miR-200c targeting GLI3 inhibits cell proliferation and promotes apoptosis in non-small cell lung cancer cells

Abstract

Lung cancer is a common malignant tumor with low cure rate. It has an easy recurrence and metastasis. This study explored whether miR-200c could regulate the biological behavior of non-small cell lung cancer cells through targeting GLI3. Luciferase reporter gene analysis was used to verify the interaction between miR-200c-3p and GLI3. miR-200c-3p and GLI3 were transiently overexpressed into A549 cells. The cell viability rate was detected by cell counting kit-8, cell invasion ability was detected with Transwell, cell apoptosis and cell cycle was determined by flow cytometry, and the expression of GLI3 was detected using quantitative polymerase chain reaction and Western blot, to verify the effect of the interaction between miR-200c-3p and GLI3 on the cell activities. miR-200c-3p overexpression could inhibit cell viability and invasion, promote apoptosis, induce G0/G1 arrest, and inhibit cell division. GLI3 overexpression could reverse the miR-200c-3p inhibition on cell cycle, reduce the number of cells in the G0/G1 phase and increase the number of cells in the S phase. miR-200c-3p overexpression in A549 cells could inhibit cell viability and invasion, and promote apoptosis. miR-200c-3p could target GLI3 to regulate cell cycle and inhibit cell proliferation.

1. Introduction

Lung cancer has been a common malignant tumor globally. The GLOBOCAN 2018 database showed that majority of lung cancer patients are men. It accounts for 14.5% of all cancers, with the mortality rate of 22%.^[1] Based on the histopathological features, the 2 main types of lung cancer are non-small cell lung cancer (NSCLC), which accounts for about 80% to 85%, and small cell lung cancer (SCLC). To date, despite significant advancements in the clinical diagnosis and treatment of lung cancer, the therapeutic effect remains unsatisfactory, and its 5-year survival rate remains very low (14% to 15%).^[2] Recurrence and metastasis are the major barrier to the curative effect, and how NSCLC acquires the capability for invasion and metastasis remains unclear. Therefore, it is of great theoretical significance and clinical practical value to further explore the molecular mechanism of invasion and metastasis in NSCLC. A number of studies found that in addition to the embryonic development, the Sonic Hedgehog (SHH) signaling pathway also has an important function in tumor development, such as skin basal cell carcinoma,^[3] prostate cancer,^[4] NSCLC,^[5] and digestive system tumor.^[6] GLI is the nuclear transcription factor of the SHH signaling pathway. In vertebrates, 3 nuclear transcription factors GLI1, GLI2 and GLI3 work together, and among these only GLI3 can act as both suppressor and activator to modulate the SHH signaling pathway, which is crucial for regulating cancer cell invasion and migration.^[7] Interfering with GLI3 expression has been reported to inhibit stemness, cell proliferation and invasion of oral squamous cell carcinoma,^[8] and Set7-mediated GLI3 methylation promotes NSCLC growth and metastasis in vivo and in vitro.^[9]

In recent years of cancer research, microRNA (miRNA)s have been shown to have important regulatory effects on cancer cell migration and other activities.^[10] Some miRNAs can also be used as the prognostic indicators in cancer. miRNAs are endogenous noncoding RNAs, usually contain 18 to 22 nucleotides, and play a key role in tumor cell metastasis. miRNAs can recognize targeted genes through the complementary sites and degrade targeted gene mRNA, via this mechanism down-regulate the target genes at the transcription level, and thereby regulate the physiological activities such as cell invasion and cell cycle. miR-200c belongs to the microRNA-200 family.^[11,12] Studies showed that endogenous miR-200c regulates cell adhesion and inhibits epithelial mesenchymal transition by targeting E-cadherin transcription repressors Zinc finger E-box-binding homeobox (ZEB)1 and ZEB2.^[13,14] miR-200c not only inhibits cell proliferation, invasion, migration and other activities in breast and gastric cancer,^[15,16] it is also abnormally expressed in lung cancer, regulates the high mobility group box protein 1 (HMGB1) and hypoxia-inducible factor 1-alpha (HIF-1α) expressions, and affects cell activities.^[17,18]

In this study, we aimed to investigate whether miR-200c can regulate the biological behavior of NSCLC through targeting GLI3. We used the miRNA target prediction database (miRDB) website for the miR-200c target gene prediction, and miR-200c-3p was found to have a binding site with GLI3, indicating targeting relationship between the 2. These 2 genes had been reported to regulate the activity of cancer cells in lung cancer,^[9,11,12] however, reports on their role in co-regulating cancer cells are relatively scarce. We cultured NSCLC cell A549 in vitro, transiently overexpressed miR-200c-3p and GLI3, and through studying their effects on the biological behavior of NSCLC cells, whether the inhibition of miR-200c was achieved via negative regulation of GLI3 was explored.

2. Materials and methods

2.1. Experimental materials

293T cells (BNCC100530), A549 cells (BNCC) (BeNa Culture Collection, Beijing, P.R. China); mimics (negative control) NC, miR-200c (synthesized by Sangon Biotech (Shanghai) Co., Ltd, Shanghai, P.R. China); pmirGLO (P0198), pcDNA3.1 (P0157) (Wuhan MiaoLing Biotech Science Co., Hubei, P.R. China); pRL-SV40 Renilla luciferase plasmid (preserved in our laboratory). Ethical approval is not necessary for the cell line studies.

2.2. Main reagents

Dulbecco modified Eagle medium (DMEM) high glucose complete medium (KGM12800S), 1640 complete medium (KGM31800S), DMEM high glucose incomplete medium (KGM12800N), 1640 incomplete medium (KGM31800N), cell counting kit (CCK)-8 (KGA317) (Jiangsu KeyGEN BioTECH Co., Nanjing, P.R. China); OPTI-minimal essential medium (MEM) I reduced serum medium (31985-062) (Gibco Inc., Billings, MT, USA), Lipofectamine 3000 transfection reagent (L3000015) (Invitrogen Corp., Carlsbad, CA, USA); dual luciferase reporter gene assay kit (RG027) (Beyotime Biotech, Shanghai, P.R. China); Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide apoptosis kit (AP101-100-kit), cell cycle staining kit (CCS102) (MultiSciences (Lianke) Biotech Co., Ltd, Hangzhou, P.R. China); crystal violet staining solution (G1061), bovine serum albumin (A8020) (Beijing Solarbio Science & Technology Co., Ltd, Beijing, P.R. China); radioimmunoprecipitation assay (RIPA) lysis buffer (C1053) (Applygen Technologies Inc., Beijing, P.R. China); bicinchoninic acid (BCA) protein quantitative kit (CW0014S) (Beijing ComWin Biotech Co., Ltd, Beijing, P.R. China); Super enhanced chemiluminescence (ECL) Plus (RJ239676) (Thermo Fisher Scientific Inc., Waltham, MA, USA); internal reference primary antibody: mouse monoclonal antiglyceraldehyde 3-phosphate dehydrogenase (GAPDH) (TA-08, 1/2000) and secondary antibody: goat anti-mouse immunoglobulin G (IgG) (heavy and light chains) (H + L) horseradish peroxidase (HRP) conjugate (ZB-2305, 1/2000) (ZSGB-Bio, Beijing, P.R. China); target primary antibody: rabbit anti GLI3 (28272-1-AP, 1/500) (Proteintech Group, Inc., Rosemont, IL, USA) and secondary antibody: goat anti-rabbit IgG (H + L) HRP conjugate (ZB-2301, 1/2000) (ZSGB-Bio); TRIzon reagent (CW0580S), Ultrapure RNA extraction kit (CW0581M) (Beijing ComWin Biotech Co., Ltd); HiScript II Q RT SuperMix for quantitative polymerase chain reaction (qPCR) (+gDNA wiper) (R223-01) (Vazyme Biotech Co. Ltd, Nanjing, P.R. China); 2 × Synergy Brands Inc. (SYBR) Green PCR Master Mix (A4004M) (Lifeint, Xiamen, Fujian, P.R. China).

2.3. Main instruments

CO₂ incubator (BPN-80CW) (Shanghai Yiheng Technical Co. Ltd, Shanghai, P.R. China); inverted fluorescence microscope (MF53) (Guangzhou Micro-shot Technology Co. Ltd, Guangdong, P.R. China); centrifugal machine (TD4A) (Yingtai Instrument, Hunan, P.R. China); multi-mode microplate reader (SAFIREII) (Tecan Group Ltd, Männedorf, canton of Zürich, Switzerland); automatic microplate reader (WD-2102B), vertical protein electrophoresis apparatus (DYY-6C) (Beijing Liuyi Biotechnology Co. Ltd, Beijing, P.R. China); NovoCyte flow cytometer (NovoCyte^TM 2060R) (ACEA BIO (Hangzhou) Co., Ltd, Zhejiang, P.R. China); ultra-sensitive chemiluminescence imaging system (Chemi Doc^TM XRS+), fluorescence PCR instrument (CFX Connect^TM Real time) (Bio-Rad Laboratories, Shanghai, P.R. China).

2.4. Vector construction

To construct a GLI3 overexpression vector, by using human complementary DNA (cDNA) as the template, the full length of GLI3 (NM_000168.6, 4755 bp) was obtained and cloned into pcDNA3.1 empty vector to acquire the GLI3 overexpression vector (GLI3-OE). To construct the GLI3 dual luciferase vectors, the fragments containing binding and mutation sites were synthesized, and cloned into the pmirGLO vector to obtain the WT-GLI3-pmirGLO and MUT-GLI3-pmirGLO vectors.

2.5. Dual luciferase transfection and detection

The 293T cells were seeded in a 12-well plate. WT-GLI3-pmirGLO and MUT-GLI3-pmirGLO were co-transfected with pRL-SV40 Renilla luciferase plasmid, mimics NC and miR-200c-3p according to the experimental grouping. 48 hours after transfection, the cells were collected and lysed using the dual luciferase reporter assay kit for 20 minutes at 4°C. About 70 μL of cell lysis buffer was added to a 96-well plate for each group. 100 μL of luciferase detection reagent was added to each well, and firefly luciferase activity was detected. Then, 100 μL of Renilla luciferase reagent was added to each well (detection substrate: buffer = 1:100), and the Renilla luciferase activity was detected. The Renilla luciferase was used as the internal reference.

2.6. Cell transfection

The A549 cells were cultured until good condition. The cells were seeded in a 6-well plate. The cells were prepared for transfection when the cell density reached 70%. The cell culture medium was replaced with a serum-free medium; the volume was 1 mL. Two sterilized eppendorf (EP) tubes was taken and each was added with 125 µL of Opti-MEM. One EP tube was added with 5 µL of lipofectamine 3000, and the other was added with 2.5 µg plasmids, 5 µL P3000, and mixed. Incubation was performed at room temperature (RT) for 5 minutes. Then, the 2 EP tubes were mixed, and incubated at RT for 15 minutes. Subsequently, the mixture was added dropwise to the 6-well plate. The cells were placed back in the incubator and cultured. 4 hours after transfection, 1 mL of complete medium with 20% serum content was added to the 6-well plate, and corresponding detection was performed after 48 hours.

2.7. Cell invasion ability detected by Transwell assay

The transfected cells were digested and collected, centrifuged, and resuspended with serum-free culture medium. On calculation, the number of cells in each small chamber was 3 × 10⁴. Then, the lower chamber of the small invasion chamber was added with 500 μL of complete medium. The total volume of cells in the upper chamber and the serum-free culture medium was approximately 300 µL. Then, the culture medium in each well was discarded. Phophate buffer saline (PBS) was added, washed for 5 minutes, followed by 0.1% prepared crystal violet, let stand and stained for 1 hour. After staining, the cells in the inside chamber of the small chamber was wiped with a cotton swab. The small chamber was inverted on the slide and photographs were taken. The staining solution in the wells were discarded, and 1 mL of 33% prepared acetic acid was added into each well, fully mixed and let stand to dissolve the staining solution in cells. Then, 200 μL from each well was absorbed into a 96-well plate. By using a multi-mode microplate reader, wavelength set at 570 nm, and 200 μL of 33% acetic acid as the control, the absorbance value of solution in each well was measured.

2.8. Cell viability detected by CCK-8

The transfected cells were digested, resuspended, counted, and seeded with a cell density of 5 × 10³ per well. After the cells adhered to the wall, the 96-well plate’s culture medium was replaced with the same medium after 24 hours (100 µL per well). Then, 10 µL of CCK-8 reagent was added into each well, and placed in the incubator for 2 hours. The absorbance value in each well was measured at 450 nm wavelength with a microplate reader. Cell viability (%) = [A(experimental group)-A(blank culture medium)]/[A(control group)-A(blank culture medium)] x 100%.

2.9. Apoptosis detected by flow cytometry

A total of 1 × 10⁶-3 × 10⁶ cells were collected. After adding 1 mL of PBS, the cells were centrifuged for 3 minutes at 1500 xg, and washed twice. By using double distilled water, 5× binding buffer was diluted into 1×, and 300 µL of precooled 1× binding buffer was used for cell resuspension. Then, 3 µL of Annexin V-APC and 5 µL of 7-amino-actinomycin D (7-AAD) was added into each tube, slightly mixed and incubated in the dark at RT for 10 minutes, followed by 200 µL of precooled 1× binding buffer, mixed and detected with flow cytometry.

2.10. Cell cycle detected by flow cytometry

The cells to be tested were collected, resuspended in 1 mL PBS, andcentrifuged for 3 minutes at 1500 xg. Then, the supernatant was discarded (twice). 1 mL of DNA staining and 10 µL of permeabilization solutions were added, mixed for 5 to 10 seconds under vortex oscillation, and incubated in the dark at RT for 30 minutes. Then, sample loading and data analysis was performed.

2.11. GLI3 expression detected by qPCR

The cells were collected, and the RNA was extracted and reverse transcribed as cDNA. By using cDNA as the template, the target gene expression in each group of cells was determined. The reaction procedure applied the 3-step method: predenaturation: 95 °C for 10 minutes; denaturation: 95 °C for 10 seconds; annealing: 58 °C for 30 seconds; extension: 72 °C for 30 seconds; 40 cycles. Table 1 showed the primer sequences used in this study.

Table 1.

Primer information.

Primer	Primer sequence
GLI3 F	CCCAACTCCTTGGTCACGATT
GLI3 R	CACTCGTGGGCTTGTTCTGTGA
miR-200c-3p RT	GTCGTATCCAGTGCAGGGTCCGAGG
miR-200c-3p F	CGCGTAATACTGCCGGGTAAT
miR-200c-3p R	AGTGCAGGGTCCGAGGTATT
GAPDH F	TGACTTCAACAGCGACACCCA
GAPDH R	CACCCTGTTGCTGTAGCCAAA

Abbreviation: GAPDH = Glyceraldehyde 3-phosphate dehydrogenase

2.12. GLI3 expression detected by Western blot

The cells in each group were lysed on ice for 15 minutes with lysis buffer, and subjected to high-speed centrifugation at 12,000 xg for 10 minutes. The supernatant was extracted, buffer solution was added, and boiled for 5 minutes. Then, this was kept at −20 °C. The protein concentration in the cells were measured with the BCA protein quantitative kit. Sodium dodecyl sulfate gel was configured, followed by sample loading and electrophoresis at 60 V for protein compression and 80 V for protein separation (120 minutes). The gel containing the internal reference or target band was cut. Then, sponge - filter paper - gel - membrane - filter paper - sponge were arranged in sequence. The gel complex substances were immersed in precooled 1× transmembrane solution, and 300 mA constant current was applied for membrane transfer. Then, 3% skimmed milk blocking solution was configured using 1× tris-buffered saline-Tween 20 (TBST). Blocking was performed at RT for 1 hour. The polyvinylidene difluoride (PVDF) membrane was incubated overnight at 4 °C with the primary antibody, washed, soaked in 1× TBST for 10 minutes, and then, the solution was discarded (3 times). Subsequently, the membrane was incubated with the secondary antibody at 4 °C for 2 hours, washed, soaked in 1× TBST for 10 minutes, and the solution was discarded (3 times). The membrane was added with ECL solution, and placed in the sample placement area of the ultra-sensitive chemiluminescence imaging system. Then, the imaging development program was run.

2.13. Statistical analysis

The data were analyzed using SPSS 20.0 software (IBM Corp., Armonk, NY, USA). All experiments were performed in 3 independent replicates. The quantitative data were presented as mean ± standard deviation (x̄ ± s). Two groups and multiple groups comparison were preformed using independent sample t-test and one-way analysis of variance (ANOVA), respectively. Tukey honestly significant difference (HSD) test was used for pairwise comparison. Test level α = 0.05.

3. Results

3.1. Verification of GLI3 as the target gene of miR-200c by dual luciferase reporter assay

Targetscan (http://www.targetscan.org/vert_72/) was used for prediction of GLI3 and miR-200c-3p binding sites. GLI3 fragments containing binding sites of wild type (WT) and binding sites with mutation (MUT) were constructed on the pmirGLO vector. The vector and miR-200c-3p were concurrently transferred into 293T cells, and the fluorescence value was detected. As shown in Figure 1, compared with the WT-GLI3 group, the WT-GLI3 + miR-200c-3p group showed significantly decreased in fluorescence value (Tukey P < .001), while the fluorescence value did not showed significant changes after the binding sites were mutated (Tukey P = 1.000). This indicate that GLI3 is the target gene of miR-200c-3p, and miR-200c-3p could down-regulate GLI3 expression.

Figure 1.

Luciferase reporter gene analysis. Note: Compared with WT-GLI3 group, *P < .05; compared with WT-GLI3 + NC group, ^#P < .05.

3.2. Verification of GLI3 gene overexpression

The full length coding sequences (CDSs) of GLI3 was obtained by cloning, and constructed onto the pcDNA3.1 overexpression vector. Upon transfected into the A549 cells, the success of overexpression was verified through qPCR and Western blot (WB). As shown in Figure 2A1 and A2, the GLI3-OE group showed significant increase in GLI3 expression compared with the NC group (Tukey, P < .001, both).

Figure 2.

GLI3 expression at the transcriptional and protein levels. (A1 and A2) The mRNA and protein expressions of GLI3 after overexpression of GLI3. Compared with NC group, *P < .05. (B1 and B2) Verification of miR-200c-3p overexpression, compared with mimics NC group, *P < .05, and mRNA expression of GLI3 in each group, compared with mimics NC group *P < .05, compared with miR-200c-3p group, ^#P < .05, compared with miR-200c-3p + GLI3-NC group, ^P < .05. (C1 and C2) Protein expression of GLI3 in each group. Compared with mimics NC, *P < .05, compared with miR-200c-3p + GLI3-NC group, ^#P < .05.

3.3. Transient overexpression of miR-200c-3p inhibited GLI3 protein expression

qPCR and WB were used to detect the GLI3 expression in each group. As shown in Figure 2B1, the content of miR-200c-3p increased significantly after transient overexpression (Tukey, P = .003). As shown in Figure 2B2, C1, and C2, compared with mimics NC, the GLI3 expression was significantly decreased after transient overexpression of miR-200c-3p (Tukey, P < .001, both). After concurrent overexpression of miR-200c-3p and GLI3 genes, the GLI3 expression was significantly increased at both transcription and protein levels as compared with the miR-200c-3p + GLI3-NC group (Tukey, P = .002, ANOVA, P < .001). miR-200c-3p could target to down-regulate GLI3 expression. When GLI3 was overexpressed concurrently, the effect of the downregulation at the transcriptional and protein levels was reversed.

3.4. Transient overexpression of miR-200c-3p inhibited cell invasion

The cell invasion was detected using Transwell assay. As shown in Figure 3D1 and D2, compared with the mimics NC group, miR-200c-3p overexpression significantly inhibited cell invasion (Tukey, P < .001). After concurrent overexpression of miR-200c-3p and GLI3 genes, the cell invasion ability was not significantly different compared with overexpression of miR-200c-3p alone (Tukey, P = .841), suggesting that the cell invasion ability was mainly inhibited by miR-200c-3p overexpression.

Figure 3.

Cell invasion, cell cycle, apoptosis, and cell proliferation. (D1 and D2) Cell invasion and absorbance value. Scale bar 200 μm (100×). Compared with mimics NC group, *P < .05; (E1, E2, and E3) Cell cycle and apoptosis. Compared with mimics NC group, *P < .05, compared with miR-200c-3p group, ^#P < .05, compared with miR-200c-3p + GLI3-NC group, ^P < .05. (F) Cell viability. Compared with mimics NC group, *P < .05, compared with miR-200c-3p group, ^#P < .05, compared with miR-200c-3p + GLI3-NC group, ^P < .05.

3.5. Transient overexpression of miR-200c-3p and GLI3 inhibited cell viability and promoted apoptosis

miR-200c-3p mimics and GLI3 overexpression vector were transfected into cells. Cell viability rate was detected by CCK-8; cell apoptosis and cell cycle were detected by flow cytometry. As shown in Figure 3E1 to E3 and F, after transient overexpression of miR-200c-3p, compared with mimics NC, the cell viability rate decreased, the apoptosis rate increased, the proportion of cells in the G0/G1 phase increased, and the proportion of cells in the S phase decreased. After concurrent transient overexpression of miR-200c-3p and GLI3, compared with miR-200c-3p + GLI3-NC, the cell viability rate decreased, the apoptosis rate increased, the proportion of cells in the G0/G1 phase increased, and the proportion of cells in the S phase decreased, but compared with the miR-200c-3p overexpression group, the proportion of cells in the G0/G1 phase decreased, and the proportion of cells in the S phase increased. The results showed that transient overexpression of miR-200c-3p alone and concurrent overexpression of miR-200c-3p and GLI3 could inhibit cell viability and promote apoptosis. Transient overexpression of miR-200c-3p alone induced G0/G1 arrest, reduced the number of cells in the S phase, and inhibited cell division. Overexpression of GLI3 could reverse the effect of the miR-200c-3p overexpression, reduced G0/G1 arrest and increased the number of cells in the S phase.

4. Discussion

NSCLC is the main type of lung cancer, with a low cure rate and a high probability of recurrence and metastasis. Therefore, research on the regulatory mechanisms of cell migration and invasion in lung cancer is particularly important. Studies have found that abnormal activation of the SHH signaling pathway in lung and digestive system tumors can regulate cancer cell migration and invasion.^[19,20] In recent years, it has also been found that miRNAs play a key role in the regulation of cancer cell proliferation and cell cycle. miR-200c has been reported to be abnormally expressed in various cancers, regulating the expression of multiple genes to affect cell migration and other activities. Studies have shown that GLI3 can regulate physiological functions such as cancer cell invasion and migration by regulating the SHH signaling pathway.^[7] We verified the targeted interaction between GLI3 and miR-200c-3p through luciferase reporter gene analysis. miR-200c-3p could down-regulate the expression of GLI3 at the transcription level. miR-200c-3p could interact with the 3 prime untranslated region (3′ UTR) of GLI3, thereby regulating the expression of GLI3 and affecting various cellular activities.

It had been reported that miR-200c-3p could inhibit cell activities by inhibiting the pAKT and PERK phosphorylation processes in the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) and mitogen-activated protein kinase kinase (MEK)/extracellular signal-regulated kinase (ERK) pathways.^[21,22] This study found that overexpression of miR-200c-3p inhibited A549 cell viability and invasion, promoted apoptosis, increased the number of cells in the G0/G1 phase and decreased the number of cells in the S phase. In addition, we transiently overexpressed miR-200c-3p and GLI3 concurrently to further explore whether overexpression of GLI3 could reverse a series of cellular activities caused by overexpression of miR-200c-3p. Interestingly, concurrent overexpression increased the inhibition of cell viability and promoted apoptosis, but had no effect on A549 cell invasion. However, in terms of cell cycle, we could see that overexpression of GLI3 reversed the state of cell arrest in the G0/G1 phase caused by overexpression of miR-200c-3p alone. After concurrent overexpression, the number of cells arrested in the G0/G1 phase decreased and the number of cells in the S phase increased. This indicated that overexpression of GLI3 could reverse the regulatory effect of miR-200c-3p on cell cycle and promote cell division. Although GLI3 increased abnormally at the transcriptional level, the expression of GLI3 increased by about 2-fold at the protein level, while the protein level increased 4-fold when GLI3 was overexpressed alone, indicating that a large portion of GLI3 interacted with miR-200c-3p. The inhibition of cell viability and enhancement of apoptosis caused by concurrent overexpression of GLI3 and miR-200c-3p might be due to the overexpression of GLI3. However, the regulatory mechanism of the interaction between miR-200c-3p and GLI3 on cell physiological activity is still unclear currently and needs to be further explored.

Although there were very few reports on the anti-cancer effect of GLI3, a study showed that GLI3 was expressed in 94% of medulloblastoma with neuronal differentiation, and medulloblastoma with glial and neuronal differentiation, and had not been detected in any differentiation-free medulloblastoma. In addition, the survival rates of patients with differentiation-free medulloblastoma were significantly reduced,^[23] indicating that GLI3 can inhibit cancer cell proliferation and promote apoptosis, however, the mechanism by which GLI3 regulates downstream genes and inhibits cell activities remains to be studied.

In conclusion, overexpression of miR-200c-3p can inhibit lung cancer cell viability and invasion, and promote apoptosis. miR-200c-3p can target GLI3 to regulate cell cycle and inhibit cell proliferation.

Author contributions

Conceptualization: Xiangjun Yi, Xuan Chen, Zhenbin Li.

Data curation: Xiangjun Yi, Xuan Chen, Zhenbin Li.

Formal analysis: Xiangjun Yi, Xuan Chen, Zhenbin Li.

Funding acquisition: Xiangjun Yi.

Investigation: Xiangjun Yi, Xuan Chen, Zhenbin Li.

Methodology: Xiangjun Yi, Xuan Chen, Zhenbin Li.

Project administration: Zhenbin Li.

Resources: Zhenbin Li.

Software: Zhenbin Li.

Supervision: Zhenbin Li.

Validation: Xiangjun Yi, Zhenbin Li.

Visualization: Xiangjun Yi, Xuan Chen.

Writing – original draft: Xiangjun Yi, Xuan Chen.

Writing – review & editing: Xiangjun Yi, Zhenbin Li.