Skip to main content
Genes logoLink to Genes
. 2024 Sep 20;15(9):1230. doi: 10.3390/genes15091230

Toll-like Receptor Expression in Pelodiscus sinensis Reveals Differential Responses after Aeromonas hydrophila Infection

Yu Tian 1, Hui Zhang 1, Lingrui Ge 2, Zi’ao Wang 2, Pei Wang 3, Shuting Xiong 1, Xiaoqing Wang 1, Yazhou Hu 1,*
Editor: Antonio Figueras
PMCID: PMC11431187  PMID: 39336821

Abstract

Background: Toll-like receptor (TLR), as an important pattern recognition receptor, is a bridge between non-specific immunity and specific immunity, and plays a vital role in the disease resistance of aquatic animals. However, the function of TLR in Pelodiscus sinensis is still unclear. Methods and Results: The sequence characteristics and homology of three TLRs (PsTLR2, PsTLR3 and PsTLR5) were determined in this investigation. Their annotation and orthologies were supported by phylogenetic analysis, functional domain prediction, and sequence similarity analysis. qPCR showed that the identified TLRs were expressed in all tissues, among the high expression of PsTLR5 in the brain and liver and the high expression of PsTLR2 and PsTLR3 in the liver. PsTLR2 mRNA expression increased 6.7-fold in the liver 12 h after Aeromonas hydrophila infection, while the mRNA expression of PsTLR3 was down-regulated by 0.29 times in liver and 0.31 times in spleen. The mRNA expression of PsTLR5 was significantly up-regulated in four immune tissues, and it was up-regulated by 122.8 times in the spleen after 72 h infection. Finally, the recombinant proteins of extracellular LRR domains of these three TLRs were obtained by prokaryotic expression technology, and the binding tests were performed to discover their ability of binding pathogenic microorganisms. Microbial binding test showed that rPsTLR2, rPsTLR3 and rPsTLR5 can combine A. hydrophila, Edwardsiella tarda, Vibrio parahaemolyticus, Staphylococcus aureus, Streptococcus agalactiae and Candida albicans, while rPsTLR3 can bind A. hydrophila, E. tarda, V. parahaemolyticus and C. albicans. Conclusions: Our findings suggested that TLRs may be crucial to turtles’ innate immune response against microbes.

Keywords: Pelodiscus sinensis, toll-like receptors, bacterial infection, immune response, microorganism binding

1. Introduction

Innate immunity is the most common host defensive mechanism observed in a wide variety of multicellular organisms [1]. Innate immune recognition is dependent on a small number of germline-encoded receptors [2]. Pathogenicity related molecular patterns (PAMP) are among those that may be identified utilizing pattern recognition receptors (PRRs) [3]. Toll-like receptor (TLR) is a key component of PRRs that may identify invasive infection and initiate the body’s healing process.

TLRs are transmembrane proteins of type I that have an internal Toll/interleukin-1 receptor (TIR) domain, a transmembrane domain, and external leucine-rich repeat (LRR) domains [4]. The LRR domain recognizes pathogens, whereas the TIR domain transduces signals downstream. TLRs identify a wide range of PAMPs, including flagellin, lipopolysaccharide (LPS), bacterial DNA, and single- or double-stranded viral RNA [5]. TLRs transmit downstream signals to the cytoplasm after recognizing PAMPs, where they activate two important adaptor proteins, the myeloid differentiation main response gene (88) (MyD88) and the Toll-like receptor adaptor molecule 1 (TICAM1, also known as TRIF). Multiple cytokines, including interleukin (IL)-12, IL-8, tumor necrosis factor alpha (TNF-α), and interferon (IFN), have been induced by these proteins. TLRs with different ligand specificities regulate different signaling pathways [6,7,8].

To date, mammals have been found to harbor 13 different types of TLRs, the majority of which are found in the genomes of aquatic animals [9,10]. They are classified into six TLR families (TLR1, TLR3, TLR4, TLR5, TLR7, and TLR11) based on their naturally occurring ligand type and recognized sequence [11]. TLR2, a crucial component of the TLR1 subfamily, is capable of identifying lipids, carbohydrates, and proteomes from microbes [12]. The ability of this receptor to generate functional heterodimers with more than two other TLR types is unique among TLRs. In addition, TLR2 interacts with non-TLR molecules, which makes a wide range of PAMPs recognizable [13,14]. As a member of the TLR3 subgroup, TLR3 is capable of identifying nucleotide derivatives that come from bacteria or viruses [15]. It has been demonstrated that TLR5 in fish and mammals is able to detect the flagellin protein component of bacterial flagella and is in charge of flagellin-mediated NF-κB activation [16]. The TLRs of Pelodiscus sinensis are still largely unexplored at the molecular level, with whole genome sequencing being one example of this [17,18].

TLR is a member of PPRs that has the capacity to recognize invasive infections and to trigger and mobilize the immune system. P. sinensis is an ancient reptile with significant nutritional and economic value as well as market growth potential. However, because to inadequate breeding practices, a lack of knowledge about germplasm protection, and inappropriate treatment use, P. sinensis’ illnesses have gotten worse over time [19]. While immune control is advantageous due to its good effect and reduced pollution, it is unclear how P. sinensis resists sickness and how immune it is. It is of great significance to study TLRs in P. sinensis. The purpose of this study is (1) to clone the TLR2, TLR3, and TLR5 genes of P. sinensis.; (2) to examine the tissue expression profile of TLRs and the expression profile during bacterial infection; (3) to produce recombinant proteins of the extracellular LRR domains of the three TLRs genes and identify their capacity to bind to microorganisms. This study may increase the immune gene database of P. sinensis, provide a theoretical reference for the analysis of disease-resistance mechanisms of P. sinensis and the development of prevention and control measures targeting TLRs.

2. Materials and Methods

2.1. Animals

All turtles, weighing about 200 g (±50 g), were obtained from Hezhou Turtle Breeding Base (Changde, China). The turtles were temporarily kept in a 50 L feeding box in the laboratory at 28 °C (±2 °C) before the test and were fed commercial pellets twice a day for 14 days. The animal experiments were according to the rules of the Animal Care and Use Committee of Hunan Agricultural University (Changsha, China; Approval Code: 202004297; Approval Date: 9 February 2020).

2.1.1. Bacterial Infection Experiment

A. hydrophila, isolated from livers of diseased turtles, was identified and preserved by our laboratory. The injection concentration of bacteria was determined by pre-experiment. The experimental group of turtles received an intraperitoneal injection of 100 μL of A. hydrophila at a concentration of 5 × 109 CFU/mL, whereas the control group of turtles received an intraperitoneal injection of 100 μL PBS. Immune-related tissues of the liver, spleen, kidney, and intestine from each group (n = 3) were sampled post-injection at 12, 24, 48, and 72 h, respectively. The samples were quickly frozen with liquid nitrogen and then stored at −80 °C before RNA extraction.

2.1.2. RNA Extraction and cDNA Synthesis

Total RNA was separated in accordance with FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China) from the collected tissues of P. sinensis in accordance with the manufacturer’s instructions. The RNA specimen quality was measured by a ratio of A260: 280. The integrity of RNA was verified by the electrophoresis of 1.5% agarose. Reverse transcription of RNA into first-strand cDNA was performed by Thermo Scientific RevertAidRT (Thermo, Waltham, MA, USA). For real-time PCR analysis, qPCR (+gDNA wiper) (Vazyme, Nanjing, China) was synthesized with HiScriptII Q RT superMix to synthesize the first-strand cDNA. The cDNA template was stored at −20 °C for later use.

2.1.3. Gene Cloning of TLR2, TLR3 and TLR5

The amplification primers of these three genes were designed based on the predicted sequences (XM_025185305.1; XM_014576247.2; XM_025180981.1) in the NCBI database (Table 1). PCR was carried out on aMyCycler (BioRad, Hercules, CA, USA) as follows: at 94 °C for five minutes; then at 94 °C for thirty seconds, at 56 °C for thirty seconds, and at 72 °C for 180 s for 35 cycles; and finally extended for ten minutes at 72 °C. The PCR was purified, ligated in pMD19T carrier (Takara, Kyoto, Japan), and then cloned into DH-5α. A commercial service (Tsingke, Changsha, China) sequenced positive clones.

Table 1.

Primers used for cloning, qPCR expression, and plasmid construction of TLRs genes.

Primer Name Primer Sequence (5′–3′) Usage
PsTLR2-F ATGAGATCAATAGGAAGCACTGGC TLR2 cloning
PsTLR2-R CTAGGATTTTAATGCTATTTTCAAATTAAA TLR2 cloning
PsTLR3-F ATGAGAGCTACCCTTTCCAGTTGG TLR3 cloning
PsTLR3-R TCAATGTATTTTGCTGCTAGATTTAAG TLR3 cloning
PsTLR5-F ATGTACTTCCCACAGTTTCTGCAG TLR5 cloning
PsTLR5-R CTACGAGATTGTCCTTATCGTTTGC TLR5 cloning
PsTLR2-qF TTCAGGCACTCAGATAACCACG Real-time PCR
PsTLR2-qR TTCTGCTGATTCTTAGGGACACC Real-time PCR
PsTLR3-qF GCACCACTTTGATAATGCTCCTC Real-time PCR
PsTLR3-qR CCCACTTCCTGTCCCTTCTTG Real-time PCR
PsTLR5-qF GATCCTGAGCATCACAATGTTACATCATC Real-time PCR
PsTLR5-qR GGCTACAACCATTATACCTGGCGATT Real-time PCR
β-actin-qF AGACCCGACAGACTACCTCA Real-time PCR
β-actin-qR CACCTGACCATCAGGCAACT Real-time PCR
PsTLR2-LRRs-F ggtatcgaaggtaggCATATGCCTTCAGGACTAACAACTGATGTCA Plasmid construction
PsTLR2-LRRs-R ctatctagactgcagGTCGACGTGACATTCAAACAGTGAAGCCG Plasmid construction
PsTLR3-LRRs-F ggtatcgaaggtaggCATATGACCTGCTCCTGGCTCTGTGTAA Plasmid construction
PsTLR3-LRRs-R ctatctagactgcagGTCGACTTTGCAGGGTGAAATGTCAAAA Plasmid construction
PsTLR5-LRRs-F ggtatcgaaggtaggCATATGCCAAACCTTCAAACCTTAGATTTAGG Plasmid construction
PsTLR5-LRRs-R ctatctagactgcagGTCGACATTACACCCATCAAGTGCCACTG Plasmid construction

2.1.4. Bioinformation Analysis of TLR2, TLR3, and TLR5

Comparison of the nucleotide and amino acid sequences was performed with the BLAST application (http://blast.ncbi.nlm.nih.gov/Blast.cgi/, accessed on 20 March 2023), based on the analysis of the derived amino acid sequences (https://web.expasy.org/protparam/, accessed on 20 March 2023), SMART (http://smart.embl-heidelberg.de/, accessed on 20 March 2023), and PROSITE (https://prosite.expasy.org/, accessed on 20 March 2023). Three dimensional (3D) models were built with SWISSMODEL (www.swissmodel.expasy.org/, accessed on 14 April 2023) and PyMOL 2.5.7. You can reconstruct more than one sequence with Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/, accessed on 14 April 2023) and GENEDOC. The phylogenetic tree was built by means of MEGA 7.0 based on neighborhood connection (NJ).

2.1.5. Quantitative PCR (qPCR) Analysis

In order to evaluate the mRNA levels of 3 TLR genes after bacteria injected into various tissues, RT-qPCR was used to detect and quantify real-time PCR. The Master Mix of ChamQ Universal SYBR qPCR (Vazyme, Nanjing, China) on LightCycler 96 (Roche, Basel, CH) was applied. The qPCR reaction mix included 5 μL of 2 × SYBR Premix Ex Taq II, cDNA template of 1 μL, sense or inverse primer (10 μM) 0.4 μL, and ddH2O 3.2 μL at the end volume of 10 μL. Each specimen was subjected to 3 replications, and β-actin was used as the cDNA normalization inner reference gene. The PCR procedure is as follows: 95 °C for 60 s, 95 °C for 5 s, 60 °C for 30 s, and then proceed to Step 2, where the process is repeated 40 times. The RT-qPCR dissociation profile was analyzed to show no contamination of DNA. Two sets of specimens were treated thrice with cDNA from three distinct bioassays (n = 3) as well as negative controls. A 2−ΔΔCT approach was employed to compute relative expression levels for each gene [20]. The difference of expression was determined by T-test, and the P was less than 0.05 indicating statistically significant. The primers used are listed in Table 1.

2.1.6. Recombinant Protein Expression and Purification

The mRNA leucine-rich repeats (LRRs) (PsTLR2-LRRs, PsTLR3-LRRs, and PsTLR5-LRRs) were amplified by using the following primers (Table 1), after the amplification of the LRRs was performed with a restriction enzyme pCold-TF. After recombinant plasmid purification via sequencing, it was converted to Escherichia coli BL21. The non-insertion pCold-TF, which could express rTFHs, could be used as a negative control. Then, the bacteria containing the expression vector were cultivated under Luria–Bertani (LB) medium at 37 °C and added with ampicillin (1 mg/mL), till OD600 was 0.6~0.8. Finally, a final concentration of isopropanol β-D-1-Thiogalactopyranoside (IPTG) was added to induce protein expression. After incubating at 16 °C for 16 h, the cells were collected by centrifuging for 10 min at 6000 rpm. The cell beads were re-suspended in Lysis buffer and then lysed in an ice-bath for 30 min by ultrasonic (2/2, 70%). The His-tagged proteins in the supernatants were purified in accordance with the manufacturer’s protocol with His-tag Purification Resin (Beyotime, Shanghai, China), and the BCA Protein Test Kit (Sangon, Shanghai, China) was performed for detection of the eluted samples’ concentration.

2.1.7. Microbial Binding Assay

Pathogenic bacteria from aquatic animals (A. hydrophila, Edwardsiella tarda, Vibrio parahaemolyticus, Staphylococcus aureus, Streptococcus agalactiae, and Candida albicans) were selected for overnight culture in LB/PDA and then re-suspended in PBS at a concentration of 1.0 × 107 cells/mL. Approximately 100 μL of purified rTLR2-LRRs, rTLR3-LRRs, and rTLR5-LRRs (100 μg/mL) were added as negative control at room temperature. The cells were removed by centrifuging (6000 revolutions per minute for 5 min) and then cleaned with PBS 3 times. For the Western blot assay, the last bacterial balls were used, and the antibody (Abkine, CA, USA) was used as the first antibody.

2.1.8. Western Blotting

Incubation of the cells using a 5 × SDS loading buffer was boiled for 10 min. The samples were then subjected to the SDS-PAGE gel and transferred onto the PVDF. The film was incubated for 10 min with QuickBlock™ blocking buffer (Beyotime, Shanghai, China), then incubated with a primary antigen at 4 °C, followed by three times of PBST, and incubated with a Horseradish Peroxidase (HRP)-conjugated goat anti-rabbit or mouse antibody (1: 5000) for 1 h at room temperature. Finally, the film was washed using PBST and processed (Beyotime, Shanghai, China) using ECL Western blotting detection reagents. A minimum of three tests were performed.

2.1.9. Statistical Analysis

Using GraphPad Prism 7.0, the average ± SD of the 3 biological tests were shown. The t-test (Both Groups) evaluated a statistically significant outcome. A p value below 0.05 was regarded as significant. All experiments were individually repeated at least three times.

3. Results

3.1. Cloning and Sequence Analysis of TLR2, TLR3, and TLR5

The completed CDS of P. sinensis TLR2, TLR3, and TLR5 genes, named PsTLR2, PsTLR3, and PsTLR5, were successfully cloned and identified. Compared with the predicted sequences in the public database, they differ in sequence length and base composition (Supplementary Materials). As shown in Figure 1, the completed CDS of PsTLR2 was 2412 bp in length and encoded 803 amino acids. The protein structure of PsTLR2 was further predicted by the SMART analysis service. The deduced PsTLR2 protein exhibited typical TLR domains, including two signal peptides, eleven leucine-rich repeat (LRR) motifs, a transmembrane region (TM), and a Toll/interleukin-1 receptor (TIR) domain. The CDS of PsTLR3 was 2691 bp in length and encoded 896 amino acids. It contained nineteen LRR motifs, a TM, and a TIR domain. The PsTLR5 gene was 2670 bp and encoded a protein with 889 amino acids, including twelve LRR motifs, two TMs, and a TIR domain.

Figure 1.

Figure 1

Sequence analysis of three TLR genes from P. sinensis. The top column contains the nucleotides of PsTLR2 (A), PsTLR3 (B), and PsTLR5 (C), whereas the bottom column contains the inferred amino acid sequences. Gray shading indicates transmembrane domains. The start codon (ATG) and the stop codon (TAG) are marked with boxes. The C-terminal leucine-rich domain (LRR-CT) and the leucine-rich domain (LRR) are marked with single underlines. Overlapping regions are shown in bold underline, and the domains of TIR are marked with wavy lines. The double underline is used here to identify low complexity. The symbol ‘*’ is used here to identify terminator T. (D) Create a schematic model of the tertiary structure of TLRs proteins using SWISSMODEL and PyMOL display by applying SMART prediction.

3D models of PsTLR2, PsTLR3, and PsTLR5 predicted by SWISS-MODEL indicated that the LRR domain of PsTLR2, PsTLR3 and PsTLR5 had a classic horseshoe structure, their transmembrane regions were composed of α helical, and the TIR domains included multiple serine/threonine residues. It can effectively recognize and bind to appropriate ligands by reason of its structural shape, which can start or control immune responses.

BLASTP analysis indicated that the deduced amino acid sequences of three TLRs shared high similarities with other reported TLRs. PsTLR2 showed 85.35% identity with MmTLR2 from Mauremys mutica (XP_044874668.1), PsTLR3 closely matched the TLR3 homologs of M. reevesii (XP_039398302.1), and PsTLR5 was similar to TLR5 proteins from Trachemys scripta elegans (XP_034620540.1). Multiple sequence alignment and sequence logo showed that the TIR domains of TLR genes in P. sinensis are highly conserved with other species. The TIR domain of TLR2 contains three box domains, namely Box1 (A-Y-), Box2 (L-RD-PG) and Box3 (-W-). The TIR domains of TLR3 and TLR5 also have three box domains (Figure 2).

Figure 2.

Figure 2

Figure 2

Multiple sequence alignment (AC) and sequence logo (D) of amino acid sequence of TLRs in P. sinensis with TLRs from other species. The LRRs are shown in red line segments, and the TIR domain is shown in green line segments. Amino acid sequence is similarity color-coded: 100% in black, 70% in pink, 50% or more in blue, less than 50% in white. The three conserved boxes 1–3 are marked with black boxes. PsTLRs are marked with red triangles. Turtles are represented by blue vertical lines. The symbol ‘*’ is used here to identify interval.

In order to determine the evolutionary relation between PsTLR2, PsTLR3, and PsTLR5 with other species, including mammals, turtles, birds, and bony fish, a phylogenetic tree was established. As illustrated in Figure 3, all TLR2, TLR3, and TLR5 clustered into one clade each. PsTLRs first formed a clade with other tortoises, and then with mammals and birds. Bony fishes alone clustered into a clade. This finding is in line with the taxonomy findings, suggesting that TLR tended to be conserved during evolution. It is speculated that their function is relatively conservative.

Figure 3.

Figure 3

Phylogenetic tree of TLRs. The phylogenetic tree was built by means of a neighborhood joining approach with a bootstrapping of 1000 copies, as discussed in the literature and methods section. PsTLRs are marked with black triangles.

3.2. Tissue Expression of TLR2, TLR3 and TLR5

RT-qPCR was employed to determine the PsTLR2, PsTLR3, and PsTLR5 mRNA in different tissues of P. sinensis. PsTLR2 was found to be ubiquitous in all of the examined tissues, moderately expressed in the brain, and highly expressed in the liver (Figure 4A). The expression of PsTLR3 is high in the liver but low in the heart, brain, spleen, kidney, muscle, intestine, and lungs (Figure 4B). PsTLR5 is found in liver, brain, and other tissues at low concentrations (Figure 4C).

Figure 4.

Figure 4

Healthy tissue-relative expression levels of PsTLR2 (A), PsTLR3 (B), and PsTLR5 (C) mRNA (heart, liver, spleen, kidney, intestine, muscle, brain, and lung).

3.3. Expression Profiles of TLR2, TLR3 and TLR5 Challenged by A. hydrophila

It has been reported that TLR expression may be up-regulated following bacterial or flagellin stimulation. In order to preliminarily ascertain if TLRs are regulated in A. hydrophila infection, RT-qPCR was used to analyze the expression patterns of TLRs. The expression of PsTLR2 in hepatic, splenic, and renal tissues was markedly elevated, with negligible alteration in the intestines (Figure 5A). In hepatic and splenic tissues, PsTLR3 was first reduced, then rose, and reached a minimum at 12 h (Figure 5B). There was significant up-regulation of PsTLR5 in four tissues. It was highest in the hepatic and splenic organs at 24 h and maximal in the kidneys at 12 h. Therefore, PsTLR5 has an active reaction against the invading bacteria during the initial phase of the challenge (Figure 5C).

Figure 5.

Figure 5

Temporal expression of three TLR genes after A. hydrophila infection. PsTLR2 (A), PsTLR3 (B), and PsTLR5 (C) expression levels in the liver and kidney of P. sinensis after A. hydrophila infection were measured by RT-qPCR. Asterisks (*) represent significant difference (* p < 0.05).

3.4. Prokaryotic Expression of TLR2, TLR3 and TLR5-LRR

LRR domains were reported to recognize pathogens. To analyze the possible mechanism of PsTLR2, PsTLR3, and PsTLR5 against bacteria, the ectodomain LRRs of PsTLR2, PsTLR3, and PsTLR5 were recombinantly expressed in BL21. SDS-PAGE analysis showed that the rPsTLR2-LRRs, rPsTLR3-LRRs, and rPsTLR5-LRRs proteins were purified and resolved as a sharp band of ~120 kDa, which was close to the molecular weight of rPsTLR2-LRRs, rPsTLR3-LRRs, and rPsTLR5-LRRs. After Western blot assay using mouse-anti-6 × His-tag monoclonal antibody, a ~120 kDa band was observed, which was consistent with the predicted size of the rPsTLR2-LRRs, rPsTLR3-LRRs, and rPsTLR5-LRRs regions (Figure 6).

Figure 6.

Figure 6

The recombinant proteins rPsTLR2-LRRs, rPsTLR3-LRRs, and rPsTLR5-LRRs were expressed and purified. Western-blot analysis of rPsTLR2-LRRs, rPsTLR3-LRRs, rPsTLR5-LRRs protein with the mouse-anti-6 × His-tag monoclonal antibody.

3.5. Binding Activities of TLR2, TLR3, and TLR5-LRR to Bacteria

Then the purified rPsTLR2-LRRs, rPsTLR3-LRRs, and rPsTLR5-LRRs proteins were used to determine whether they could bind to bacteria. By Western blot assay (Figure 7), rPsTLR2-LRRs and rPsTLR5-LRRs were able to bind to all the tested bacteria, among which A. hydrophila, V. parahaemolyticus, E. tarda, and S. agalactiae showed the highest affinity, whereas rPsTLR3-LRR could only bind to A. hydrophila, V. parahaemolyticus, E. tarda, and C. albicans, and the rTFH protein (control) showed no binding activity to any bacteria.

Figure 7.

Figure 7

The microorganisms binding assay of rPsTLR2-LRRs, rPsTLR3-LRRs, rPsTLR5-LRRs and TFH recombinant protein. The binding ability was showed by Western blotting. TFH was used as negative control.

4. Discussion

From the obtained results, the predicted sequences in the public database are not completely consistent with the experimental amplification results, indicating that the predicted sequences are not completely correct, and it is necessary for us to verify the predicted sequences in the public database. Nevertheless, these high-throughput sequencing-based data provide an important foundation for research. According to research, the structure of the TLR family is relatively conserved, typically featuring three domains: LRR domains, TM domain, and TIR domain. Three classical domains are present in each of the PsTLR2, PsTLR3, and PsTLR5 genes, which is consistent with the traits of the TLR family.

The extracellular domain of the TLR family is a variable LRR domain that is important for ligand recognition and signal transduction and is involved in many physiological processes, including immune response and signal transduction [21,22,23]. Species differ in the number and kind of LRR domains [24]. But the TIR domain is rather conservative. It primarily contributes to TLR signal transmission and localization, which is essential for innate immunity. Through homotropic interactions, TIR enlists downstream TIR-containing signaling molecules to create a signaling complex [25,26]. Three conserved functional domains (Box1, Box2, and Box3) are found in the TIR domain. Box is a conserved amino acid sequence of the TIR domain, which is closely related to the signaling function. The boxes were discovered to be present in the TIR domain of each species of TLR by comparing their TIR domains [27]. Research has indicated that the TIR domain signal transduction is significantly influenced by Box1, that the dimerization and recruitment of adaptor proteins in the TIR domain are determined by the Bbloop site in the Box2 region, and that the functional intracellular region of TLR signal transduction, the Box3 region, is involved in directing the localization of the receptor [7,28]. The binding of TIR to proteins linked to signal transduction is facilitated by both Box1 and Box2. Through the results of multiple alignment of protein sequences and phylogenetic trees, we can see that the extracellular LRR domain of PsTLR2, PsTLR3, and PsTLR5 was less conserved. The amino acid sequences of PsTLR2 and PsTLR5 each contain 11 LRR domains, similar to the number of LRR domains found in other turtles’ TLRs, such as Gopherus flavomarginatus TLR2 (XP_050802314.1), which has 11 LRR domains. Mauremys reevesii TLR2 (XP_039396763.1) has 10 LRR domains; Chelonoidis abingdonii TLR5 (XP_032643841.1) and Terrapene triunguis TLR5 (XP_024055424.2) have 12 LRR domains. The amino acid sequence of PsTLR3 contains 19 LRR domains, which is less than the number of LRR domains of TLR3 in other turtles. For example, G. flavomarginatus TLR3 (XP_050803453.1) and Gopherus evgoodei TLR3 (XP_030420382.1) have 21 LRR domains. PsTLR2 and PsTLR3 have more LRR domains than other vertebrates; for example, Megalobrama amblycephala TLR2 (XP_048053737.1) and Mus musculus TLR2 (NP_036035.3) have only eight LRR domains. Homo sapiens TLR3 (NP_003255.1) and M. musculus TLR3 (NP_001344245.1) have 18 LRR domains. Therefore, in most vertebrates, different TLR genes have different leucine-repeat structures in the extracellular region, suggesting that they also play different recognition mechanisms in the process of pathogen recognition. The TIR domains of PsTLR2, PsTLR3, and PsTLR5 were found to be highly conserved, and all of them contained three conserved box domains (box1, box2, and box3). This suggests that they stabilize efficient transduction signals, an important safeguard for the immune system against pathogens. This occurrence further demonstrated that the gene cloned was accurate.

The research revealed that PcTLR2 was significantly expressed in the intestine of Pseudosciaena crocea, whereas PcTLR3 was primarily expressed in the liver and then the intestine [29,30]. Carassius auratus’s liver, head kidney, and spleen all showed significant levels of CaTLR2 expression [31]. Micropterus salmoides’s head kidney showed high expression of MsTLR3 [32]. TLR5m was widely distributed in all tissues in Oncorhynchus mykiss, whereas TLR5s was primarily expressed in the liver [33]. These findings suggest that distinct TLR isoforms within a species exhibit varying tissue selectivity, and that distinct species exhibit distinct TLR gene expression profiles. TLR mRNA is often highly expressed in immunological tissues like the gut, spleen, liver, and kidney in all species. According to certain studies, the spleen, head kidney, and blood of fish all take part in the immune response, suggesting that the intestine, liver, spleen, and kidney are the key immune organs of aquatic animals and the primary locations where immune genes function to prevent pathogen invasion. P. sinensis was found to have higher expression levels of PsTLR2, PsTLR3, and PsTLR5 in the intestine, liver, spleen, and kidney than other tissues. This suggests that these tissues are the main sites for the synthesis and storage of the PsTLR2, PsTLR3, and PsTLR5 genes in P. sinensis. Although TLR genes have different expression patterns in different species, they are widely expressed in different tissues and organs, indicating that they play important roles in the immune system [29,30,31,32,33].

Numerous investigations have demonstrated that A. hydrophila can infect P. sinensis and result in a range of illnesses [34,35,36]. TLRs are crucial PRRs that have the ability to identify germs and trigger the immune system. Previous findings revealed that TLR gene expression changed after A. hydrophila infection in many aquatic animals, such as Danio rerio [37], Acipenser sinensis [38], and T. fulvidraco [39]. PsTLR2, PsTLR3, and PsTLR5 expression were also up-regulated following A. hydrophila infection in P. sinensis. TLR2 can recognize peptidoglycan, especially peptidoglycan from Gram-positive and Gram-negative bacteria, lipoproteins and lipopeptides, human cytomegalovirus (CMV) glycoprotein B, Mycobacterium tuberculosis antigens, and other small-molecule compounds [40]. TLR3 recognizes a variety of double-stranded RNA molecules, including viral dsRNA and synthetic dsRNA mimetics such as polyinosinic-polycytidylic acid (poly (I:C). In addition, TLR3 recognizes single-stranded RNAs (ssRNAs) and mRNAs, which may be derived from damaged host cells or tissues [41]. TLR5 is able to recognize flagellin from different bacterial species [42]. The expression of PsTLR2 and PsTLR5 was up-regulated in the early stage of infection, indicating that PsTLR2 and PsTLR5 recognized the peptidoglycan components and flagellin of invading A. hydrophila and triggered the immune response. However, PsTLR3 mainly recognizes viral RNA molecules and cannot respond to the invasion of A. hydrophila at the early stage of infection. At the late stage of infection, A. hydrophila may be phagocytosed and decomposed by macrophages in vivo to produce RNA molecules, which are recognized by PsTLR3 and begin to up-regulate its expression. This phenomenon suggests that TLRs play an important role in the immune process against bacterial invasion.

Analyzing the structure and function of proteins is crucial in post-genome research, and the most fundamental tool for this is an efficient protein expression system. Because E. coli expression systems are inexpensive and convenient, they are frequently employed to produce recombinant proteins [43,44,45]. Unfortunately, improper folding prevents the majority of recombinant proteins from forming soluble proteins [46]. In order to obtain more soluble target proteins, the cell can restrict the expression of other cellular proteins in the low-temperature environment by utilizing the CspA (cold shock protein A) promoter and related components found in the pCold-TF plasmid [47,48]. For instance, Hu used the pCold-TF vector to successfully express the recombinant protein BpEG01790 [49]. The zymography analysis along with SDS-PAGE verified that the recombinant protein was a soluble and active protein. Maya Uenobe used the pCold-TF prokaryotic expression method to successfully produce the soluble recombinant protein ayu TNF [50]. The pCold-TF expression system was also chosen for this investigation in order to create the recombinant plasmids pCold-TLR2-LRR, pCold-TLR3-LRR, and pCold-TLR5-LRR. Following IPTG induction, the recombinant plasmids successfully expressed the soluble proteins rPsTLR2, rPsTLR3, and rPsTLR5, as demonstrated by the SDS-PAGE results, which were in line with the anticipated outcomes. The acquisition of the proteins rPsTLR2, rPsTLR3, and rPsTLR5 gave rise to a solid foundation for additional research into the roles of PsTLR2, PsTLR3, and PsTLR5.

The primary pathogens that pose a threat to aquaculture include bacteria, fungi, and other microorganisms. Of particular concern are Gram-negative bacteria like A. hydrophila and V. parahaemolyticus, which have the potential to cause numerous diseases in aquatic animals and significantly impair aquaculture operations [34,35,36,51]. Numerous investigations have demonstrated the ability of TLR recombinant proteins to bind to harmful bacteria in vitro. For instance, Zhu discovered that TLR5 in Trachinotus ovatus could bind to A. hydrophila, S. aureus, E. coli, and Vibrio anguillarum [52]; Liu discovered that a recombinant protein of MaTLR14 from rice eel could bind to A. hydrophila, E. tarda, S. aureus, and Bacillus subtilis [53]. Wu discovered that TLR3 could attach itself to a variety of bacteria, including Photobacterium damselae, E. coli, A. hydrophila, S. aureus, and Vibrio harveyi, Vibrio vulnificus, and Vibrio anguatus [54]. The outcomes of this chapter demonstrated that P. sinensis’s recombinant proteins rPsTLR2, rPsTLR3, and rPsTLR5 could bind to microbes as well. Compared to rPsTLR2 and rPsTLR5, rPsTLR3’s capacity to bind to microorganisms was less potent at the same binding concentration. Gram-negative bacteria were more resistant to rPsTLR2’s binding than Gram-positive bacteria were, while fungi were more resistant to rPsTLR5’s binding than rPsTLR2. These findings demonstrated that PsTLR2, PsTLR3, and PsTLR5 are capable of identifying microorganisms. They can also function as pattern recognition receptors to identify pathogens, transfer immunological data, and have a significant impact on the immune system’s reaction to antibiotics.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes15091230/s1, Figure S1: Amino acid sequence alignment of PsTLR2 and XM_025185305.1 (“*” indicates sequence identity; “Spaces” indicate sequence inconsistencies; the length of the sequence is marked by the red box). Figure S2 Amino acid sequence alignment of PsTLR3 and XM_014576247.2 (“*” indicates sequence identity; “Space” and “Red triangle” indicate sequence inconsistencies; the length of the sequence is marked by the red box). Figure S3 Amino acid sequence alignment of PsTLR5 and XM_025180981.1 (“*” indicates sequence identity; “Spaces” indicate sequence inconsistencies; the length of the sequence is marked by the red box).

Author Contributions

Conceptualization, P.W.; Software, H.Z.; Formal analysis, L.G.; Investigation, Z.W.; Data curation, S.X.; Writing—original draft, Y.T.; Writing—review & editing, Y.H.; Supervision, X.W. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The animal experiments were according to the rules of the Animal Care and Use Committee of Hunan Agricultural University (Changsha, China; Approval Code: 202004297; Approval Date: 9 February 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This work was supported by National Natural Science Foudation of China (grant number 32102839) and Natual Science Foudation of man Province (grant number 2022J140167).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Janeway C.A., Medzhitov R. Innate Immune Recognition. Annu. Rev. Immunol. 2002;20:197–216. doi: 10.1146/annurev.immunol.20.083001.084359. [DOI] [PubMed] [Google Scholar]
  • 2.Suresh R., Mosser D.M. Pattern recognition receptors in innate immunity, host defense, and immunopathology. Adv. Physiol. Educ. 2013;37:284–291. doi: 10.1152/advan.00058.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Boltaña S., Roher N., Goetz F.W., MacKenzie S.A. PAMPs, PRRs and the genomics of gram negative bacterial recognition in fish. Dev. Comp. Immunol. 2011;35:1195–1203. doi: 10.1016/j.dci.2011.02.010. [DOI] [PubMed] [Google Scholar]
  • 4.Akira S., Uematsu S., Takeuchi O. Pathogen Recognition and Innate Immunity. Cell. 2006;124:783–801. doi: 10.1016/j.cell.2006.02.015. [DOI] [PubMed] [Google Scholar]
  • 5.Akira S., Takeda K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004;4:499–511. doi: 10.1038/nri1391. [DOI] [PubMed] [Google Scholar]
  • 6.Kawai T., Akira S. TLR signaling. Cell Death Differ. 2006;13:816–825. doi: 10.1038/sj.cdd.4401850. [DOI] [PubMed] [Google Scholar]
  • 7.O’Neill L.A.J., Bowie A.G. The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling. Nat. Rev. Immunol. 2007;7:353–364. doi: 10.1038/nri2079. [DOI] [PubMed] [Google Scholar]
  • 8.Takeuchi O., Akira S. Pattern Recognition Receptors and Inflammation. Cell. 2010;140:805–820. doi: 10.1016/j.cell.2010.01.022. [DOI] [PubMed] [Google Scholar]
  • 9.Habib Y.J., Zhang Z. The involvement of crustaceans toll-like receptors in pathogen recognition. Fish Shellfish Immunol. 2020;102:169–176. doi: 10.1016/j.fsi.2020.04.035. [DOI] [PubMed] [Google Scholar]
  • 10.Palti Y. Toll-like receptors in bony fish: From genomics to function. Dev. Comp. Immunol. 2011;35:1263–1272. doi: 10.1016/j.dci.2011.03.006. [DOI] [PubMed] [Google Scholar]
  • 11.Zhou Z., Lin Z., Pang X., Shan P., Wang J. MicroRNA regulation of Toll-like receptor signaling pathways in teleost fish. Fish Shellfish Immunol. 2018;75:32–40. doi: 10.1016/j.fsi.2018.01.036. [DOI] [PubMed] [Google Scholar]
  • 12.Kirschning C.J., Schumann R.R. TLR2: Cellular sensor for microbial and endogenous molecular patterns. Curr. Top. Microbiol. Immunol. 2002;270:121–144. doi: 10.1007/978-3-642-59430-4_8. [DOI] [PubMed] [Google Scholar]
  • 13.De Oliviera Nascimento L., Massari P., Wetzler L.M. The Role of TLR2 in Infection and Immunity. Front. Immunol. 2012;3:79. doi: 10.3389/fimmu.2012.00079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wetzler L.M. The role of Toll-like receptor 2 in microbial disease and immunity. Vaccine. 2003;21((Suppl. S2)):S55–S60. doi: 10.1016/S0264-410X(03)00201-9. [DOI] [PubMed] [Google Scholar]
  • 15.Matsumoto M., Seya T. TLR3: Interferon induction by double-stranded RNA including poly(I:C) Adv. Drug Deliv. Rev. 2008;60:805–812. doi: 10.1016/j.addr.2007.11.005. [DOI] [PubMed] [Google Scholar]
  • 16.Miao E.A., Andersen-Nissen E., Warren S.E., Aderem A. TLR5 and Ipaf: Dual sensors of bacterial flagellin in the innate immune system. Semin. Immunopathol. 2007;29:275–288. doi: 10.1007/s00281-007-0078-z. [DOI] [PubMed] [Google Scholar]
  • 17.Liu T., Han Y., Chen S., Zhao H. Genome-wide identification of Toll-like receptors in the Chinese soft-shelled turtle Pelodiscus sinensis and expression analysis responding to Aeromonas hydrophila infection. Fish Shellfish Immunol. 2019;87:478–489. doi: 10.1016/j.fsi.2019.01.052. [DOI] [PubMed] [Google Scholar]
  • 18.Lv Z., Hu Y., Tan J., Wang X., Liu X., Zeng C. Comparative Transcriptome Analysis Reveals the Molecular Immunopathogenesis of Chinese Soft-Shelled Turtle (Trionyx sinensis) Infected with Aeromonas hydrophila. Biology. 2021;10:1218. doi: 10.3390/biology10111218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang J., Wang F., Jiang Y.-L., Hou G.-J., Cheng Y.-S., Chen H.-L., Li X. Modern greenhouse culture of juvenile soft-shelled turtle, Pelodiscus sinensis. Aquac. Int. 2017;25:1607–1624. doi: 10.1007/s10499-017-0137-y. [DOI] [Google Scholar]
  • 20.Livak K.J., Schmittgen T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 21.Lai R., Liu H., Jakovlić I., Zhan F., Wei J., Yang P., Wang W. Molecular cloning and expression of toll-like receptor 4 (tlr4) in the blunt snout bream (Megalobrama amblycephala) Dev. Comp. Immunol. 2016;59:63–76. doi: 10.1016/j.dci.2016.01.009. [DOI] [PubMed] [Google Scholar]
  • 22.Leulier F., Lemaitre B. Toll-like receptors—Taking an evolutionary approach. Nat. Rev. Genet. 2008;9:165–178. doi: 10.1038/nrg2303. [DOI] [PubMed] [Google Scholar]
  • 23.Matsushima N., Tachi N., Kuroki Y., Enkhbayar P., Osaki M., Kamiya M., Kretsinger R.H. Structural analysis of leucine-rich-repeat variants in proteins associated with human diseases. Cell. Mol. Life Sci. CMLS. 2005;62:2771–2791. doi: 10.1007/s00018-005-5187-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bell J.K., Mullen G.E.D., Leifer C.A., Mazzoni A., Davies D.R., Segal D.M. Leucine-rich repeats and pathogen recognition in Toll-like receptors. Trends Immunol. 2003;24:528–533. doi: 10.1016/S1471-4906(03)00242-4. [DOI] [PubMed] [Google Scholar]
  • 25.Ofir G., Herbst E., Baroz M., Cohen D., Millman A., Doron S., Tal N., Malheiro D.B.A., Malitsky S., Amitai G., et al. Antiviral activity of bacterial TIR domains via immune signalling molecules. Nature. 2021;600:116–120. doi: 10.1038/s41586-021-04098-7. [DOI] [PubMed] [Google Scholar]
  • 26.Toshchakov V.Y., Neuwald A.F. A survey of TIR domain sequence and structure divergence. Immunogenetics. 2020;72:181–203. doi: 10.1007/s00251-020-01157-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ota F., Monika A., Roman J. Suppression of TLR Signaling by Targeting TIR domain-Containing Proteins. Curr. Protein Pept. Sci. 2012;13:776–788. doi: 10.2174/138920312804871148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Slack J.L., Schooley K., Bonnert T.P., Mitcham J.L., Qwarnstrom E.E., Sims J.E., Dower S.K. Identification of Two Major Sites in the Type I Interleukin-1 Receptor Cytoplasmic Region Responsible for Coupling to Pro-inflammatory Signaling Pathways*. J. Biol. Chem. 2000;275:4670–4678. doi: 10.1074/jbc.275.7.4670. [DOI] [PubMed] [Google Scholar]
  • 29.Ao J., Mu Y., Wang K., Sun M., Wang X., Chen X. Identification and characterization of a novel Toll-like receptor 2 homologue in the large yellow croaker Larimichthys crocea. Fish Shellfish Immunol. 2016;48:221–227. doi: 10.1016/j.fsi.2015.11.002. [DOI] [PubMed] [Google Scholar]
  • 30.Huang X.-N., Wang Z.-Y., Yao C.-L. Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol. 2011;31:98–106. doi: 10.1016/j.fsi.2011.04.009. [DOI] [PubMed] [Google Scholar]
  • 31.Ishii A., Kawasaki M., Matsumoto M., Tochinai S., Seya T. Phylogenetic and expression analysis of amphibian Xenopus Toll-like receptors. Immunogenetics. 2007;59:281–293. doi: 10.1007/s00251-007-0193-y. [DOI] [PubMed] [Google Scholar]
  • 32.Zhao Z., Liu S., Wu C., Wang Q., Zhang Y., Wang B., Wang L., Sun R., Guo M., Ji W. Bioinformatics characteristics and expression analysis of TLR3 and its adaptor protein TRIF in largemouth bass (Micropterus salmoides) upon Flavobacterium columnare infection. Gene. 2023;872:147450. doi: 10.1016/j.gene.2023.147450. [DOI] [PubMed] [Google Scholar]
  • 33.Tsujita T., Tsukada H., Nakao M., Oshiumi H., Matsumoto M., Seya T. Sensing bacterial flagellin by membrane and soluble orthologs of Toll-like receptor 5 in rainbow trout (Onchorhynchus mikiss) J. Biol. Chem. 2004;279:48588–48597. doi: 10.1074/jbc.M407634200. [DOI] [PubMed] [Google Scholar]
  • 34.Chung T.H., Yi S.W., Kim B.S., Kim W.I., Shin G.-W. Identification and antibiotic resistance profiling of bacterial isolates from septicaemic soft-shelled turtles (Pelodiscus sinensis) Vet. Med. 2017;62:169–177. doi: 10.17221/65/2016-VETMED. [DOI] [Google Scholar]
  • 35.Zhou X., Guo Q., Dai H. Identification of differentially expressed immune-relevant genes in Chinese soft-shelled turtle (Trionyx sinensis) infected with Aeromonas hydrophila. Vet. Immunol. Immunopathol. 2008;125:82–91. doi: 10.1016/j.vetimm.2008.05.008. [DOI] [PubMed] [Google Scholar]
  • 36.Zhou X., Wang L., Feng H., Guo Q., Dai H. Acute phase response in Chinese soft-shelled turtle (Trionyx sinensis) with Aeromonas hydrophila infection. Dev. Comp. Immunol. 2010;35:441–451. doi: 10.1016/j.dci.2010.11.011. [DOI] [PubMed] [Google Scholar]
  • 37.Luo K., Di J., Han P., Zhang S., Xia L., Tian G., Zhang W., Dun D., Xu Q., Wei Q. Transcriptome analysis of the critically endangered Dabry’s sturgeon (Acipenser dabryanus) head kidney response to Aeromonas hydrophila. Fish Shellfish Immunol. 2018;83:249–261. doi: 10.1016/j.fsi.2018.09.044. [DOI] [PubMed] [Google Scholar]
  • 38.Meijer A., Krens S.F., Rodriguez I., He S., Bitter W., Snaar-Jagalska B.E., Spaink H. Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Mol. Immunol. 2004;40:773–783. doi: 10.1016/j.molimm.2003.10.003. [DOI] [PubMed] [Google Scholar]
  • 39.Blasius A., Beutler B. Intracellular Toll-like Receptors. Immunity. 2010;32:305–315. doi: 10.1016/j.immuni.2010.03.012. [DOI] [PubMed] [Google Scholar]
  • 40.Komai-Koma M., Jones L., Ogg G.S., Xu D., Liew F.Y. TLR2 is expressed on activated T cells as a costimulatory receptor. Proc. Natl. Acad. Sci. USA. 2004;101:3029–3034. doi: 10.1073/pnas.0400171101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bell J.K., Botos I., Hall P.R., Askins J., Shiloach J., Davies D.R., Segal D.M. The molecular structure of the TLR3 extracellular domain. J. Endotoxin Res. 2006;12:375–378. doi: 10.1177/09680519060120060801. [DOI] [PubMed] [Google Scholar]
  • 42.Letran S.E., Lee S.-J., Atif S.M., Uematsu S., Akira S., McSorley S.J. TLR5 functions as an endocytic receptor to enhance flagellin-specific adaptive immunity. Eur. J. Immunol. 2011;41:29–38. doi: 10.1002/eji.201040717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Hannig G., Makrides S.C. Strategies for optimizing heterologous protein expression in Escherichia coli. Trends Biotechnol. 1998;16:54–60. doi: 10.1016/S0167-7799(97)01155-4. [DOI] [PubMed] [Google Scholar]
  • 44.Rosano G., Ceccarelli E. Recombinant protein expression in Escherichia coli: Advances and challenges. Front. Microbiol. 2014;5:172. doi: 10.3389/fmicb.2014.00172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhang Z.-X., Nong F.-T., Wang Y.-Z., Yan C.-X., Gu Y., Song P., Sun X.-M. Strategies for efficient production of recombinant proteins in Escherichia coli: Alleviating the host burden and enhancing protein activity. Microb. Cell. Fact. 2022;21:191. doi: 10.1186/s12934-022-01917-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Baneyx F. Recombinant protein expression in Escherichia coli. Curr. Opin. Biotechnol. 1999;10:411–421. doi: 10.1016/S0958-1669(99)00003-8. [DOI] [PubMed] [Google Scholar]
  • 47.Mayer M., Buchner J. Refolding of Inclusion Body Proteins. Humana Press; Totowa, NJ, USA: 2004. [DOI] [PubMed] [Google Scholar]
  • 48.Saini P., Wani S., Kumar R., Chhabra R., Chimni S., Sareen D. Trigger Factor Assisted Folding of the Recombinant Epoxide Hydrolases Identified from C. pelagibacter and S. nassauensis. Protein Expr. Purif. 2014;104:71–84. doi: 10.1016/j.pep.2014.09.004. [DOI] [PubMed] [Google Scholar]
  • 49.Hu X., Guangsen F., Liao H., Zhilei F., Ma C., Ni H., Li X. Optimized soluble expression of a novel endoglucanase from Burkholderia pyrrocinia in Escherichia coli. 3 Biotech. 2020;10:387. doi: 10.1007/s13205-020-02327-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Uenobe M., Kohchi C., Yoshioka N., Yuasa A., Inagawa H., Morii K., Nishizawa T., Takahashi Y., Soma G. Cloning and characterization of a TNF-like protein of Plecoglossus altivelis (ayu fish) Mol. Immunol. 2007;44:1115–1122. doi: 10.1016/j.molimm.2006.07.281. [DOI] [PubMed] [Google Scholar]
  • 51.Odeyemi O.A. Incidence and prevalence of Vibrio parahaemolyticus in seafood: A systematic review and meta-analysis. Springerplus. 2016;5:464. doi: 10.1186/s40064-016-2115-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Liu R., Qi Y., Feng H., Niu Y., Zhang F., Yang G., Shan S. Fish-specific Toll-like receptor 14 (TLR14) from Asian swamp eel (Monopterus albus) is involved in immune response to bacterial infection. Fish Shellfish Immunol. 2022;124:313–323. doi: 10.1016/j.fsi.2022.04.010. [DOI] [PubMed] [Google Scholar]
  • 53.Zhu K.C., Wu M., Zhang D.C., Guo H.Y., Zhang N., Guo L., Liu B.S., Jiang S.G. Toll-Like Receptor 5 of Golden Pompano Trachinotus ovatus (Linnaeus 1758): Characterization, Promoter Activity and Functional Analysis. Int. J. Mol. Sci. 2020;21:5916. doi: 10.3390/ijms21165916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wu M., Zhu K.C., Guo H.Y., Guo L., Liu B., Jiang S.G., Zhang D.C. Characterization, expression and function analysis of the TLR3 gene in golden pompano (Trachinotus ovatus) Dev. Comp. Immunol. 2021;117:103977. doi: 10.1016/j.dci.2020.103977. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials, further inquiries can be directed to the corresponding author.


Articles from Genes are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES