH, Dar SA, et al. Active Cousinia thomsonii extracts modulate expression of crucial Proinflammatory Mediators/Cytokines and NFκB Cascade in Lipopolysaccharide-Induced albino Wistar Rat Model. J Inflamm Res. 2020;13:829–45. 10.2147/JIR.S272539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Allen F, Greiner R, Wishart D. Competitive fragmentation modeling of ESI-MS/MS spectra for putative metabolite identification. Metabolomics. 2015;11(1):98–110. 10.1007/s11306-014-0676-4. [Google Scholar]
  • 49.Wang F, Liigand J, Tian S, Arndt D, Greiner R, Wishart DS. CFM-ID 4.0: more accurate ESI-MS/MS spectral prediction and compound identification. Anal Chem. 2021;93(34):11692–700. 10.1021/acs.analchem.1c01465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wishart DS, Knox C, Guo AC, Eisner R, Young N, Gautam B, et al. HMDB: a knowledgebase for the human metabolome. Nucleic Acids Res. 2009;37(Database issue):D603–10. 10.1093/nar/gkn810. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (1,000.2KB, docx)

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without unjustified reservation.


Articles from BMC Biotechnology are provided here courtesy of BMC

RESOURCES