Abstract
Human T-cell leukemia virus type 1 (HTLV-1) is suggested to cause adult T-cell leukemia after 40 to 50 years of latency in a small percentage of carriers. However, little is known about the pathophysiology of the latent period and the reservoir organs where polyclonal proliferation of cells harboring integrated provirus occurs. The availability of animal models would be useful to analyze the latent period of HTLV-1 infection. At 18 months after HTLV-1 infection of C3H/HeJ mice inoculated with the MT-2 cell line, which is an HTLV-1-producing human T-cell line, HTLV-1 provirus was detected in spleen DNA from eight of nine mice. No more than around 100 proviruses were found per 105 spleen cells. Cellular sequences flanking the 3′ long terminal repeat (LTR) and the clonalities of the cells which harbor integrated HTLV-1 provirus were analyzed by linker-mediated PCR. The results showed that the flanking sequences are of mouse genome origin and that polyclonal proliferation of the spleen cells harboring integrated HTLV-1 provirus had occurred in three mice. A sequence flanking the 5′ LTR was isolated from one of the mice and revealed the presence of a 6-nucleotide duplication of cellular sequences, consistent with typical retroviral integration. Moreover, PCR was performed on DNA from infected tissues, with LTR primers and primers derived from seven novel flanking sequences of the three mice. Data revealed that the expected PCR products were found from lymphatic tissues of the same mouse, suggesting that the lymphatic tissues were the reservoir organs for the infected and proliferating cell clones. The mouse model described here should be useful for analysis of the carrier state of HTLV-1 infection in humans.
Human T-cell leukemia virus type 1 (HTLV-1) is believed to cause various HTLV-1-associated diseases including adult T-cell leukemia/lymphoma (ATL) (7, 22). Before the manifestation of ATL, there is a long latency period, of up to 40 to 50 years, after HTLV-1 infection, when the infected individual is an asymptomatic carrier. In addition, only 2 to 3% of infected individuals develop ATL (20). These facts suggest that a multistep carcinogenesis model could be applied to explain the leukemogenesis in ATL (16).
During the long latent period of HTLV-1 infection, most carriers show polyclonal proliferation of cells harboring integrated HTLV-1 provirus (21, 26). However, the reservoir organs of cell clones harboring integrated HTLV-1 provirus are not clear in humans. The study of the pathophysiology of the carrier states of HTLV-1 infection is essential for analysis of the mechanism of the progression to ATL. However, it is difficult to study the clonal proliferation of cells harboring integrated HTLV-1 provirus in human organs (2, 4).
The availability of animal models would be useful to analyze the reservoir organs where cell clones harboring integrated HTLV-1 provirus are persistent during the carrier state. Although HTLV-1 transmission in experimental animals has been reported for rabbits (1, 12, 17, 18, 23), monkeys (24, 25), and rats (10, 19), little information is available on the reservoir organs for cell clones which harbor integrated HTLV-1 in the persistently infected animals. We recently reported HTLV-1 transmission to newborn mice and maintenance of HTLV-1 provirus in the mouse spleen for 4 months (5, 6).
In this work, we found that the mode of integration of HTLV-1 after inoculation of MT-2 cells (15) is consistent with that reported in the typical retrovirus infection, which shows duplication of the cellular sequences at the site of integration, and we found that the lymphatic tissues, the spleen in particular, are the major reservoir organs of HTLV-1-infected cells that show clonal proliferation, even at a low frequency. The cell clones infected with HTLV-1 at a lower level were identified by linker-mediated (LM)-PCR in the spleen, and the same cell clones were found in other lymphatic tissues of the same animals.
Ten offspring from three pregnant C3H/HeJ (3) mice were each injected intraperitonealy with 2.5 × 106 MT-2 cells within 24 h after birth and again at 1-week of age (6). One mouse died of malignant histiocytoma at 15 months of age. The long terminal repeat (LTR) and pX sequences of the HTLV-1 provirus in the mouse organs were detected by PCR when the mice were 18 months old. HTLV-1 provirus was detected frequently in peripheral blood mononuclear cells (PBMC), spleen, and lymph nodes but less frequently in the liver, kidneys, and thyroid. These results are consistent with the recent report of a study with experimentally infected squirrel monkeys (11).
To detect the clonal proliferation of cells in PBMC harboring integrated HTLV-1 provirus, we performed LM-PCR (28) but could not detect the amplified band. This might be due to the low abundance of HTLV-1 provirus in PBMC compared to that in the spleen and/or to the sensitivity of our LM-PCR, which proved to be ≥10 copies of HTLV-1 provirus using the ATL-1K cell line, which has only one HTLV-1 provirus integrated per cell (reference 9 and data not shown).
Next we performed LM-PCR with the spleens of mice 1, 2, 3, 5, 6, and 9, which were determined to have 10 to 100 copies of pX sequences per 105 cells by our semiquantitative PCR method (13, 14). The spleens of these mice showed positive signals in LM-PCR. The representative LM-PCR pattern in mice 1, 5, and 6 (Fig. 1) clearly demonstrated that there are heterogeneous cell clones with different flanking sequences, which are consistent with polyclonal integration of HTLV-1 provirus into the spleen cells of these mice.
FIG. 1.
LM-PCR analysis of cell clones with different integration sites. The results of LM-PCR on spleen DNA from mice 1, 5, and 6 are presented. P, positive control (ATL-1K cell DNA).
These LM-PCR products were successfully cloned and sequenced. The clones that have more than 39 nucleotides to prove their mouse origin by PCR are shown in Table 1. The amplification of these flanking sequences by PCR from normal mouse DNA but not from MT-2 cell DNA (5, 6) showed that these sequences are of mouse genome origin (data not shown).
TABLE 1.
Flanking sequences of HTLV-1 integration sites
| Clone | Size (bp) | Flanking mouse genome sequencea |
|---|---|---|
| 1C1 | 57 | ATCATCTCCAGACATTTTACATAGCATAACACTTTGATGTGTGAGACAGTAGCCATG |
| 5C1 | 189 | GGGTTTCATCCCCTTTCCTGAACCTTAAATCAGTTACTGATTGGTTATCCCCACAATCTTTGTACCAACTTTACCCTAGCATATCTTACAGGCAGTGTATTGTAGATAAAGGGTTTGTAGCTGACTTCGTGTTTGCATTTCTCCTTTGAGTCTGTGCAAAGTACTTTGTACCAGAGACACTGGAGCATG |
| 5C2 | 186 | ACTGAGGATGCAAAGACATATGCTGGGTCCTTGCCACTGAGGGCCAAAGCCTAATGAAACAGGCAGGCAATAAATAATTAACACAAACAGGGGGCCGGTGCTGAAAGTATTAGTGTAGACCCTTGAAGTATGTGTTTTTTGAGTTGTTTCTCGGGGCGATGGCTTAGACACAGAGCCTCATACATG |
| 5C3 | 82 | AGACTTGGTGTAAATGTAAACACAGCTTGAAATTTGAAATTTCATCTTATTCCTAGGGGGACCTAGTTTATTCTGGTGCATG |
| 5C4 | 51 | TTTTCCAAAAAAAAAAAAAGAAGAAATCAGTCCGGGCAGTGGTGGCACATG |
| 6C1 | 281 | GATACTCTGTTAACAGCTGTCTGGAATGATTTCCTACAGGAAGGTACCTCTGAAATGACTCAAGGAAGAAGAATAAAGATTATTTCTAGACTAGAATGAATATGCTTGCAAGAGAGAAGATTCTGAGAGAGGTAATCAGAATAAAGATGCTTAGAGACATAGAAATGTTTATAGTCCAGAGCTCATATCTCCTGGCAAAAGGTAGACAGTGCATCATTTCCAGGGAAGATGAGGTTGGGAGACAGACAGAGGCTAGATAATGCCCAGCTCTGTATGACATG |
| 6C2 | 137 | CTTCTCAATAGTCACAAATGATATAAAATATCTTGGCGTGACTCTAACTAAGGAAGTGAAAGATCTGTATGATAAAAACTTCAAATCTCTGAAGAAAAAATTAAGGAAGATCTCAGAAGATGGAAAGATCTCCCATG |
Positions of the reverse primers used to prove the mouse origin of the flanking sequences are underlined.
Clone 5C4 showed identity to a genomic sequence near the Mus musculus 45S pre-rRNA gene (nucleotides 2226 to 2277; GenBank accession no. X82564). To determine whether the mouse cellular sequence was flanked by the 5′ LTR of clone 5C4, the forward primer, 5C4-5′ F (5′GTGGAGCACACCTTTAACCT3′) was designed from the available database and PCR was performed with the reverse primer at the U3 region of the 5′ LTR, 5′AGCCATATGCGTGCCATGAA3′, using a template of spleen DNA of mouse 5. The amplified band was excised, cloned, and sequenced, as shown in Fig. 2. It is clear that a 6-nucleotide duplication, 5′TTTTCC3′, is found in the flanking sequence of the 5′ and 3′ LTR. This suggests that HTLV-1 is integrated in mouse cells in a mode typical of retrovirus integration. The sequence of clone 6C2 turned out to be the open reading frame of the mouse L1 element, which is abundant in the mouse genome.
FIG. 2.
A 6-nucleotide duplication is found in the flanking sequence of the 5′ and 3′ LTR. The nucleotide sequences of the 5′ and 3′ flanks of clone 5C4 in mouse 5 are shown. The double underlines show the 6-nucleotide (nt) duplication of the mouse sequences.
The LM-PCR was performed with samples from other organs such as lymph nodes, kidneys, and liver, but there was no amplified band. This might be due to similar reasons to those discussed for PBMC (see above). These results strongly suggest that spleen is the major reservoir organ of HTLV-1-infected cells in mice.
We next checked whether each cell clone identified in the spleen DNA was also found in several other organs. PCR was performed with a forward primer, Bio-2, complementary to a part of the 3′ LTR, and with a reverse primer which was designed from the novel mouse flanking sequences (Fig. 3; Table 1). The results showed that these clones were found in the spleen, lymph nodes, liver, kidneys, lungs, and ovaries (Table 2). The copy numbers of these clones were assayed semiquantitatively by serial dilution of DNA aliquots from mouse 5. The results showed that there were 750 to 3,000 or more cells that have the same integration site per 108 spleen cells, if the cells contain one provirus per cell. It is not clear whether these small numbers of each cell clone show proliferation through immune stimulation or are driven by integrated HTLV-1 provirus. Considering the number of cell clones found in these mice, the clonal proliferation might be due to ongoing immune stimulation of T-cell or B-cell clones which happen to harbor the provirus. This is consistent with the multistep carcinogensis model of HTLV-1 if these latently infected cells are at the stage of being a carrier before malignant transformation. For more strong clonal expansion, it is necessary to have additional genetic or epigenetic events which lead to leukemia.
FIG. 3.
Organ distribution of the same cell clone harboring integrated HTLV-1 provirus in mouse 5. (A) Example of the design scheme for PCR detection of the cells with clone 5C1. (B) The products were electrophoresed in a 2% agarose gel, and Southern hybridization was performed with a probe. Forward primer, Bio-2 (28); reverse primer, 5′AAGATTGTGGGGATAACCAA3′; probe; Bio-5 (28). The first nucleotide of the flanking sequence was designated 1. SP, spleen; LI, liver; MG, mammary gland; KI, kidney; OV, ovary; TH, thymus; LN, lymph nodes; UT, uterus.
TABLE 2.
Organ distribution of provirus and clonesa
| Mouse no. | Clone | Presence of clone in:
|
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| PBMC | Spleen | Lymph nodes | Liver | Kidneys | Thyroid | Lungs | Testies | Ovaries | Mammary glands | Uterus | ||
| 1 | Provirus (LTR) | − | + | + | − | − | + | + | − | NA | NA | NA |
| 1C1 | − | + | + | − | − | + | + | − | NA | NA | NA | |
| 5 | Provirus (LTR) | + | + | + | + | + | − | NE | NA | − | − | − |
| 5C1 | − | + | + | − | + | − | NE | NA | − | − | − | |
| 5C2 | − | + | − | + | + | − | NE | NA | − | − | − | |
| 5C3 | − | + | + | − | + | − | NE | NA | − | − | − | |
| 5C4 | − | + | + | + | + | − | NE | NA | − | − | − | |
| 6 | Provirus (LTR) | + | + | + | + | + | − | NE | NA | + | NE | − |
| 6C1 | − | + | + | + | − | − | NE | NA | + | NE | − | |
| 6C2 | − | + | + | + | − | − | NE | NA | + | NE | − | |
The LTR sequence was detected by PCR, and each clone was detected by PCR using Bio-2 as a forward primer and the reverse primers designed from novel mouse flanking sequences of each clone. NA, not available; NE, not examined.
It is interesting that HTLV-1-infected cells reside mainly in the lymphatic tissues, the spleen in particular. Although the function of HTLV-1 integration in HTLV-1-infected cells is not known, it is clear that the cell clones which harbor integrated HTLV-1 provirus can be easily identified in the spleen as well as in the other lymphatic tissues. These cell clones, even at a low frequency, continue to proliferate and are not eliminated in these organs. This is consistent with the finding that the proviral load in PBMC of HTLV-1 carriers spans about 5 orders of magnitude, from 1 to 40,000/105 PBMC (14).
The presence of small numbers of latently infected cells in the lymphatic tissues might be analogous to the condition of the remaining HIV-1-infected cells in the reservoir organs even after highly active antiretroviral therapy (8).
Our results indicate that the cell clones harboring integrated HTLV-1 provirus have preferred reservoir organs, in this case lymphatic tissues, and that PBMC alone are not sufficient for detecting the clonal state of cells harboring integrated HTLV-1 provirus. The preferred distribution of provirus in different organs might be consistent with various HTLV-1-associated diseases in humans (27). The antibody against HTLV-1 antigens was negative when MT-2 cells were injected during the neonatal period but was positive when they were injected into mice aged 7 months (data not shown). The reverse transcriptase activity in the supernatant of splenocytes of HTLV-1-infected mice after being cultured for 2 weeks was negative. This might be due to the small number of virus-integrated cells or to the low expression of viral gene, which should be clarified in future studies. However, the present work suggests that mice could be used as an HTLV-1 carrier model in an analysis of the mechanism of the persistence of cell clones with integrated HTLV-1 provirus in reservoir organs and as a simple model in the evaluation of possible vaccine or antisense strategies to prevent HTLV-1 infection in vivo.
Acknowledgments
We thank T. Nagasawa, H. Abe, R. Feng, and N. Arashi-Hesse for kind suggestions.
This work was supported in part by a Grant-in-Aid for the 2nd Term of the Comprehensive 10-Year Strategy for Cancer Control and Cancer Research from the Ministry of Health and Welfare and from the Ministry of Education, Science, Sports and Culture of Japan.
REFERENCES
- 1.Akagi T, Takeda I, Oka T, Ohtsuki Y, Yano S, Miyoshi I. Experimental infection of rabbits with human T-cell leukemia virus type I. Jpn J Cancer Res. 1985;76:86–94. [PubMed] [Google Scholar]
- 2.Cavrois M, Wain-Hobson S, Gessain A, Plumelle Y, Wattel E. Adult T-cell leukemia/lymphoma on a background of clonally expanding human T-cell leukemia virus type-1-positive cells. Blood. 1996;88:4646–4650. [PubMed] [Google Scholar]
- 3.Coutinho A. Genetic control of B-cell response. II. Identification of the spleen B-cell defect in C3H/HeJ mice. Scand J Immunol. 1976;5:129–140. doi: 10.1111/j.1365-3083.1976.tb02999.x. [DOI] [PubMed] [Google Scholar]
- 4.Etoh K, Tamiya S, Yamaguchi K, Okayama A, Tsubouchi H, Ideta T, Mueller N, Takatsuki K, Matsuoka M. Presistent clonal proliferation of human T-lymphotropic virus type I-infected cells in vivo. Cancer Res. 1997;57:4862–4867. [PubMed] [Google Scholar]
- 5.Fang J, Kushida S, Feng R, Tanaka M, Kikukawa H, Kawamura T, Uchida K, Miwa M. Integration of HTLV-1 provirus into mouse transforming growth factor-α gene. Biochem Biophys Res Commun. 1997;233:792–795. doi: 10.1006/bbrc.1997.6557. [DOI] [PubMed] [Google Scholar]
- 6.Fang J, Kushida S, Feng R, Tanaka M, Kawamura T, Abe H, Maeda N, Onobori M, Hori M, Uchida K, Miwa M. Transmission of human T-cell leukemia virus type 1 to mice. J Virol. 1998;72:3952–3957. doi: 10.1128/jvi.72.5.3952-3957.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Franchini G. Molecular mechanism of human T-cell leukemia/lymphotropic virus type 1 infection. Blood. 1995;86:3619–3639. [PubMed] [Google Scholar]
- 8.Haase A T. Population biology of HIV-1 infection: viral and CD4+ T cell demographics and dynamics in lymphatic tissues. Annu Rev Immunol. 1999;17:625–656. doi: 10.1146/annurev.immunol.17.1.625. [DOI] [PubMed] [Google Scholar]
- 9.Hoshino H, Esumi H, Miwa M, Shimoyama M, Minato K, Tobinai K, Hirose M, Watanabe S, Inada N, Kinoshita K, Kamihira S, Ichimaru M, Sugimura T. Establishment and characterization of 10 cell lines derived from patients with adult T-cell leukemia. Proc Natl Acad Sci USA. 1983;80:6061–6065. doi: 10.1073/pnas.80.19.6061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ishiguro N, Abe M, Seto K, Sakurai H, Ikeda H, Wakisaka A, Togashi T, Tateno M, Yoshiki T. A rat model of human T lymphocyte virus type I (HTLV-I) infection. 1. Humoral antibody response, provirus integration, and HTLV-I-associated myelopathy/tropical spastic paraparesis-like myelopathy in seronegative HTLV-I carrier rats. J Exp Med. 1992;176:981–989. doi: 10.1084/jem.176.4.981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kazanji M, Ureta-Vidal A, Ozden S, Tangy F, de Thoisy B, Fiette L, Talarmin A, Gessain A, de The G. Lymphoid organs as a major reservoir for human T-cell leukemia virus type 1 in experimentally infected squirrel monkeys (Saimiri sciureus): provirus expression, persistence, and humoral and cellular immune responses. J Virol. 2000;74:4860–4867. doi: 10.1128/jvi.74.10.4860-4867.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kotani S, Yoshimoto S, Yamato K, Fujishita M, Yamashita M, Ohtsuki Y, Taguchi H, Miyoshi I. Serial transmission of human T-cell leukemia virus type I by blood transfusion in rabbits and its prevention by use of X-irradiated stored blood. Int J Cancer. 1986;37:843–847. doi: 10.1002/ijc.2910370608. [DOI] [PubMed] [Google Scholar]
- 13.Matsumura M, Kushida S, Ami Y, Uchida K, Kameyama T, Terano A, Shiraki H, Sato H, Miwa M. A simple and reliable method for the detection and quantitation of the human T-cell leukemia virus type-I provirus in peripheral blood mononuclear cells of seropositive blood donors. Jpn J Clin Oncol. 1992;22:335–341. [PubMed] [Google Scholar]
- 14.Matsumura M, Kushida S, Ami Y, Suga T, Uchida K, Kameyama T, Terano A, Inoue Y, Shiraki H, Okochi K, Sato H, Miwa M. Quantitation of HTLV-1 provirus among seropositive blood donors: relation with antibody profile using synthetic peptides. Int J Cancer. 1993;55:220–222. doi: 10.1002/ijc.2910550209. [DOI] [PubMed] [Google Scholar]
- 15.Miyoshi I, Kubonishi I, Yoshimoto S, Akagi T, Ohtsuki Y, Shiraishi Y, Nagata K, Hinuma Y. Type C virus particles in a cord T-cell line derived by co-cultivating normal human cord leukocytes and human leukemic T cells. 1981. Nature. 1981;294:770–771. doi: 10.1038/294770a0. [DOI] [PubMed] [Google Scholar]
- 16.Okamoto T, Ohno Y, Tsugane S, Watanabe W, Shimoyama M, Tajima K, Miwa M, Shimotohno T. Multi-step carcinogensis model for adult T-cell leukemia. Jpn J Cancer Res. 1989;80:191–195. doi: 10.1111/j.1349-7006.1989.tb02289.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Seto A, Isono T, Ogawa K. Infection of inbred rabbits with cell-free HTLV-1. Leuk Res. 1991;15:105–110. doi: 10.1016/0145-2126(91)90090-g. [DOI] [PubMed] [Google Scholar]
- 18.Seto A, Kawanishi M, Matsuda S, Ogawa K. Seronegative virus carriers in the infection of rabbits with human T lymphotropic virus type I. J Exp Med. 1988;168:2409–2414. doi: 10.1084/jem.168.6.2409. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Suga T, Kameyama T, Kinoshita T, Shimotohno K, Matsumura M, Tanaka H, Kushida S, Ami Y, Uchida M, Uchida K, Miwa M. Infection of rats with HTLV-1: a small animal model for HTLV-1-carriers. Int J Cancer. 1991;49:764–769. doi: 10.1002/ijc.2910490522. [DOI] [PubMed] [Google Scholar]
- 20.Tajima K The T and B Cell Malignancy Study Group; co-authors. The 4th nationwide study of adult T cell leukemia/lymphoma (ATL) in Japan: estimates of risk of ATL and its geographical and clinical features. Int J Cancer. 1990;45:237–243. doi: 10.1002/ijc.2910450206. [DOI] [PubMed] [Google Scholar]
- 21.Tsukasaki K, Tsusima H, Yamamura M, Hata T, Murata K, Maeda T, Atogami S, Sohda H, Momita S, Ideda S, Katamine S, Yamada Y, Kamihira S, Tomonaga M. Integration patterns of HTLV-1 provirus in retation to the clinical course of ATL: frequent clonal change at crisis from indolent disease. Blood. 1997;89:948–956. [PubMed] [Google Scholar]
- 22.Uchiyama T, Yodoi J, Sagawa K, Takatsuki K, Uchino H. Adult T-cell leukemia: clinical and hematologic features of 16 cases. Blood. 1977;50:481–492. [PubMed] [Google Scholar]
- 23.Uemura Y, Kotani S, Yoshimoto S, Fujishita M, Yamashita M, Ohtsuki Y, Taguchi H, Miyoshi I. Mother-to-offspring transmission of human T cell leukemia virus type I in rabbits. Blood. 1987;69:1255–1258. [PubMed] [Google Scholar]
- 24.Yamamoto N, Hayami M, Komuro A, Schneider J, Hunsmann G, Okada M, Hinuma Y. Experimental infection of cynomolgus monkeys with a human retrovirus, adult T-cell leukemia virus. Med Microbiol Immunol. 1984;173:57–64. doi: 10.1007/BF02123570. [DOI] [PubMed] [Google Scholar]
- 25.Yamanouchi K, Kinoshita K, Moriuchi R, Katamine S, Amagasaki T, Ikeda S, Ichimaru M, Miyamoto T, Hino S. Oral transmission of human T-cell leukemia provirus type-I into a common marmoset (Callithrix jaccus) as an experimental model for milk-born transmission. Jpn J Cancer Res. 1985;76:481–487. [PubMed] [Google Scholar]
- 26.Yoshida M, Seiki M, Yamaguchi K, Takatsuki K. Monoclonal integration of human T-cell leukemia provirus in all primary tumars of adult T-cell leukemia suggests causative role of human T-cell leukemia virus in the disease. Proc Natl Acad Sci USA. 1984;81:2534–2537. doi: 10.1073/pnas.81.8.2534. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Watanabe T. HTLV-1-associated diseases. Int J Hematol. 1997;66:257–278. doi: 10.1016/s0925-5710(97)00077-7. [DOI] [PubMed] [Google Scholar]
- 28.Wattel E, Vartanian J-P, Pannetier C, Wain-Hobson S. Clonal expansion of human T-cell leukemia virus type I-infected cells in asymptomatic and symptomatic carriers without malignancy. J Virol. 1995;69:2863–2868. doi: 10.1128/jvi.69.5.2863-2868.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]