Phenotypic and genotypic analysis of drug resistance in M. tuberculosis isolates in Gansu, China

Yousheng Peng; Chenchen Li; Xueke Hui; Xiaoning Huo; Nigus Abebe Shumuyed; Zhong Jia

doi:10.1371/journal.pone.0311042

. 2024 Sep 27;19(9):e0311042. doi: 10.1371/journal.pone.0311042

Phenotypic and genotypic analysis of drug resistance in M. tuberculosis isolates in Gansu, China

Yousheng Peng ¹, Chenchen Li ¹, Xueke Hui ², Xiaoning Huo ³, Nigus Abebe Shumuyed ⁴, Zhong Jia ^1,^5,^*

Editor: Salman Sadullah Usmani⁶

PMCID: PMC11432870 PMID: 39331607

Abstract

Tuberculosis has posed a serious threat to human health. It is imperative to investigate the geographic prevalence of tuberculosis and medication resistance, as this information is essential for informing strategies for its prevention and treatment. Drug resistance was identified using a proportion method. Drug-resistant genes and pathways were predicted using whole genome sequencing. The drug resistance range of bedaquiline was identified using the microporous plate two-fold dilution method, and drug resistance genes were studied using sequencing. The study revealed that 19.99% of the tuberculosis cases had multidrug resistance. The genes of M. tuberculosis are predominantly involved in the synthesis of ABC transporters, two-component systems, and bacterial secretion systems, as well as in energy production and conversion, and lipid transport and metabolism. The genes encode for 82.45% of carbohydrate-related enzymes such as glycoside hydrolases, glycosyl transferases, and carbohydrate esterases. The minimum inhibitory concentration (MIC) of bedaquiline against clinical strains was approximately 0.06 μg/mL, with identified mutations in drug-resistant genes Rv0678, atpE, and pepQ, specifically V152A, P62A, and T222N, respectively. The multidrug resistance tuberculosis development was attributed to the strong medication resistance exhibited. It was concluded that tuberculosis had presented a high level of drug resistance. Phenotypic resistance was related to genes, existing potential genetic resistance in M. tuberculosis. Bedaquiline was found to possess effective antibacterial properties against M. tuberculosis.

Introduction

Tuberculosis, one of the most ancient diseases to afflict humans, necessitates a prolonged course of multidrug therapy even in cases of latent infection, despite the extensive history of treatment experience [1]. Estimates suggest that globally, approximately 1.7 billion individuals were infected with Mycobacterium tuberculosis (M. tuberculosis), leading to over 10 million new cases of the disease annually and resulting in latent tuberculosis in 2.2 billion individuals [2]. Drug-resistant tuberculosis poses a significant public health challenge in numerous countries, with the increasing prevalence of drug-resistant M. tuberculosis complicating the treatment of tuberculosis [3]. The treatment effect of multidrug resistance tuberculosis is poor and the treatment cycle is long [4]. However, a small number of patients with multidrug resistance to tuberculosis were treated with medications such as bedaquiline, linezolid, and clofaczimine, among others, resulting in enhanced therapeutic outcomes as determined by genetic and phenotypic drug susceptibility testing [5]. Drug-resistant tuberculosis responds well to bedaquiline, an anti-tuberculosis medication [6]. While bedaquiline is currently included in the treatment regimen for tuberculosis, its clinical utilization remains restricted due to limited experience [7–9]. It specifically interferes with the action of F-ATP synthase, which prevents the synthesis of ATP [10,11]. Bedaquiline demonstrates limited cross-resistance with other anti-tuberculosis medications in vitro due to its specific enzyme target. Furthermore, bedaquiline has been shown to enhance the therapeutic effectiveness of linezolid, thus highlighting its potential utility in the treatment of tuberculosis and reducing the prevalence of drug-resistant strains and associated mortality rates [12,13]. However, phenotypic susceptibility testing and drug resistance gene analysis must be ongoing when new medications are added to the treatment regimen [14]. Mutations in the genes Rv0678 or atpE [15] are the main causes of M. tuberculosis’s resistance to bedaquiline. However, mutations in the gene PepQ can also result in bedaquiline resistance in M. tuberculosis [16]. Therefore, the detection of mutations in genes associated with drug resistance can facilitate the implementation of early treatment strategies for tuberculosis, ultimately improving the prognosis of the disease. Whole-genome sequencing is a valuable tool for accurately identifying drug-resistant strains of tuberculosis by predicting drug susceptibility, gene functionality, resistance mechanisms, and other relevant characteristics [17]. Despite the proven efficacy of bedaquiline in treating tuberculosis, there is a lack of comprehensive information on tuberculosis treatment, including the absence of established guidelines for antibiotic concentrations against clinical strains M. tuberculosis. The identification of the bedaquiline resistance gene in M. tuberculosis, the initial site of its widespread application, establishes a significant milestone in the understanding of the efficacy of bedaquiline and other diarylquinoline-based medications. This study will lay the foundation for the future utilization of bedaquiline in clinical settings.

Materials and methods

From February 2018 and July 2019, a total of 2,136 cases containing M. tuberculosis strains were collected from clinical samples at Lanzhou Pulmonary Hospital (Gansu, China). The Tuberculosis Diagnosis and Treatment Guidelines established by the Chinese Medical Association’s Tuberculosis Society were utilized as the basis for diagnosis. All samples were systematically coded, with the investigation focusing solely on the demographic variables of sex and age. The yinke medicine supplied the Lowenstein-Jensen medium kit for the cultivation of drug-resistant M. tuberculosis, while a liquid culture media for mycobacteria was procured from Beso Biotechnology.

Drug resistance detection

Selected M. tuberculosis colonies in the logarithmic stage of growth were transferred into grinding tubes containing glass beads and 0.5% Tween80, which were then mounted on oscillators and agitated to achieve a cheese-like appearance. The bacteria were subsequently diluted with normal saline and combined with a bacterial suspension of 1×10⁸CFU/mL. Further dilutions were made to achieve concentrations of 1×10⁶CFU/mL and 1×10⁴CFU/mL for turbidimetric analysis in a McBurnish tube. Ten drugs, such as isoniazid, rifampicin, ethambutol, streptomycin, kanamycin, levofloxacin, capreomycin, amikacin, moxifloxacin, and pyrazinamide, were assessed for drug resistance in all samples through the proportionate method. The bacterial liquid was evenly spread over the medium containing different anti-tuberculosis medications using a single ring (0.01 mL) of the diluted bacterial solution and 22 SWG standard inoculation rings, respectively, following the marking approach. Following injection, the specimens were cultivated at 37°C, and the results were documented after a period of four weeks. Various criteria for assessing medication resistance include monoresistance (resistance to one first-line anti-tuberculosis drug only), polydrug resistance ((resistance to more than one first-line anti-tuberculosis drug (other than both isoniazid and rifampicin)), multidrug resistance (resistance to at least both isoniazid and rifampicin), and extensive drug resistance (resistance to any fluoroquinolone and to at least one of three second-line injectable drugs (capreomycin, kanamycin and amikacin), in addition to multidrug resistance).

Drug sensitivity detection

Two hundred eight strains exhibiting known phenotypic resistance were randomly selected for analysis, and their resistance to bedaquiline was assessed in liquid culture media using the microporous plate dilution method. A standard control was established by introducing 100 uL of liquid medium into the second microplate well. Bedaquiline was serially diluted concentrations ranging from 4–0.008 g/mL in 10-fold increments from the third to the twelfth Well, with 100 uL of the diluted solution added to each well for testing. The inoculation of 100 uL of diluted bacterial liquid (1×10⁶CFU/mL) into wells two through twelve resulted in a final drug concentration that ranged from 0.004μg/mL to 2μg/mL and a bacterial count of 5×10⁵CFU/mL. Following inoculation, resazurin was added to each well and the microporous plates were inoculated at 37°C for one week. Results were then reported within 24 hours. The MIC of the medicine against the strain is believed to be the highest concentration well exhibiting a color change from blue to red.

DNA extraction and sequencing

A nucleotide was extracted from the chosen strains utilizing the Bacterial Genome DNA Extraction Kit following the guidelines provided by the manufacturer (Tiangen Biotech Co., LTD). The three primary drug-resistant gene sequences were amplified using PCR. The primer sequences for the drug-resistant bedaquiline genes Rv0678, atpE, and pepQ are presented in Table 1. The sequencing of the bedaquiline resistance genes Rv0678, atpE, and pepQ from 208 clinical strains was conducted according to a standardized protocol. The PCR reaction conditions included pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 62°C (Rv0678 and pepQ) and 58°C (atpE) for 30 seconds, and elongation at 72°C for 30 seconds, repeated for 35 times. Sanger Sequencing was performed on the PCR products at Lanzhou Tianqi Gene Co., LTD, and the resulting sequences were analyzed using DNAMAM software to align with the M. tuberculosis H37Rv (NC 000963.3) reference genome for mutation identification.

Table 1. Primer synthesis of three genes.

Primer	Sequence (5´ to 3´)	TM valve(°C)
Rv0678_F Rv0678_R	`GTGAGCGTCAACGACGGG` `TCAGTCGTCCTCTCCGG`	62 62
atpE_F atpE_R	`ATGGACCCCACTATCGCTGC` `TTACTTGACGGGTGTAGCGAA`	58 58
PE(F) PE(R)	`GTGACACATTCCCAGCGTCGAG` `GGAGCCCGCCAGTAGTGTACC`	62 62

Open in a new tab

The sequencing process utilized Oxford Nanopore Technologies. Specifically, M. tuberculosis strains with known resistance phenotypes were cultured to logarithmic growth periods, colonies were selected and stored in freeze tubes using inoculation loops, high-speed centrifugation was employed to ensure colony placement at the bottom of the tube, and the tube were subsequently frozen in liquid nitrogen for a minimum of 3 hours before being sent to Beijing Biomarker Technologies Co., Ltd for sequencing with Oxford Nanopore Technologies. The genome assembly was analyzed using a combination of bioinformatics tools, including RepeatMasker, Prodigal, tRNAscan-SE, GenBlastA, CRTIslandPath-DIMOB, and PhiSpy, to identify a diverse array of repetitive-sequence coding genes, noncoding genes, pseudogenes, and genomic islands. Subsequently, gene sequences were further refined and annotated using the GO, COG, and KEGG databases, as well as proprietary databases such as Cazyme and ARDB.

Statistical analysis

The experiments were conducted in triplicate, following established protocols for sample collection as referenced in the literature [18,19]. The data from this study were organized in Excel 2017 and analyzed using SPSS 22.0 software. Descriptive analysis of the epidemiological characteristics of tuberculosis patients was performed using Origin 2017 Software.

Results

Detection of drug resistance of M. tuberculosis

Fig 1 presents statistics derived from 2,136 cases of clinical isolates of M. tuberculosis. Analysis revealed that the age range for tuberculosis infection spans from 3 to 88 years, with a peak incidence occurring between the ages of 21 and 30, as depicted in Fig 2. The overall drug resistance rate was 39.04%, with multidrug resistance exhibiting the highest prevalence and ethambutol demonstrating the lowest resistance among the medications studied. As shown in Fig 3, it illustrated the various drug-resistant M. tuberculosis such as multidrug resistance (19.99%), polydrug resistance (7.44%), extensive resistance (1.45%), and resistance to streptomycin (4.31%), isoniazid (2.76%), levofloxacin (1.97%), rifampin (0.56%), amikacin or capreomycin (0.37%) and ethambutol (0.19%). By depicting the drug resistance of tuberculosis in different age groups, the results showed that multidrug resistance was higher than other drug resistance types in all age groups, with the exception of the 71–80 stage, with a maximum of 28.74%. Widespread resistance was consistently lower than other types of drug resistance across all age groups, with the highest level observed at 2.99% in the 41–50 age group (Fig 4). Additionally, monoresistance reached a peaked of 13.16% in individuals aged 81 to 90, while resistance to multidrug resistance peaked at 10.45% in the 71–80 age group.

Fig 2 — Note: R (%) represents resistance level of samples; the abscissa represents the interval of different ages; the ordinate represents the number of cases at different ages.

Fig 3 — Note: The I, R, S, E, L, A/C, MDR, XDR, DMR are respectively monoresistance to isoniazid, rifampicin, streptomycin, ethambutol, levofloxacin, amikacin or capreomycin, multidrug resistance, extensive resistance, polydrug resistance; The RR, AR and A represent respectively resistance, total resistance and total samples.

Fig 4 — Note: The DMR, XDR, MDR and R represent respectively polydrug resistance, extensive resistance, multidrug resistance, monoresistance tuberculosis.

The complete sequence analysis of M. tuberculosis

By conducting an analysis of the entire genome sequence, it was determined that the genes of M. tuberculosis were involved in lipid transport and metabolism, amino acid transport and metabolism, as well as energy production and conversion (Figs 5 and 6). Additionally, it was found that the genes responsible for 82.45% of the enzymes related to carbohydrates encode glycoside hydrolases, glycosyl transferases, and carbohydrate esterases, as depicted in Fig 7. Fig 8 illustrated the involvement of ABC transporters, two-component systems, amino acid biosynthesis, carbon metabolism, citric acid cycle, fatty acid biosynthesis, and bacterial secretion systems as key areas of participation. Additionally, this study presented the prediction of M. tuberculosis gene map (Fig 9), along with the identification of mutations in the pentapeptide repeat family gene, undecenyl pyrophosphate phosphatase, and aminoglycoside N-acetyltransferase genes of M. tuberculosis.

Fig 6 — Note: The abscissa is the classification content of COG, and the ordinate is the number of genes. In different functional classes, the proportion of genes reflects the metabolic or physiological preferences in the corresponding period and environment.

Fig 8 — Note: The ordinate is KEGG secondary classification and the abscissa is percentage.

Fig 9 — Note: Circos visualizes the genome to more clearly explore the relationships between components or locations in the genome.

The drug sensitivity tests of bedaquiline to M. tuberculosis

A variety of M. tuberculosis strains were subjected to testing for bedaquiline resistance using both phenotypic and molecular techniques. The inhibitory concentration of bedaquiline was found to be predominantly at 0.060 g/mL across a range of MIC values, as depicted in Fig 10. Specifically, the MIC of bedaquiline against various clinical strains was determined as follows: 0.481% at 2.000μg/mL, 0.962% at 1.000μg/mL, 3.365% at 0.500μg/mL, 14.423% at 0.250μg/mL, 13.462% at 0.120μg/mL, 50% at 0.060μg/mL, 10.096% at 0.030μg/mL, 1.923% at 0.016μg/mL, 1.442% at 0.008μg/mL, and 3.846% at 0.004μg/mL.

Fig 10 — Note: Red dashed line represents resistance level of samples; The ordinate represents the probability of cases.

Bedaquiline drugs resistance gene analysis

In this study, three drug resistance genes were amplified and partial results were presented (Fig 11). The mutation rate was determined as the proportion of test strains exhibiting mutation. The results, as depicted in Table 2 and Fig 12, suggested an association between bedaquiline resistance and Rv0678, atpE, and pepQ. Specifically, the P62A mutation was identified in RV0678 with an 8.3% mutation rate. The atpE gene exhibited a mutation rate of 10.1%, predominantly displaying the V152A mutation, with additional mutations identified as G77R, S51F, E112K, and L141R. Furthermore, analysis of Table 2 revealed that the pepQ gene predominantly harbored the T222N mutation, which had a mutation rate of 4.1%. The highest prevalence of mutations associated with bedaquiline resistance were observed in the AtpE and Rv0678 genes, distributed in a seemingly random pattern throughout the Open Reading Framework.

Table 2. Mutation rates and mutation sites of drug-resistant genes.

gene	Mutation rate	main mutation	other mutation	reported mutations
atpE	8.2	P62A	D27G, V74L	D28V/P, E61D, I66M
Rv0678	5.8	V152A	G77R, S51F, E112K, L141R	S63R/G, R50Q, R107C
pepQ	3.4	T222N	\	G265T, T157C, R337L

Open in a new tab

Discussion

Tuberculosis poses a significant challenge to global public health, necessitating the implementation of a viable strategy and efficacious treatment measures [20]. To gain a comprehensive understanding of tuberculosis and the resistance M. tuberculosis to current anti-tuberculosis medications, as well as to establish a scientific foundation for tuberculosis prevention and treatment, our initial investigation focused on the resistance profiles of established clinical agents. Subsequently, we examined the inhibitory concentration and drug resistance of bedaquiline against M. tuberculosis. The drug resistance model developed from this research may present viable treatment options for tuberculosis and enhance clinical efficacy [21]. The emergence of drug-resistant tuberculosis has posed substantial challenges to the prevention and treatment of tuberculosis. Isoniazid, a key component of first-line tuberculosis therapy, exhibits a notable resistance rate of 2.76% against M. tuberculosis [22]. The dynamic alterations and mechanisms associated with isoniazid resistance mutations in M. tuberculosis remain incompletely understood, despite the infrequent occurrence of isoniazid mono-resistance. The article indicates a notable increase in the proportion of M. tuberculosis strains exhibiting resistance to isoniazid compared to previous years. Furthermore, the escalation in cases of M. tuberculosis carrying an inhA mutation resistant to isoniazid may be associated with previous exposure to propioniazid [23,24]. Isoniazid exhibits the highest rate of drug resistance among all substances, with drug resistance rates for tuberculosis relapse surpassing those for tuberculosis onset [25]. In the Xi’an investigation, multidrug resistance accounted for 24.4% of the total resistance of M. tuberculosis, which was determined to be 39.0% [26]. Conversely, in Dalian city, there has been a notable reduction in both overall drug resistance and multidrug resistance rates for tuberculosis in recent years, with monoresistance accounting for approximately half of the total drug resistance [27]. The lack of reliability of rifampicin resistance as a biomarker for detecting multidrug resistant tuberculosis necessitates the use of techniques capable of identifying both rifampicin and isoniazid resistance in order to develop an effective treatment plan for tuberculosis [28]. The results indicated an overall tuberculosis drug resistance rate of 39.04% and a multidrug resistance rate of 19.99%. Analysis of the samples revealed a higher resistance to ethambutol and streptomycin compared to other monoresistance. The aforementioned findings suggest a potentially elevated rate of tuberculosis drug resistance in the region. The work can offer insight into tuberculosis treatment and establishes the groundwork for M. tuberculosis studies in Gansu province.

The utilization of whole-genome sequencing is increasingly essential in the diagnosis and research of tuberculosis due to its ability to rapidly identify medication resistance, characterize strains, and provide data for genotyping. Whole-genome sequencing for diverse M. tuberculosis strains demonstrates high accuracy in species identification, consistent mapping of drug resistance compared to drug sensitivity testing, and early detection of drug resistance prior to sensitivity testing [29–31]. The findings of this study indicate that gene mutations are responsible for the bacitracin and fluoroquinolone resistance phenotypes in M. tuberculosis. The resistance to these medications, particularly fluoroquinolones, is expected based on theoretical considerations. Further investigation into the mechanisms underlying this resistance is warranted. Whole-genome sequencing can help identify new mutation sites and elucidate the pathways leading to drug-resistant mutations, facilitating early detection of drug-resistant tuberculosis. Genome analysis revealed that the ofloxacin resistance in M. tuberculosis is not solely attributed to the DNA gyrase mutation, as the V762G mutation also plays a significant role in reducing the drug’s sensitivity. Furthermore, the drug efflux mechanism was determined not to be a contributing factor to M. tuberculosis’s ofloxacin resistance [32]. Whole-genome sequencing can be utilized to identify novel mutations associated with drug resistance. The results demonstrate that the M. tuberculosis gene plays a significant role in regulating the primary membrane material transit, center carbon metabolism, and secretion system. The M. tuberculosis proprotein transferase subunit family (SecD, SecEThe, SecA, and YajC), membrane insertion protease, fusion signal recognition particle receptor, and signal recognition particle subunit SRP54 are all components of the bacterial secretion system. Analysis of the genome allows for a comprehensive understanding of gene distribution, protein functions, and biological processes within M. tuberculosis

The implementation of rapid molecular detection significantly improves the accuracy level of tuberculosis by directly identifying M. tuberculosis and drug treatment resistance in clinical specimens. This approach accelerates the administration of anti-tuberculosis drugs and reduces the duration of tuberculosis treatment [33]. Drug sensitivity tests is essential in conjunction with appropriate tuberculosis therapy as it can identify the emergence of bedaquiline resistance at an early stage [34]. Bedaquiline exhibited potent activity against M. tuberculosis with a MIC of 0.062μg/mL, along with moderate efficacy against non-M. tuberculosis strains [35]. Resazurin microtitration revealed bedaquiline MIC values ranging from 0.0039 to 0.25 μg/mL against M. tuberculosis strains in Latin America [36]. In the present investigation, the MICs of bedaquiline against M. tuberculosis exhibited a range of 0.004 μg/mL to 2 μg/mL, with the 50% strain demonstrating a MIC concentration of 0.06 μg/mL, aligning closely with the study’s results. Nevertheless, clinical resistance to bedaquiline has been observed in M. tuberculosis.The predominant factors contributing to bedaquiline resistance were identified as mutations in either Rv0678 or atpE. Initially, mutations in Rv0678 were associated with low-level resistance, followed by mutations in atpE leading to high-level resistance.

The study results indicated that the Rv0678 and atpE genes exhibited the highest frequency of V152A and P62A mutations, respectively, with the pepQ gene showing the highest occurrence of T222N mutations. The site of mutations in bedaquiline resistance genes detected in this experiment have not been reported in previous studies. It should be noted that these findings are specific to tuberculosis within the national context, as Gansu Province serves as a representative region. Furthermore, alterations in the Rv0678 and atpE genes were identified, and treatment with bedaquiline resulted in an increase in the MICs against M. tuberculosis [37]. The M. tuberculosis strains exhibiting extensive drug resistance have shown notable efficacy against bedaquiline and clofazmin in China. Early detection and treatment of tuberculosis may contribute to the emergence of bedaquiline resistance [38]. The study results indicate that bedaquiline is an effective treatment for tuberculosis, with a critical resistance concentration of 0.06 μg/mL. These findings offer valuable insights for future research and utilization of bedaquiline in the management of M. tuberculosis infections.

Supporting information

S1 File

(XLSX)

pone.0311042.s001.xlsx^{(142.6KB, xlsx)}

S1 Raw image

(PDF)

pone.0311042.s002.pdf^{(384.2KB, pdf)}

Acknowledgments

We thank Chongxiang Tong, attending physicians at Lanzhou Pulmonary Hospital, for their useful discussions and support. We would also like to thank Bo Yu, President, for providing the experimental platform at the Second People’s Hospital of Lanzhou City. We would also like to thank Jin Wu, physicians at Traditional Chinese Medicine Hospital of Lanzhou City.

Data Availability

All relevant data are within the paper and its Supporting Information files. Additional large data sets are made available via the Dryad public repository, DOI:10.5061/dryad.r4xgxd2np.

Funding Statement

This study was supported by Natural Science Foundation of Gansu Province (18JR3RA417). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Tornheim JA, Dooley KE. The Global Landscape of Tuberculosis Therapeutics. Annual Review of Medicine. 2019. Jan 27; 70:105–120. doi: 10.1146/annurev-med-040717-051150 . [DOI] [PubMed] [Google Scholar]
2.Daley CL. The Global Fight Against Tuberculosis. Thoracic Surgery Clinics. 2019. Feb; 29(1):19–25. doi: 10.1016/j.thorsurg.2018.09.010 . [DOI] [PubMed] [Google Scholar]
3.Miryala SK, Anbarasu A, Ramaiah S. Impact of bedaquiline and capreomycin on the gene expression patterns of multidrug-resistant Mycobacterium tuberculosis H37Rv strain and understanding the molecular mechanism of antibiotic resistance. Journal of Cellular Biochemistry. 2019. Sep; 120(9):14499–14509. doi: 10.1002/jcb.28711 . [DOI] [PubMed] [Google Scholar]
4.Cohen K, Maartens G. A safety evaluation of bedaquiline for the treatment of multi-drug resistant tuberculosis. Expert Opinion on Drug Safety. 2019. Oct; 18(10):875–882. doi: 10.1080/14740338.2019.1648429 . [DOI] [PubMed] [Google Scholar]
5.Lange C, Dheda K, Chesov D, Mandalakas AM, Udwadia Z, Horsburgh CR Jr. Management of drug-resistant tuberculosis. Lancet. 2019. Sep 14; 394(10202):953–966. doi: 10.1016/S0140-6736(19)31882-3 . [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Kotwal P, Magotra A, Dogra A, Sharma S, Gour A, Bhatt S, et al. Assessment of preclinical drug interactions of bedaquiline by a highly sensitive LC-ESI-MS/MS based bioanalytical method. J Chromatogr B Analyt Technol Biomed Life Sci. 2019. Apr 1:1112:48–55. doi: 10.1016/j.jchromb.2019.02.022 . [DOI] [PubMed] [Google Scholar]
7.Sutherland HS, Tong AST, Choi PJ, Blaser A, Franzblau SG, Cooper CB, et al. Variations in the C-unit of bedaquiline provides analogues with improved biology and pharmacology. Bioorganic & Medicinal Chemistry. 2020. Jan 1; 28(1):115213. doi: 10.1016/j.bmc.2019.115213 . [DOI] [PubMed] [Google Scholar]
8.Jones J, Mudaly V, Voget J, Naledi T, Maartens G, Cohen K. Adverse drug reactions in South African patients receiving bedaquiline-containing tuberculosis treatment: an evaluation of spontaneously reported cases. BMC Infectious Diseases. 2019. Jun 20; 19(1):544. doi: 10.1186/s12879-019-4197-7 . [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Kempker RR, Mikiashvili L, Zhao Y, Benkeser D, Barbakadze K, Bablishvili N, et al. Clinical Outcomes among Patients with Drug-resistant Tuberculosis receiving bedaquiline or Delamanid Containing Regimens. Clinical infectious diseases. 2020. Dec 3; 71(9):2336–2344. doi: 10.1093/cid/ciz1107 . [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Healan AM, Griffiss JM, Proskin HM, O’Riordan MA, Gray WA, Salata RA, et al. Impact of Rifabutin or Rifampin on bedaquiline Safety, Tolerability, and Pharmacokinetics Assessed in a Randomized Clinical Trial with Healthy Adult Volunteers. Antimicrobial Agents and Chemotherapy. 2017. Dec 21; 62(1):e00855–17. doi: 10.1128/AAC.00855-17 . [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Sarathy JP, Gruber G, Dick T. Re-Understanding the Mechanisms of Action of the Anti-Mycobacterial Drug bedaquiline. Antibiotics. 2019. Dec 11; 8(4):261. doi: 10.3390/antibiotics8040261 . [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Li Y, Sun F, Zhang W. Bedaquiline and delamanid in the treatment of multidrug-resistant tuberculosis: Promising but challenging. Drug Development Research. 2019. Feb; 80(1):98–105. doi: 10.1002/ddr.21498 . [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Schnippel K, Ndjeka N, Maartens G, Meintjes G, Master I, Ismail N, et al. Effect of bedaquiline on mortality in South African patients with drug-resistant tuberculosis: a retrospective cohort study. The Lancet Respiratory Medicine. 2018. Sep; 6(9):699–706. doi: 10.1016/S2213-2600(18)30235-2 . [DOI] [PubMed] [Google Scholar]
14.Zimenkov DV, Nosova EY, Kulagina EV, Antonova OV, Arslanbaeva LR, Isakova AI, et al. Examination of bedaquiline-and linezolid-resistant Mycobacterium tuberculosis isolates from the Moscow region. The Journal of Antimicrobial Chemotherapy. 2017. Jul 1; 72(7):1901–1906. doi: 10.1093/jac/dkx094 . [DOI] [PubMed] [Google Scholar]
15.Ismail N, Ismail NA, Omar SV, Peters RPH. In Vitro Study of Stepwise Acquisition of rv0678 and atpE Mutations Conferring bedaquiline Resistance. Antimicrobial Agents and Chemotherapy. 2019. Jul 25; 63(8):e00292–19. doi: 10.1128/AAC.00292-19 . [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Almeida D, Ioerger T, Tyagi S, Li SY, Mdluli K, Andries K, et al. Mutations in pepQ Confer Low-Level Resistance to bedaquiline and Clofazimine in Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy. 2016. Jul 22; 60(8):4590–9. doi: 10.1128/AAC.00753-16 . [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Hegeto LA, Caleffi-Ferracioli KR, Nakamura-Vasconcelos SS, Almeida AL, Baldin VP, Nakamura CV, et al. In vitro combinatory activity of piperine and anti-tuberculosis drugs in Mycobacterium tuberculosis. Tuberculosis. 2018. Jul: 111:35–40. doi: 10.1016/j.tube.2018.05.006 . [DOI] [PubMed] [Google Scholar]
18.Moyo S, Cox HS, Hughes J, Daniels J, Synman L, De Azevedo V, et al. Loss from treatment for drug resistant tuberculosis: risk factors and patient outcomes in a community-based program in Khayelitsha, South Africa. PLoS One. 2015. Mar 18; 10(3):e0118919. doi: 10.1371/journal.pone.0118919 . [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Liu Z, Zhang M, Wang J, Chen S, Wu B, Zhou L, et al. Longitudinal Analysis of Prevalence and Risk Factors of Rifampicin-Resistant Tuberculosis in Zhejiang, China. Biomed Res Int. 2020. Feb 12; 2020:3159482. doi: 10.1155/2020/3159482 . [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Rojek AM, Horby PW. Modernising epidemic science enabling patient-centred research during epidemics. BMC Medicine, 2016. Dec 19; 14(1):212. doi: 10.1186/s12916-016-0760-x . [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Bajrami R, Mulliqi G, Kurti A, Lila G, Raka L. Mycobacterium tuberculosis Drug resistance profile of isolates from patients referred to tuberculosis reference laboratory in Kosovo. International Journal of Mycobacteriology, 2019. Jan-Mar; 8(1):22–24. doi: 10.4103/ijmy.ijmy_16_19 . [DOI] [PubMed] [Google Scholar]
22.Zhang D, Wang P. Progress in the diagnosis and treatment of isoniazid-resistant tuberculosis. Shandong Medicine. 2020. 60: 102–104. doi: 10.3969/j.issn.1002-266x.2020.03.028 [DOI] [Google Scholar]
23.Huo F, Lu J, Zong Z, Jing W, Shi J, Ma Y, et al. Change in prevalence and molecular characteristics of isoniazid-resistant tuberculosis over a 10-year period in China. BMC Infectious Diseases. 2019. 19: 689. doi: 10.1186/s12879-019-4333-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Kandler JL, Mercante AD, Dalton TL, Ezewudo MN, Cowan LS, Burns SP, et al. Validation of Novel Mycobacterium tuberculosis Isoniazid Resistance Mutations Not Detectable by Common Molecular Tests. Antimicrobial Agents And Chemotherapy, 2018. Sep 24; 62(10):e00974–18 doi: 10.1128/AAC.00974-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Li XX, Liang YP, Zhao T. Analysis of drug resistance in 422 hospitalized patients with tuberculosis. Shaanxi Medical Journal. 2020. 49: 250–253. doi: 10.3969/j.issn.1000-7377.2020.02.033 [DOI] [Google Scholar]
26.Li YY, Zeng LC, Liu W. Analysis of tuberculosis drug resistance epidemic status and related factors in 2017–2018. Modern Preventive Medicine. 2019. 46: 4001–4004+4032. https://doi.org/cnki:sun:xdyf.0.2019-21-039. [Google Scholar]
27.Cai CK, Lu XT, Li G, Sun SX, Gu XF, Xu Y, et al. Analysis of drug resistance status of tuberculosis patients in Dalian from 2012 to 2018. Journal of Tuberculosis and Lung Health. 2019. 8: 265–271. doi: 10.3969/j.issn.2095-3755.2019.04.007 [DOI] [Google Scholar]
28.Wang XY, Luo M, Zhang HZ, Wang J. Correlation analysis of rifampicin resistance and multidrug resistance in tuberculosis patients in Chongqing. Chinese Journal of Tropical Medicine. 2019. 19: 1141–1144. doi: 10.13604/j.cnki.46-1064/r.2019.12.09 [DOI] [Google Scholar]
29.Ocheretina O, Shen L, Escuyer VE, Mabou MM, Royal-Mardi G, Collins SE, et al. Whole Genome Sequencing Investigation of a Tuberculosis Outbreak in Port-au-Prince, Haiti Caused by a Strain with a "Low-Level" rpoB Mutation L511P-Insights into a Mechanism of Resistance Escalation. PloS One. 2015. Jun 3; 10(6):e0129207 doi: 10.1371/journal.pone.0129207 . [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Van Beek J, Haanperä M, Smit PW, Mentula S, Soini H. Evaluation of whole genome sequencing and software tools for drug susceptibility testing of Mycobacterium tuberculosis. Clinical Microbiology and Infection. 2019. Jan; 25(1):82–86. doi: 10.1016/j.cmi.2018.03.041 . [DOI] [PubMed] [Google Scholar]
31.Genestet C, Hodille E, Westeel E, Ginevra C, Ader F, Venner S, et al. Subcultured Mycobacterium tuberculosis isolates on different growth media are fully representative of bacteria within clinical samples. Tuberculosis. 2019. May; 116:61–66. doi: 10.1016/j.tube.2019.05.001 . [DOI] [PubMed] [Google Scholar]
32.Eilertson B, Maruri F, Blackman A, Guo Y, Herrera M, van der Heijden Y, et al. A novel resistance mutation in eccC5 of the ESX-5 secretion system confers ofloxacin resistance in Mycobacterium tuberculosis. The Journal of Antimicrobial Chemotherapy. 2016. Sep; 71(9):2419–27. doi: 10.1093/jac/dkw168 . [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Opota O, Mazza-Stalder J, Greub G, Jaton K. The rapid molecular test Xpert MTB/RIF ultra: towards improved tuberculosis diagnosis and rifampicin resistance detection. Clinical microbiology and Infection. 2019. Nov; 25(11):1370–1376. doi: 10.1016/j.cmi.2019.03.021 . [DOI] [PubMed] [Google Scholar]
34.Schrager LK, Vekemens J, Drager N, Lewinsohn DM, Olesen OF. The status of tuberculosis vaccine development. The Lancet Infectious Diseases, 2020. Mar; 20(3):e28–e37. doi: 10.1016/S1473-3099(19)30625-5 . [DOI] [PubMed] [Google Scholar]
35.Li B, Ye M, Guo Q, Zhang Z, Yang S, Ma W, et al. Determination of MIC Distribution and Mechanisms of Decreased Susceptibility to bedaquiline among Clinical Isolates of Mycobacterium abscessus. Antimicrobial Agents And Chemotherapy, 2018. Jun 26; 62(7):e00175–18. doi: 10.1128/AAC.00175-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Meehan CJ, Goig GA, Kohl TA, Verboven L, Dippenaar A, Ezewudo M, et al. Whole genome sequencing of Mycobacterium tuberculosis: current standards and open issues. Nature Reviews Microbiology. 2019. Sep; 17(9):533–545. doi: 10.1038/s41579-019-0214-5 . [DOI] [PubMed] [Google Scholar]
37.Peretokina IV, Krylova LY, Antonova OV, Kholina MS, Kulagina EV, Nosova EY, et al. Reduced susceptibility and resistance to bedaquiline in clinical M. tuberculosis isolates. The Journal of Infection. 2020. May; 80(5):527–535. doi: 10.1016/j.jinf.2020.01.007 . [DOI] [PubMed] [Google Scholar]
38.Xu J, Wang B, Hu M, Huo F, Guo S, Jing W, et al. Primary Clofazimine and bedaquiline Resistance among Isolates from Patients with Multidrug-Resistant Tuberculosis. Antimicrobial Agents And Chemotherapy. 2017. May 24; 61(6):e00239–17. doi: 10.1128/AAC.00239-17 . [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0311042.r001

Decision Letter 0

Salman Sadullah Usmani

17 Apr 2024

PONE-D-23-36124The drug susceptibility and gene-set enrichment analysis of M. tuberculosis isolates in Gansu Province, ChinaPLOS ONE

Dear Dr. Jia,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jun 01 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Salman Sadullah Usmani, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. Note from Emily Chenette, Editor in Chief of PLOS ONE, and Iain Hrynaszkiewicz, Director of Open Research Solutions at PLOS: Did you know that depositing data in a repository is associated with up to a 25% citation advantage (https://doi.org/10.1371/journal.pone.0230416)? If you’ve not already done so, consider depositing your raw data in a repository to ensure your work is read, appreciated and cited by the largest possible audience. You’ll also earn an Accessible Data icon on your published paper if you deposit your data in any participating repository (https://plos.org/open-science/open-data/#accessible-data).

3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ".

4. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

The American Journal Experts (AJE) (https://www.aje.com/) is one such service that has extensive experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. Please note that having the manuscript copyedited by AJE or any other editing services does not guarantee selection for peer review or acceptance for publication.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript

A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

A clean copy of the edited manuscript (uploaded as the new *manuscript* file)”.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

6. In the online submission form, you indicated that [The data underlying the results presented in the study are available from author].

All PLOS journals now require all data underlying the findings described in their manuscript to be freely available to other researchers, either 1. In a public repository, 2. Within the manuscript itself, or 3. Uploaded as supplementary information.

This policy applies to all data except where public deposition would breach compliance with the protocol approved by your research ethics board. If your data cannot be made publicly available for ethical or legal reasons (e.g., public availability would compromise patient privacy), please explain your reasons on resubmission and your exemption request will be escalated for approval.

7. Ethics statement only appears at the end of the manuscript:

Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.

8. Thank you for stating the following financial disclosure:

[Zhong Jia, Natural Science Foundation of Gansu Province (18JR3RA417)].

Please state what role the funders took in the study. If the funders had no role, please state: ""The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.""

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

9. Thank you for stating the following in the Acknowledgments Section of your manuscript:

[The study was supported by Natural Science Foundation of Gansu Province (18JR3RA417).]

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

[Zhong Jia, Natural Science Foundation of Gansu Province (18JR3RA417)].

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Additional Editor Comments:

The manuscript has been reviewed by four reviewers, who identified significant concerns in the study's design and methodology. Mixing pulmonary and extrapulmonary isolates for analysis is problematic, as bedaquiline is intended for treating pulmonary multidrug-resistant tuberculosis (MDR-TB) according to CDC guidelines. This approach may lead to unreliable conclusions. The study also lacks comparison with existing research on mutations in the Rv0678, atpE, and pepQ genes, limiting the novelty and validity of the findings. Additionally, there is clear issues with the writing quality and data presentation, including unclear language, grammatical errors, and improper formatting of scientific terms. Some figures lack sufficient detail or resolution, making interpretation challenging.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A

Reviewer #2: Yes

Reviewer #3: I Don't Know

Reviewer #4: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The drug susceptibility and gene-set enrichment analysis of M. tuberculosis isolates in

Gansu Province, China

The article seem to have a very good data that is not well presented starting from the title through the rest of the content. The abstract does not tell us clearly what the authors did, why, how and what did they conclude.

The methods regarding the bioinformatics section is very abstract and does not tell us how and why these list of databases and software are used.

Reviewer #2: Dear authors, as much I can evaluate your manuscript it can be accepted. However, at some of the area of your manuscript, I do not have expertise which needs to be evaluated by other reviewers.

Kindly consider the other reviewer comments seriously.

Reviewer #3: The authors describe that Bedaquiline is a new drug in the paper and carried out PCR and whole genome sequencing of isolates. This paper has multiple issues.

1. The authors are using pulmonary and extra pulmonary isolates together to interpret the data which does not make sense as the site of infection are different.

2. Bedaquiline has been found to be useful drug since 2016 not sure why the authors say it is a new drug.

3. The authors dont show any comparison with other studies for the mutations they found in Rv0678, atpE, and pepQ genes as there are multiple studies which have reported mutation in these genes from several isolates from different countries.

4. In MTB most of the genes show enrichment of of ABC transporters, two-component systems, and bacterial

secretion systems what new information are the authors adding in this study.

5. Bedaquiline may be used to treat adults with a confirmed diagnosis of pulmonary MDR TB as per the CDC guideline so why did the authors use extra pulmonary isolates in the study.

6. There are several grammatical errors in the paper for example M. tuberculosis is not italicized in the entire paper.

Reviewer #4: The study aimed to investigate various aspects of tuberculosis, including drug resistance, sensitivity, and genetic mutations, using samples collected from Lanzhou Pulmonary Hospital in Gansu, China, between February 2018 and July 2019. A total of 2,136 cases with M. tuberculosis strains were analyzed, following the Tuberculosis Diagnosis and Treatment Guidelines of the Chinese Medical Association.

Drug resistance detection was conducted using a proportionate approach for ten drugs, and drug sensitivity testing for bedaquiline was performed on 208 strains. DNA extraction and sequencing were carried out to identify drug-resistant gene sequences, with subsequent analysis to predict gene function and resistance mechanisms. Results indicated varying degrees of drug resistance, including multi-drug resistance and extensive resistance, among the samples. Mutations in specific genes, such as Rv0678, atpE, and PepQ, were associated with bedaquiline resistance. Additionally, pathway analysis revealed potential mechanisms underlying drug resistance.

1. Please use help of English speaker or any grammatical tools to improve the quality of the manuscript. Below are some examples which should be implemented to improve the quality. "Demonstrated a polymorphic distribution with different regions" - It's not clear what is meant by "polymorphic distribution. The phrase "were firstly predicted" should be "were predicted initially" or "were predicted first."

2. "Bedaquiline's, as a new drug, resistance range was identified" - This sentence is unclear. It could be rephrased as "The range of resistance to bedaquiline, a new drug, was identified."

3. Please elaborate “82.45% of the enzymes involved in carbohydrates”.

4. Write more clearly “the effects of drug-resistant tuberculosis cases” at Page 5 line 5?

5. Some images are not clear such as Figure 9 and 12

6. Figure 8 is not full please provide full image for pathway analysis.

7. “Note: A, B, C and D are amino acid comparison diagrams of atpE, Rv0678 and PepQ genes, respectively. 0 represents the amino acid sequence of the corresponding drug-resistant gene of the standard strain of M. tuberculosis. The other numbers represent the coding of the corresponding strain.” if it belongs to Figure 12 then modify it accordingly.

8. Data analysis methodology can be incorporated in more details for better understanding

9. The description of drug resistance categories (single drug resistance, multi-drug resistance, etc.) lacks clarity and standardization.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Rehab Ahmed

Reviewer #2: Yes: Shaban Ahmad

Reviewer #3: No

Reviewer #4: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Sep 27;19(9):e0311042. doi: 10.1371/journal.pone.0311042.r002

Author response to Decision Letter 0

12 Jun 2024

Dear Editors and Reviewers:

Thank you for your comments and suggesting concerning our manuscript entitled “The drug susceptibility and gene-set enrichment analysis of M. tuberculosis isolates in Gansu, China” (PONE-D-23-36124R1). Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have responded carefully to all comments by the reviewers and have made correction which we hope meet with approval. Revised portion are marked in red in the paper.

Response to comments from the Editor

Additional Editor Comments:

Response: We thank the editor for their constructive comments. The experimental M. tuberculosis samples utilized in this study were sourced from various biological sources, including sputum, lung lavage, puncture, pleural effusion, and joint fluid, obtained from in vitro culture methods. The reason that the strains used in the bedaquiline susceptibility experiments do not only include multidrug-resistant strains was to investigate the effectiveness of bedaquiline resistance against M. tuberculosis. The sites of bedaquiline resistance gene mutations detected in this experiment have not been reported in previous studies and belong to novel gene mutations, which was modified in the discussion section. In addition, we have asked a colleague whose native language is English to review our manuscript, revising the inappropriate language and format.

Response to comments from the Reviewer

Reviewer #1: The drug susceptibility and gene-set enrichment analysis of M. tuberculosis isolates in

Gansu Province, China

The article seem to have a very good data that is not well presented starting from the title through the rest of the content.

Response: Thanks for the helpful comments. We reviewed the article again and changed the title to “Phenotypic and genotypic analysis of drug resistance in M. tuberculosis isolates in Gansu, China”. We hope that this title summarized the subject of the article.

The abstract does not tell us clearly what the authors did, why, how and what did they conclude.

Response: Thanks for the suggestion. We modified the summary, and this experiment first investigated the drug resistance in tuberculosis, then tested the antibacterial effect of bedaquiline on M. tuberculosis, and finally used genome sequencing to predict potential resistance sites. It was concluded that tuberculosis had presented a high level of drug resistance. Phenotypic resistance was related to genes, existing potential genetic resistance in M. tuberculosis. Bedaquiline was found to possess effective antibacterial properties against M. tuberculosis.

The methods regarding the bioinformatics section is very abstract and does not tell us how and why these list of databases and software are used.

Response: Thanks for the great suggestion. We used whole-genome sequencing technology to search for M. tuberculosis gene function and potential drug resistance loci through genome annotation and enrichment.

Kindly consider the other reviewer comments seriously.

Response: Thanks for reviewing our manuscript. We must adopt the suggestions of the reviewer to carefully revise the manuscript carefully.

Reviewer #3: The authors describe that Bedaquiline is a new drug in the paper and carried out PCR and whole genome sequencing of isolates. This paper has multiple issues.

1. The authors are using pulmonary and extra pulmonary isolates together to interpret the data which does not make sense as the site of infection are different.

Response: We thank review’s comment. The experimental M. tuberculosis samples utilized in this study were sourced from various biological sources, including sputum, lung lavage, puncture, pleural effusion, and joint fluid, obtained from in vitro culture methods. Our interpretation was that the source of clinical M. tuberculosis had not only the lungs but also other.

2. Bedaquiline has been found to be useful drug since 2016 not sure why the authors say it is a new drug.

Response: We are grateful for this review’s comment. We were very sorry to have made such a mistake at the beginning and have now revised it in the article.

Response: Thank this review for the critical comment. The study results indicated that the Rv0678 and atpE genes exhibited the highest frequency of V152A and P62A mutations, respectively, with the pepQ gene showing the highest occurrence of H211Q mutations. The site of mutations in bedaquiline resistance genes detected in this experiment have not been reported in previous studies. We have made the changes in the text.

4. In MTB most of the genes show enrichment of of ABC transporters, two-component systems, and bacterial secretion systems what new information are the authors adding in this study.

Response: We are thankful for this comment. Our primary aim was to predict potential resistance sites in M. tuberculosis.

5. Bedaquiline may be used to treat adults with a confirmed diagnosis of pulmonary MDR TB as per the CDC guideline so why did the authors use extra pulmonary isolates in the study.

Response: Thank this review for the critical comment. The strains used in the experiments were all derived from in vitro cultures of different types of samples. All the subjects tested are M. tuberculosis.

6. There are several grammatical errors in the paper for example M. tuberculosis is not italicized in the entire paper.

Response: We appreciate these comments. We have changed the M. tuberculosis to italics in the text.

Response: Thank you for your very helpful suggestions to improve our paper. We have revised this paragraph. We have modified the “firstly prediction” to “predicted” in the text.

2. "Bedaquiline's, as a new drug, resistance range was identified" - This sentence is unclear. It could be rephrased as "The range of resistance to bedaquiline, a new drug, was identified."

Response: Thank the review for the comment. We made changes in the text to rewrite “bedaquiline’s drug resistance range” to “the drug resistance range of bedaquiline”.

3. Please elaborate “82.45% of the enzymes involved in carbohydrates”.

Response: We thank the review for this comment. In this experiment, carbohydrates-related enzymes of M. tuberculosis genes encoding 82.45% were enriched by whole genome sequencing, such as glycoside hydrolases, glycosyl transferases, and carbohydrate esterases.

4. Write more clearly “the effects of drug-resistant tuberculosis cases” at Page 5 line 5?

Response: We appreciate this comment. We feel sorry to make this mistake in the old version. We have made the changes in the text.

5. Some images are not clear such as Figure 9 and 12

Response: Thank reviewer for the comment. We uploaded the high-resolution Figure 9 and Figure 12 when submitting the revision.

6. Figure 8 is not full please provide full image for pathway analysis.

Response: Thanks for the valuable comments. We uploaded the complete figure 8 of the data when we submitted the revised manuscript.

Response: Thanks again for the valuable comments and helpful suggestions. We have removed the inappropriate paragraphs.

8. Data analysis methodology can be incorporated in more details for better understanding

Response: We are grateful for this review’s comment. A retrospective analysis of the tuberculosis clinical database from February 2018 to July 2019 used tuberculosis diagnosis and treatment guidelines as inclusion criteria.

9. The description of drug resistance categories (single drug resistance, multi-drug resistance, etc.) lacks clarity and standardization.

Response: We are thankful for this comment. We defined monoresistance, polydrug resistance, multidrug resistance, and extensive drug resistance with rereference to “WHO. Definitions and reporting framework for tuberculosis [M].2013.WHO, 2014 : 5”.

We believe that these revisions have significantly improved the quality and clarity of the manuscript. However, if you have any further suggestions or require additional clarification, please do not hesitate to let us know. We are committed to making the necessary modifications to ensure that the manuscript meets the standards of PLOS ONE.

Thank you again for your valuable feedback and support.

Best regards,

Prof. Zhong Jia

College of Veterinary Medicine

Gansu Agricultural University

Lanzhou 730070

PR China

2024.06.12

Attachment

Submitted filename: Response to Reviewers.docx

pone.0311042.s003.docx^{(22.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0311042.r003

Decision Letter 1

Salman Sadullah Usmani

19 Jul 2024

PONE-D-23-36124R1Phenotypic and genotypic analysis of drug resistance in M. tuberculosis isolates in Gansu, ChinaPLOS ONE

Dear Dr. Jia,

Please submit your revised manuscript by Sep 02 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Salman Sadullah Usmani, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments:

There is still concern raised by one of the reviwer about the combined analysis of pulmonary and extra pulmonary isolates. It will be wise to show these analysis seperately, as the site of infections are different.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: (No Response)

Reviewer #4: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #3: No

Reviewer #4: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #3: N/A

Reviewer #4: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #3: Yes

Reviewer #4: Yes

**********

6. Review Comments to the Author

Reviewer #3: 1. The author need to separately analyze pulmonary and extra pulmonary isolates as the site of infections are different and they cannot be mixed up and shown as they all are drug resistant. Show the results separately for pulmonary and extra-pulmonary isolates.

2. The authors need to show comparison of Bedaquiline mutations identified in their study with other WGS studies as Bedaquiline mutations have been also identified in other WGS studies. Please add this information is table2 showing what is unique and common mutations as compared to other studies

Reviewer #4: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

Reviewer #4: No

**********

PLoS One. 2024 Sep 27;19(9):e0311042. doi: 10.1371/journal.pone.0311042.r004

Author response to Decision Letter 1

1 Aug 2024

Responses to the editor and reviewers comments

Editor (Comments for the Author):

Response: Thank you for your consideration and work. The review’s comments are all valuable and very helpful for revising and improving our paper. We have revised the manuscript carefully and responded to the reviewers’ comments point-by-point.

Reviewer #3 (Comments for the Author):

Q1. The author need to separately analyze pulmonary and extra pulmonary isolates as the site of infections are different and they cannot be mixed up and shown as they all are drug resistant. Show the results separately for pulmonary and extra-pulmonary isolates.

Response: Many thanks to the reviewer for the comments. In the diagnosis of tuberculosis, sputum is typically utilized as the primary sample. This is due to the propensity of tuberculosis patients to expel the pathogen from pulmonary lesions into the sputum through coughing and other mechanisms. Consequently, the presence of Mycobacterium tuberculosis and other pertinent evidence can be more directly identified through sputum analysis. However, not all manifestations of tuberculosis are confined to the lungs. Tuberculosis can affect various parts of the body, including the meninges (tuberculous meningitis), bones (bone tuberculosis), and intestines (intestinal tuberculosis). Consequently, diagnostic samples from the affected sites, such as cerebrospinal fluid, bone tissue, and intestinal tissue, can provide a more accurate assessment of the disease's extent and severity. Therefore, reliance solely on sputum samples is insufficient for a comprehensive diagnosis. Moreover, alternative sample types should be employed for patients who are unable to produce sputum or experience difficulty in doing so, to facilitate accurate diagnosis. Utilizing diverse sample types can offer a multifaceted basis for tuberculosis diagnosis. The etiological agent of tuberculosis, irrespective of the infection site, is typically Mycobacterium tuberculosis. Bedaquiline is an antimicrobial agent specifically targeting Mycobacterium tuberculosis. We did not conduct separate analyses of the samples from the lungs and other anatomical regions, as our experimental focus was on Mycobacterium tuberculosis, which exhibits consistent characteristics across the various sample sources. We sincerely hope that this response will satisfy the reviewers.

Q2. The authors need to show comparison of Bedaquiline mutations identified in their study with other WGS studies as Bedaquiline mutations have been also identified in other WGS studies. Please add this information is table2 showing what is unique and common mutations as compared to other studies.

Response: Many thanks to the reviewer for the comments. We reviewed the literature and added in Table 2 the mutation sites of previously identified Bedaquiline resistance genes. We also demonstrate that the mutation sites of the Bedaquiline resistance gene identified in this paper are inconsistent with previously identified mutations (page 9, lines 246-249).

Attachment

Submitted filename: Response to Reviewers.docx

pone.0311042.s004.docx^{(17.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0311042.r005

Decision Letter 2

Salman Sadullah Usmani

11 Sep 2024

Phenotypic and genotypic analysis of drug resistance in M. tuberculosis isolates in Gansu, China

PONE-D-23-36124R2

Dear Dr. Jia,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Salman Sadullah Usmani, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

It seems that the authors have adequately responded to the third reviewer's query and provided a reasonable justification for their analysis. Despite this, the reviewer appears reluctant to accept the paper. However, it is worth noting that the other reviewers are satisfied with the updated version of the manuscript. After two rounds of revisions, I believe the manuscript is now satisfactory and suitable for publication.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #3: (No Response)

Reviewer #4: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #3: No

Reviewer #4: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #3: N/A

Reviewer #4: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #3: Yes

Reviewer #4: Yes

**********

6. Review Comments to the Author

Reviewer #3: The author's have not cited the papers in Table 2 as they have reported the mutations in Bedaquiline.

The extraplumonary and pulmonary samples cannot be combined in the analysis as the author's themselves have written in the response the site of infection is different in pulmonary tuberculosis and in extrapulmonary tuberculosis.

Reviewer #4: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

Reviewer #4: Yes: Vinod Kumar

**********

PLoS One. doi: 10.1371/journal.pone.0311042.r006

Acceptance letter

Salman Sadullah Usmani

18 Sep 2024

PONE-D-23-36124R2

PLOS ONE

Dear Dr. Jia,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Salman Sadullah Usmani

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File

(XLSX)

pone.0311042.s001.xlsx^{(142.6KB, xlsx)}

S1 Raw image

(PDF)

pone.0311042.s002.pdf^{(384.2KB, pdf)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0311042.s003.docx^{(22.1KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0311042.s004.docx^{(17.3KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files. Additional large data sets are made available via the Dryad public repository, DOI:10.5061/dryad.r4xgxd2np.

[pone.0311042.ref001] 1.Tornheim JA, Dooley KE. The Global Landscape of Tuberculosis Therapeutics. Annual Review of Medicine. 2019. Jan 27; 70:105–120. doi: 10.1146/annurev-med-040717-051150 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref002] 2.Daley CL. The Global Fight Against Tuberculosis. Thoracic Surgery Clinics. 2019. Feb; 29(1):19–25. doi: 10.1016/j.thorsurg.2018.09.010 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref003] 3.Miryala SK, Anbarasu A, Ramaiah S. Impact of bedaquiline and capreomycin on the gene expression patterns of multidrug-resistant Mycobacterium tuberculosis H37Rv strain and understanding the molecular mechanism of antibiotic resistance. Journal of Cellular Biochemistry. 2019. Sep; 120(9):14499–14509. doi: 10.1002/jcb.28711 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref004] 4.Cohen K, Maartens G. A safety evaluation of bedaquiline for the treatment of multi-drug resistant tuberculosis. Expert Opinion on Drug Safety. 2019. Oct; 18(10):875–882. doi: 10.1080/14740338.2019.1648429 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref005] 5.Lange C, Dheda K, Chesov D, Mandalakas AM, Udwadia Z, Horsburgh CR Jr. Management of drug-resistant tuberculosis. Lancet. 2019. Sep 14; 394(10202):953–966. doi: 10.1016/S0140-6736(19)31882-3 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref006] 6.Kotwal P, Magotra A, Dogra A, Sharma S, Gour A, Bhatt S, et al. Assessment of preclinical drug interactions of bedaquiline by a highly sensitive LC-ESI-MS/MS based bioanalytical method. J Chromatogr B Analyt Technol Biomed Life Sci. 2019. Apr 1:1112:48–55. doi: 10.1016/j.jchromb.2019.02.022 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref007] 7.Sutherland HS, Tong AST, Choi PJ, Blaser A, Franzblau SG, Cooper CB, et al. Variations in the C-unit of bedaquiline provides analogues with improved biology and pharmacology. Bioorganic & Medicinal Chemistry. 2020. Jan 1; 28(1):115213. doi: 10.1016/j.bmc.2019.115213 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref008] 8.Jones J, Mudaly V, Voget J, Naledi T, Maartens G, Cohen K. Adverse drug reactions in South African patients receiving bedaquiline-containing tuberculosis treatment: an evaluation of spontaneously reported cases. BMC Infectious Diseases. 2019. Jun 20; 19(1):544. doi: 10.1186/s12879-019-4197-7 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref009] 9.Kempker RR, Mikiashvili L, Zhao Y, Benkeser D, Barbakadze K, Bablishvili N, et al. Clinical Outcomes among Patients with Drug-resistant Tuberculosis receiving bedaquiline or Delamanid Containing Regimens. Clinical infectious diseases. 2020. Dec 3; 71(9):2336–2344. doi: 10.1093/cid/ciz1107 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref010] 10.Healan AM, Griffiss JM, Proskin HM, O’Riordan MA, Gray WA, Salata RA, et al. Impact of Rifabutin or Rifampin on bedaquiline Safety, Tolerability, and Pharmacokinetics Assessed in a Randomized Clinical Trial with Healthy Adult Volunteers. Antimicrobial Agents and Chemotherapy. 2017. Dec 21; 62(1):e00855–17. doi: 10.1128/AAC.00855-17 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref011] 11.Sarathy JP, Gruber G, Dick T. Re-Understanding the Mechanisms of Action of the Anti-Mycobacterial Drug bedaquiline. Antibiotics. 2019. Dec 11; 8(4):261. doi: 10.3390/antibiotics8040261 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref012] 12.Li Y, Sun F, Zhang W. Bedaquiline and delamanid in the treatment of multidrug-resistant tuberculosis: Promising but challenging. Drug Development Research. 2019. Feb; 80(1):98–105. doi: 10.1002/ddr.21498 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref013] 13.Schnippel K, Ndjeka N, Maartens G, Meintjes G, Master I, Ismail N, et al. Effect of bedaquiline on mortality in South African patients with drug-resistant tuberculosis: a retrospective cohort study. The Lancet Respiratory Medicine. 2018. Sep; 6(9):699–706. doi: 10.1016/S2213-2600(18)30235-2 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref014] 14.Zimenkov DV, Nosova EY, Kulagina EV, Antonova OV, Arslanbaeva LR, Isakova AI, et al. Examination of bedaquiline-and linezolid-resistant Mycobacterium tuberculosis isolates from the Moscow region. The Journal of Antimicrobial Chemotherapy. 2017. Jul 1; 72(7):1901–1906. doi: 10.1093/jac/dkx094 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref015] 15.Ismail N, Ismail NA, Omar SV, Peters RPH. In Vitro Study of Stepwise Acquisition of rv0678 and atpE Mutations Conferring bedaquiline Resistance. Antimicrobial Agents and Chemotherapy. 2019. Jul 25; 63(8):e00292–19. doi: 10.1128/AAC.00292-19 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref016] 16.Almeida D, Ioerger T, Tyagi S, Li SY, Mdluli K, Andries K, et al. Mutations in pepQ Confer Low-Level Resistance to bedaquiline and Clofazimine in Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy. 2016. Jul 22; 60(8):4590–9. doi: 10.1128/AAC.00753-16 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref017] 17.Hegeto LA, Caleffi-Ferracioli KR, Nakamura-Vasconcelos SS, Almeida AL, Baldin VP, Nakamura CV, et al. In vitro combinatory activity of piperine and anti-tuberculosis drugs in Mycobacterium tuberculosis. Tuberculosis. 2018. Jul: 111:35–40. doi: 10.1016/j.tube.2018.05.006 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref018] 18.Moyo S, Cox HS, Hughes J, Daniels J, Synman L, De Azevedo V, et al. Loss from treatment for drug resistant tuberculosis: risk factors and patient outcomes in a community-based program in Khayelitsha, South Africa. PLoS One. 2015. Mar 18; 10(3):e0118919. doi: 10.1371/journal.pone.0118919 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref019] 19.Liu Z, Zhang M, Wang J, Chen S, Wu B, Zhou L, et al. Longitudinal Analysis of Prevalence and Risk Factors of Rifampicin-Resistant Tuberculosis in Zhejiang, China. Biomed Res Int. 2020. Feb 12; 2020:3159482. doi: 10.1155/2020/3159482 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref020] 20.Rojek AM, Horby PW. Modernising epidemic science enabling patient-centred research during epidemics. BMC Medicine, 2016. Dec 19; 14(1):212. doi: 10.1186/s12916-016-0760-x . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref021] 21.Bajrami R, Mulliqi G, Kurti A, Lila G, Raka L. Mycobacterium tuberculosis Drug resistance profile of isolates from patients referred to tuberculosis reference laboratory in Kosovo. International Journal of Mycobacteriology, 2019. Jan-Mar; 8(1):22–24. doi: 10.4103/ijmy.ijmy_16_19 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref022] 22.Zhang D, Wang P. Progress in the diagnosis and treatment of isoniazid-resistant tuberculosis. Shandong Medicine. 2020. 60: 102–104. doi: 10.3969/j.issn.1002-266x.2020.03.028 [DOI] [Google Scholar]

[pone.0311042.ref023] 23.Huo F, Lu J, Zong Z, Jing W, Shi J, Ma Y, et al. Change in prevalence and molecular characteristics of isoniazid-resistant tuberculosis over a 10-year period in China. BMC Infectious Diseases. 2019. 19: 689. doi: 10.1186/s12879-019-4333-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref024] 24.Kandler JL, Mercante AD, Dalton TL, Ezewudo MN, Cowan LS, Burns SP, et al. Validation of Novel Mycobacterium tuberculosis Isoniazid Resistance Mutations Not Detectable by Common Molecular Tests. Antimicrobial Agents And Chemotherapy, 2018. Sep 24; 62(10):e00974–18 doi: 10.1128/AAC.00974-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref025] 25.Li XX, Liang YP, Zhao T. Analysis of drug resistance in 422 hospitalized patients with tuberculosis. Shaanxi Medical Journal. 2020. 49: 250–253. doi: 10.3969/j.issn.1000-7377.2020.02.033 [DOI] [Google Scholar]

[pone.0311042.ref026] 26.Li YY, Zeng LC, Liu W. Analysis of tuberculosis drug resistance epidemic status and related factors in 2017–2018. Modern Preventive Medicine. 2019. 46: 4001–4004+4032. https://doi.org/cnki:sun:xdyf.0.2019-21-039. [Google Scholar]

[pone.0311042.ref027] 27.Cai CK, Lu XT, Li G, Sun SX, Gu XF, Xu Y, et al. Analysis of drug resistance status of tuberculosis patients in Dalian from 2012 to 2018. Journal of Tuberculosis and Lung Health. 2019. 8: 265–271. doi: 10.3969/j.issn.2095-3755.2019.04.007 [DOI] [Google Scholar]

[pone.0311042.ref028] 28.Wang XY, Luo M, Zhang HZ, Wang J. Correlation analysis of rifampicin resistance and multidrug resistance in tuberculosis patients in Chongqing. Chinese Journal of Tropical Medicine. 2019. 19: 1141–1144. doi: 10.13604/j.cnki.46-1064/r.2019.12.09 [DOI] [Google Scholar]

[pone.0311042.ref029] 29.Ocheretina O, Shen L, Escuyer VE, Mabou MM, Royal-Mardi G, Collins SE, et al. Whole Genome Sequencing Investigation of a Tuberculosis Outbreak in Port-au-Prince, Haiti Caused by a Strain with a "Low-Level" rpoB Mutation L511P-Insights into a Mechanism of Resistance Escalation. PloS One. 2015. Jun 3; 10(6):e0129207 doi: 10.1371/journal.pone.0129207 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref030] 30.Van Beek J, Haanperä M, Smit PW, Mentula S, Soini H. Evaluation of whole genome sequencing and software tools for drug susceptibility testing of Mycobacterium tuberculosis. Clinical Microbiology and Infection. 2019. Jan; 25(1):82–86. doi: 10.1016/j.cmi.2018.03.041 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref031] 31.Genestet C, Hodille E, Westeel E, Ginevra C, Ader F, Venner S, et al. Subcultured Mycobacterium tuberculosis isolates on different growth media are fully representative of bacteria within clinical samples. Tuberculosis. 2019. May; 116:61–66. doi: 10.1016/j.tube.2019.05.001 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref032] 32.Eilertson B, Maruri F, Blackman A, Guo Y, Herrera M, van der Heijden Y, et al. A novel resistance mutation in eccC5 of the ESX-5 secretion system confers ofloxacin resistance in Mycobacterium tuberculosis. The Journal of Antimicrobial Chemotherapy. 2016. Sep; 71(9):2419–27. doi: 10.1093/jac/dkw168 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref033] 33.Opota O, Mazza-Stalder J, Greub G, Jaton K. The rapid molecular test Xpert MTB/RIF ultra: towards improved tuberculosis diagnosis and rifampicin resistance detection. Clinical microbiology and Infection. 2019. Nov; 25(11):1370–1376. doi: 10.1016/j.cmi.2019.03.021 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref034] 34.Schrager LK, Vekemens J, Drager N, Lewinsohn DM, Olesen OF. The status of tuberculosis vaccine development. The Lancet Infectious Diseases, 2020. Mar; 20(3):e28–e37. doi: 10.1016/S1473-3099(19)30625-5 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref035] 35.Li B, Ye M, Guo Q, Zhang Z, Yang S, Ma W, et al. Determination of MIC Distribution and Mechanisms of Decreased Susceptibility to bedaquiline among Clinical Isolates of Mycobacterium abscessus. Antimicrobial Agents And Chemotherapy, 2018. Jun 26; 62(7):e00175–18. doi: 10.1128/AAC.00175-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311042.ref036] 36.Meehan CJ, Goig GA, Kohl TA, Verboven L, Dippenaar A, Ezewudo M, et al. Whole genome sequencing of Mycobacterium tuberculosis: current standards and open issues. Nature Reviews Microbiology. 2019. Sep; 17(9):533–545. doi: 10.1038/s41579-019-0214-5 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref037] 37.Peretokina IV, Krylova LY, Antonova OV, Kholina MS, Kulagina EV, Nosova EY, et al. Reduced susceptibility and resistance to bedaquiline in clinical M. tuberculosis isolates. The Journal of Infection. 2020. May; 80(5):527–535. doi: 10.1016/j.jinf.2020.01.007 . [DOI] [PubMed] [Google Scholar]

[pone.0311042.ref038] 38.Xu J, Wang B, Hu M, Huo F, Guo S, Jing W, et al. Primary Clofazimine and bedaquiline Resistance among Isolates from Patients with Multidrug-Resistant Tuberculosis. Antimicrobial Agents And Chemotherapy. 2017. May 24; 61(6):e00239–17. doi: 10.1128/AAC.00239-17 . [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Phenotypic and genotypic analysis of drug resistance in M. tuberculosis isolates in Gansu, China

Yousheng Peng

Chenchen Li

Xueke Hui

Xiaoning Huo

Nigus Abebe Shumuyed

Zhong Jia

Roles

Abstract

Introduction

Materials and methods

Drug resistance detection

Drug sensitivity detection

DNA extraction and sequencing

Table 1. Primer synthesis of three genes.

Statistical analysis

Results

Detection of drug resistance of M. tuberculosis

Fig 1. Distribution of total sample types.

Fig 2. The distribution of cases at different age stages.

Fig 3. The distribution of different drug resistance types.

Fig 4. The distribution of drug resistance types at different age stages.

The complete sequence analysis of M. tuberculosis

Fig 5. Experimental sequencing process.

Fig 6. Protein functional cluster analysis.

Fig 7. Carbohydrate-related enzymes classification.

Fig 8. Analysis of the whole protein KEGG pathway.

Fig 9. Genomic cycle map for M. tuberculosis.

The drug sensitivity tests of bedaquiline to M. tuberculosis

Fig 10. Antibacterial concentrations of bedaquiline on Mycobacterium tuberculosis.

Bedaquiline drugs resistance gene analysis

Fig 11. Agarose gel of three resistant genes.

Table 2. Mutation rates and mutation sites of drug-resistant genes.

Fig 12. Alignment the major and other mutation sites of each drug resistance gene.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Salman Sadullah Usmani

Roles

Author response to Decision Letter 0

Decision Letter 1

Salman Sadullah Usmani

Roles

Author response to Decision Letter 1

Decision Letter 2

Salman Sadullah Usmani

Roles

Acceptance letter

Salman Sadullah Usmani

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases