A Nonviral Peptide Can Replace the Entire N Terminus of Zucchini Yellow Mosaic Potyvirus Coat Protein and Permits Viral Systemic Infection

Abstract

Systematic deletion and peptide tagging of the amino-terminal domain (NT, ∼43 amino acids) of an attenuated zucchini yellow mosaic potyvirus (ZYMV-AGII) coat protein (CP) were used to elucidate its role in viral systemic infection. Deletion mutants truncated by 8, 13, and 33 amino acid residues from the CP-NT 5′ end were systemically infectious and produced symptoms similar to those of the AGII virus. Tagging these deletion mutants with either human c-Myc (Myc) or hexahistidine peptides maintained viral infectivity. Similarly, addition of these peptides to the intact AGII CP-NT did not affect viral life cycle. To determine which parts, if any, of the CP-NT are essential for viral systemic infection, a series of Myc-tagged mutants with 8 to 43 amino acids removed from the CP-NT were constructed. All Myc-tagged CP-NT deletion mutants, including those from which virtually all the viral CP-NT had been eliminated, were able to encapsidate and cause systemic infection. Furthermore, chimeric viruses with deletions of up to 33 amino acids from CP-NT produced symptoms indistinguishable from those caused by the parental AGII virus. In contrast to CP-NT Myc fusion, addition of the foot-and-mouth disease virus (FMDV) immunogenic epitope to AGII CP-NT did not permit systemic infection. However, fusion of the Myc peptide to the N terminus of the FMDV peptide restored the capability of the virus to spread systemically. We have demonstrated that all CP-NT fused peptides were exposed on the virion surface, masking natural CP immunogenic determinants. Our findings demonstrate that CP-NT is not essential for ZYMV spread and that it can be replaced by an appropriate foreign peptide while maintaining systemic infectivity.

Zucchini yellow mosaic potyvirus (ZYMV) is a member of the Potyviridae family, the largest group of plant-infecting viruses (31). As in all potyviruses, the ZYMV genome consists of a single messenger-polarity RNA molecule of about 10 kb, encapsidated by ∼2,000 subunits of coat protein (CP), forming a helical, flexuous filament particle about 750 nm long and 11 nm wide (8, 19).

Though there are no high-resolution X-ray diffraction data available on the structure of potyvirus CP, there is a considerable amount of information about its topology. Structure predictions, together with immunological studies (7, 29) of potyvirus CPs, have demonstrated structural features similar to those of the CP of tobacco mosaic virus (21) and potato virus X (26). Like those proteins, potyviral CP is a three-domain protein with variable N- and C-terminal regions exposed on the virion surface and a conserved core domain that probably interacts with viral RNA (1, 29). ZYMV CP (279 amino acids [aa]) is composed of a 214-aa core domain flanked by 43- to 45- and 20-aa N- and C-terminal domains, respectively, as predicted by Shukla et al. (30). The putative trypsin protease motif of potyvirus CP, representing the end of the surface-exposed N-terminal domain (NT), is presumed to be positioned between amino acids Lys and Asp, located in the KDKD motif (29).

Different domains have been associated with distinct functions of CP during the viral life cycle. It has been shown that the conserved core but not the N or C terminus is required for virus assembly (10, 16, 35), plasmodesmatal gating (25), and cell-to-cell movement (10). The NT has been shown to assist aphid transmission via its DAG motif (5, 13) through interaction with the virus-encoded helper component-proteinase (HC-Pro) (22, 23). A number of studies have shown that the NT of the CP (CP-NT) is involved in viral long-distance movement and systemic spread. Tobacco etch virus (TEV) mutants with deletions in the CP N- or C-terminal domains have produced virions in vivo, but the virus was defective in long-distance movement in planta (9, 10). Also, mutational analysis demonstrated that changes of Ser₄₇ to Pro of the pea seed-borne mosaic virus CP (2) and Asp₅ to Lys in the DAG motif of the tobacco vein mottling virus CP-NT (20) can modulate the ability of the virus to move systemically in Chenopodium quinoa and tobacco plants, respectively. Additionally, substitution of potato virus A Ser₇ for Gly within its CP-NT reduced virus accumulation 10-fold but did not affect the rate of systemic movement (3). Nevertheless, viral accumulation and long-distance movement of plum pox virus were not affected by insertions of 15- and 30-aa nonviral sequences between CP Ala₁₂ and Leu₁₃, suggesting that this region does not have a role in viral systemic spread (12).

In the present study we have investigated whether an intact ZYMV CP-NT is essential for virus systemic infection or whether it can be replaced by a nonviral sequence. To this end, we created chimeric viruses replacing the NT part of the CP with a foreign peptide. Our results indicate for the first time that ZYMV systemic infection can be maintained when a foreign peptide replaces the CP N-terminal region.

MATERIALS AND METHODS

Construction of virus mutants.

Constructs containing various CP fusions were created by PCR, with an attenuated zucchini yellow mosaic potyvirus, AGII, as a template (4, 15). Sense primers contained a PstI site at their 5′ end, followed by the indicated sequence tag and a homologous CP sequence, with or without deletion. The CP homologous antisense primer included an MluI site. The amplified fragments were double digested by PstI and MluI and cloned into the partial clone pKSΔSacI-PstI-poly comprising about a quarter of the AGII sequence from its 3′ end at positions 7515 to 9591 (4). pKSΔSacI-PstI-poly clones were double digested by SacI and MluI, and the resulting fragments containing tags were cloned into the AGII genome to create AGII-tagged mutants. The tags used were as follows: His tag, 5′-TCACACCATCACCATCACCAT-3′; Myc tag, 5′-TCAGCATCAGAGCAGAAGC TCAT T TCAGAGGAGGATC TCGGATCC-3′ (11); foot-and-mouth disease virus (FMDV) epitope tag, 5′- AGTGTGAGAGGAGATC T TCAAGTGC T TGCACGAAAAGCAGCAAGACCAC T T-3′ (33). CP-NT deletions without a sequence tag fusion (AGIIΔ8, Δ13, and Δ33) were constructed by the same strategy, but with sense primers flanked by a PstI site at their 5′ end followed by a homologous CP-deleted sequence. The AGII-Myc-FMDVΔ13 construct was generated by the same strategy, but with a sense primer flanked by a BamHI site at its 5′ end followed by an FMDV sequence tag and a homologous CP-deleted (Δ13) sequence. The amplified PCR fragments were double digested by BamHI and MluI and cloned into a partial clone (pKSΔSacI-PstI-poly) that already contained a Myc-tagged CP digested by BamHI (underlined) located in the 3′ end of the Myc tag and MluI.

Plant growth, inoculation, and symptom evaluation.

Squash (Cucurbita pepo L. cv. Ma'ayan), cucumber (Cucumis sativus L. cv. Shimshon), and melon (Cucumis melo L. cv. Arava) plants were grown in a growth chamber under continuous light at 23°C. Seedlings were selected for experimental use when their cotyledons were fully expanded. Particle bombardment inoculation was performed with a hand-held device, the handgun (14). Mild virus symptoms are observable only in squash, as the AGII virus does not elicit symptoms on other cucurbits (15); therefore, squash was chosen to test the systemic infectivity of various viral constructs. After bombardment or mechanical inoculation of cotyledons, squash seedlings were grown and examined daily for symptom development, and the first appearance of symptoms on noninoculated leaves was recorded.

RT-PCR analysis of recombinant virus progeny.

Reverse transcription (RT)-PCR of viral progeny was conducted in a one-tube single-step method modified from that of Sellner et al. (28). A 50-μl volume was used containing the CP-NT flanking primers 5′-AGCTCCATACATAGCTGAGACA-3′ and 5′-TGGTTGAACCAAGAGGCGAA-3′ in the following mixture: 1.5 mM MgCl₂, 125 μM deoxynucleoside triphosphates, 1× Sellner buffer (28), 0.03% Triton X-100, 8% phosphate-buffered saline–Tween (8 mg of NaCl per ml, 0.2 mg of KH₂PO₄ per ml, 1.15 mg of Na₂HPO₄ per ml, 0.2 mg of KCl per ml, Tween 20 [0.05%]), 100 ng of each specific primer, 2 U of Taq polymerase, 5 U of avian myeloblastosis virus reverse transcriptase (Chimerex), and 2 to 5 μg of total RNA. RT-PCR cycles were as follows: 46°C for 30 min; 94°C for 2 min, followed by 33 cycles at 94°C, 60°C, and 72°C, each for 30 s; and one final cycle of 5 min at 72°C. Resulting amplified fragments were directly sequenced with a homologous nested primer, 5′-CATTTCCTTTCACGCGTGGC-3′.

Total protein extraction of systemically infected squash leaves.

Three independent squash seedlings were inoculated by particle bombardment with each of the various cDNA constructs. Samples (70 mg; six leaf disks, comprising two of each plant) from symptom-expressing leaves were collected in microcentrifuge tubes 14 or 21 days postinoculation (dpi). The sample was ground in 150 μl of USB buffer (75 mM Tris-HCl [pH 6.8], 9 M urea, 4.5% [vol/vol] sodium dodecyl sulfate [SDS], 7.5% [vol/vol]β-mercaptoethanol), boiled for 5 min, and cooled on ice. Cooled homogenates were centrifuged for 10 min at 10,000 × g, and 100 μl of the supernatant containing total leaf proteins was collected and mixed with 100 μl of 2× protein sample buffer. A 10- to 15-μl sample of the mixture was subjected to SDS-polyacrylamide gel electrophoresis (PAGE) and immunoblotting.

DAS-ELISAs.

Infected plant material (100 mg, nine leaf disks, comprising three from each plant) was ground in enzyme-linked immunosorbent assay (ELISA) sample buffer (15) and centrifuged for 10 min at 10,000 × g. Supernatant (100-μl samples) was loaded on ELISA plates coated with antiserum against ZYMV-CP (1:2,000). Double-sandwich (DAS)-ELISA was performed according to the method of Gal-On (15), with either anti-CP alkaline phosphatase conjugate (1:2,000), anti-FMDV polyclonal antibody (1:2,000) followed by anti-rabbit alkaline phosphatase conjugate (1:4,000), or anti-Myc (1:2,500) monoclonal antibody followed by anti-mouse alkaline phosphatase conjugate (1:4,000).

Affinity purification of His-tagged AGII virions with Ni²⁺-charged resin and electron microscopy observation.

Squash seedlings were inoculated with AGII, AGII-His, and AGII-HisΔ8 cDNAs. Leaf samples (2 g) were taken 11 d.p.i. and homogenized by mortar and pestle with 6 ml of chilled 0.1 M borate, pH 8.0, and 20 mM imidazole (designated HB). The homogenate was filtered through one layer of Miracloth (Calbiochem-Behring, La Jolla, Calif.), and the resulting filtrate was centrifuged at 2,000 × g for 10 min at 4°C. The supernatant (designated Total) was collected and mixed with 600 μl of a 50% slurry of Ni²⁺- charged resin (Cytosignal) that had been equilibrated with HB. The mixture was stirred for 3 h at 4°C and loaded on an empty column (Bio-Rad Laboratories, Richmond, Calif.). Gravity flowthrough (designated Ft) was collected. The column was then washed with 20 column volumes of HB and 10 column volumes of wash buffer (0.1 M borate, pH 8.0, and 50 mM imidazole) to eliminate nonspecifically Ni²⁺-bound proteins. Bound virions were eluted by additions of one-half column volume of elution buffer (0.1 M borate, pH 8.0, and 300 mM imidazole). Samples from total and fourth-eluted fractions were mounted on carbon-coated Formvar grids, which were negatively stained with 2% uranyl acetate for 2 min. Micrographs were obtained with a JEOL JEM-100CXII electron microscope.

Partial purification and immunogold labeling of virus.

Infected leaf material was collected 21 d.p.i. and ground with borate buffer (0.5 M borate [pH. 8.0], 1 mM EDTA), chloroform, and CCl₄ at a ratio of 2:0.5:0.5 (wt/vol). The extract was centrifuged at 10,000 × g for 15 min at 4°C. The supernatant was collected and filtered through three layers of Miracloth (Calbiochem-Behring), and the resulting filtrate was loaded on a 20% sucrose cushion in borate buffer. Partially purified virions were pelleted by ultracentrifugation at 140,000 × g for 2.5 h at 4°C. The pellet was dissolved by shaking overnight with 1/10 diluted borate buffer at 4°C. Ten-microliter samples of partially purified AGII, AGII-Myc, AGII-Myc Δ13, and AGII-Myc Δ23 were adsorbed onto Formvar grids for 2 min. After a 10-min washing step with TBG buffer (20 mM Tris-HCl, pH 8.2; 225 mM NaCl; 1% calf skin gelatin [Sigma Chemical Co., St. Louis, Mo.]; 0.1% bovine serum albumin), the samples were incubated with an anti-Myc monoclonal antibody (Sigma) for 15 min. After six washing steps with TBG buffer, the samples were incubated for a further 15 min with 10-nm gold-labeled anti-mouse immunoglobulin G (Pelco). The grids were finally washed six times with TBG buffer and three times with filtered double-distilled water before staining with 2% uranyl acetate for 2 min. Micrographs were obtained with a JEOL JEM-100CXII electron microscope.

RESULTS

Fusion of His and Myc peptides to the CP-NT permits AGII accumulation and systemic infection.

The ability of AGII, an attenuated zucchini yellow mosaic virus (15), to serve as an epitope presentation system was studied. A 21-nucleotide sequence encoding a seven-residue peptide, comprising six histidines with a serine residue at its N′ end, added to enable processing by the NIa protease (24), was cloned into the AGII genome (Fig. 1A). This created a translational fusion of the cloned sequence with either a full-length CP, AGII-His (Fig. 1A) or a truncated CP lacking eight amino acid residues from its NT, AGII-HisΔ8 (Fig. 1A). A cDNA containing AGII with a similar CP truncation but without an added peptide tag, AGIIΔ8, was constructed as a control for viral infectivity and systemic infection (data not shown).

FIG. 1.

Characterization of AGII-His and AGII-HisΔ8 in systemically infected squash leaves. (A) Schematic presentation of AGII-His and AGII-HisΔ8 CP-NT regions. The insertion site of the His peptide (TAG) in the genomic map of AGII virus and the amino acid sequences at this site are shown. Partial open reading frames (ORFs) of NIb and CP are graphically indicated by a rectangle separated by a solid vertical line. A dotted vertical line separates the His tag (His), CP-NT, and CP core (CORE) ORFs from each other. Residues encoding the NIa protease motif are shown in italics. The amino acid residues recognized by AB6 monoclonal antibody are underlined. (B) Immunoblot analysis of AGII-His and AGII-HisΔ8. Total extracts (15 μl) of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibody. Extracts from virus-free plants (Virus-free) were used as a negative control. All samples, including virus-free samples, were collected from developmentally equivalent leaves at 21 d.p.i. Relative loading of protein in each lane is shown by Ponceau staining. The positions of molecular-mass standards (in kDa) are indicated on the left. (C) DAS-ELISA analysis with anti-CP of samples shown in panel B. Each result is the average of three independent samples taken from three different plants. O.D. 405, optical density at 405 nm.

Both AGII-His and AGII-HisΔ8 were 100% infectious on susceptible squash (Table 1). Symptoms appeared 7 to 8 d.p.i., with characteristics similar to those of the parental AGII virus. Likewise, all squash plants inoculated with AGIIΔ8 cDNA were systemically infectious (Table 1). Similar infectivity was obtained with histidine-tagged cDNA constructs on cucumber and melon. Both chimeric viruses were genetically stable in plants and kept the His tag intact for at least 90 days and through three subsequent passages in squash plants, as determined by RT-PCR of viral progeny and direct sequencing of the amplified product.

TABLE 1.

Characteristics of AGII CP-NT mutants

cDNA clone	Infectivity (%)a	Time of symptom appearanceb (d.p.i.)	Virion assemblyc	Systemic spread in cucurbitsd
AGII	100	7	+	S
AGIIΔ8	100	7	+	S
AGIIΔ13	100	7	+	S
AGIIΔ33	100	7	+	S
AGII-His	100	8	+	S
AGII-HisΔ8	100	7	+	S
AGII-Myc	100	7	+	S
AGII-MycΔ8	100	8	+	S
AGII-MycΔ13	100	7	+	S
AGII-MycΔ18	100	7	+	S
AGII-MycΔ23	100	9	+	S
AGII-MycΔ28	100	8	+	S
AGII-MycΔ33	100	8	+	S
AGII-MycΔ38	100	14	+	S
AGII-MycΔ43	33	17	+	S
AGII-MycΔ48	0	−	NO	N
AGII-FMDV	0	−	NO	N
AGII-FMDVΔ13	0	−	NO	N
AGII-Myc-FMDVΔ13	100	11	+	S
ZYMV-MycΔ33	100	8	+	S

^aFrom a total of nine plants that were tested. 

^b−, no visible symptoms appeared for up to 30 d.p.i. 

^cVirion particles were observed (+) or not (NO) under the electron microscope. 

^dSystemic infection was observed (S) or not (N) in squash, melon, and cucumber. 

The accumulation of His-tagged CPs in systemically infected squash leaves was analyzed by immunoblotting with an anti-His monoclonal antibody. A specific band was detected in AGII-His and AGII-HisΔ8 extracts, but not in AGII or virus-free extracts (Fig. 1B). A band with similar mobility was detected also by anti-CP polyclonal antibodies (Fig. 1B). Immunoblotting with AB6, a monoclonal antibody that recognizes a specific heptapeptide in CP-NT, showed that chimeric CPs accumulated to a level similar to that of wild-type CP (Fig. 1B). In addition, the lower gel mobility of AGII-His CP was consistent with the predicted higher molecular weight resulting from the seven added amino acid residues. Interestingly, DAS-ELISA of the above extracts with anti-CP antibodies failed to detect His-tagged virions (Fig. 1C). This is consistent with the weak detection of His-tagged CPs by the same antibodies by Western blotting (Fig. 1B), suggesting that the protruding CP-NT, containing most anti-CP epitopes (7), is masked by the His tag (Fig. 1C).

To study whether the fused His tag was exposed on the viral surface, virions were tested under native conditions for their ability to bind a Ni²⁺ affinity column, known to bind exposed clusters of His residues (27). Soluble extracts from squash leaves systemically infected with AGII-His, AGII-HisΔ8, and AGII were subjected to Ni²⁺ affinity chromatography. Ni²⁺-bound virions were eluted with 300 mM imidazole, and an equal volume from each fraction was analyzed by immunoblotting. A protein with the same gel mobility as AGII CP was immunodetected by anti-His antibody in the fractions eluted from AGII-His and AGII-HisΔ8 Ni²⁺ affinity columns (Fig. 2A, fractions E2 to E5). Furthermore, no protein was detectable after washes with excess 75 mM imidazole (Fig. 2A, wash lane), suggesting specific binding of His-tagged CPs to Ni²⁺. In contrast, anti-CP antibodies detected nontagged CP in similar amounts in the Total and Ft fractions and not in the eluted fractions, indicating that native CP does not bind Ni²⁺ (Fig. 2A, bottom panel). Electron microscopy analysis of the AGII-His and AGII-HisΔ8 E4 fractions revealed intact virus particles structurally similar to AGII (Fig. 2B, lane E4). However, a higher proportion of broken particles was evident after purification treatments. In addition, these fractions were found to be infectious by mechanical inoculation experiments. In contrast, viral particles were not visible in the AGII E4 fraction under the electron microscope, and its material was not infectious. Together, these results prove that Ni²⁺ binding occurs via the His tag and suggest that the tag is exposed on AGII-His and AGII-HisΔ8 viral surfaces.

FIG. 2.

The His tag is exposed on the surfaces of AGII-His and AGII-HisΔ8 virions. (A) One-step affinity purification of His-tagged virions on Ni²⁺-charged resin. Extracts from squash leaves systemically infected with AGII, AGII-His, and AGII-HisΔ8 were mixed with Ni²⁺-charged resin and subjected to Ni²⁺ affinity chromatography. Equal volumes of pre-Ni²⁺ mixing fraction (Total), column effluent fraction (Ft), final 75 mM imidazole wash fraction (Wash), and the first to fifth 300 mM imidazole eluted fractions (E1 to E5, respectively) were analyzed by immunoblotting with indicated antibodies. The positions of molecular-mass standards (in kDa) are indicated on the left. (B) Transmission electron micrographs of AGII, AGII-His, and AGII-HisΔ8 virions from either the Total or E4 fractions shown in panel A. N.D., not detected. Bar (top right micrograph), 430 nm.

To determine whether a foreign peptide longer than 7 aa residues would support virus assembly and systemic infection, a 48-nucleotide sequence encoding a 16aa peptide from the human c-Myc (Myc [11]) was cloned into the AGII genome to create a translational fusion with CP, AGII-Myc (Fig. 3A). Recombinant AGII-Myc cDNA was able to infect cucurbits seedlings systemically, like AGII. AGII-Myc chimeric virus was genetically stable in plants and kept the Myc tag intact for at least 60 days and three subsequent passages in squash plants, as determined by RT-PCR of viral progeny and direct sequencing of the amplified product. Accumulation of Myc-CP fusion protein in systemically infected squash leaves was analyzed by Western blot analysis with anti-CP and anti-Myc antibodies. A band with slightly slower gel mobility than AGII CP was detected by anti-CP in AGII-Myc extract (Fig. 3B, top panel), as predicted from the fusion of Myc peptide to CP. This band was also specifically detected by anti-Myc antibodies. Comparable levels of CP were found in AGII-Myc and AGII by immunoblotting with AB6 monoclonal antibody (Fig. 3B). DAS-ELISA of the above extracts with anti-CP failed to detect the chimeric virus, indicating an epitope-masking phenomenon similar to that of His-tagged viruses (Fig. 3C).

FIG. 3.

Characterization of AGII-Myc in systemically infected squash leaves. (A) Schematic presentation of AGII-Myc CP-NT region. Partial ORFs of NIb and CP are graphically indicated by a rectangle separated by a solid vertical line. A dotted vertical line separates the Myc tag (Myc), CP-NT, and CP core (CORE) domains from each other. Residues encoding the NIa protease motif and Myc are shown in italics and bold, respectively. (B) Immunoblot analysis of AGII-Myc. Total extracts (15 μl) of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibodies. Extracts from virus-free squash plants (Virus-free) were used as a negative control. All samples, including virus-free samples, were collected from developmentally equivalent leaves at 21 d.p.i. Relative loading of protein in each lane is shown by Ponceau staining. The positions of molecular-mass standards (in kDa) are indicated on the left. (C) DAS-ELISA analysis with anti-CP of samples shown in panel B. Each result is the average of three independent samples taken from three different plants. O.D. 405, optical density at 405 nm.

A Myc peptide fused to a truncated CP-NT permits viral systemic infection.

To ascertain the necessity of the CP-NT domain for systemic infection of AGII, we performed a systematic deletion analysis of CP-NT and tested the infectivity of mutant cDNAs. Initially, AGII cDNAs containing a truncated CP-NT, lacking either 13 (AGIIΔ13) or 33 (AGIIΔ33) aa residues from its N-terminal domain, were constructed. Both cDNAs were found to be infectious, as was AGIIΔ8 cDNA (Table 1). To further study whether the addition of a fused foreign peptide could maintain systemic infection of CP-NT-truncated AGII, we generated serial deletions of CP-NT every five aa from position Ala₈ up to position Ala₄₈ (Fig. 4A). The last deletion (AGII-MycΔ48) completely removed the 43-aa CP-NT and part of the core (32). These deletions were then introduced into the AGII-Myc genome to create a Myc translational fusion with truncated CPs (as described in Materials and Methods) (Fig. 4A). Mutated AGII cDNAs were tested for their ability to support systemic infection in planta. Squash seedlings were inoculated by particle bombardment with various constructs, and symptom appearance on noninoculated leaves, indicative of systemic spread, was recorded. As shown in Table 1, symptoms appeared 7 to 9 d.p.i., as in the parental AGII on plants inoculated with clones containing a deletion of up to 33 aa residues from the NT. Infectivity efficiency and symptom expression were also unchanged. However, deletion of five more residues (AGII-MycΔ38) delayed symptom appearance by 6 days, and deletion of an additional five (AGII-MycΔ43) (Table 1) delayed it by 9 days. Leaves systemically infected by these two impeded viruses exhibited milder symptoms than those infected by AGII and other mutant constructs, including His-tagged AGII. In addition, AGII-MycΔ43 exhibited an infectivity efficiency about three times lower than those of other infectious mutants (Table 1). It is noteworthy that a deletion of up to 43 aa from CP-NT did not affect viral assembly, and the virus particles observed were indistinguishable from AGII particles under the electron microscope (Fig. 5 shows data for AGII-MycΔ13 and AGII-MycΔ23). No viral particles or symptoms were apparent in leaves after inoculation with AGII-MycΔ48.

FIG. 4.

Characterization of Myc-tagged AGII deletion mutants in systemically infected squash leaves. (A) Schematic presentation of the CP-NT region of Myc-tagged AGII deletion mutants. Partial open reading frames (ORFs) of NIb and CP are graphically indicated by a rectangle separated by a solid vertical line. A dotted vertical line separates the Myc tag (Myc), CP-NT, and CP core (CORE) domains from each other. Residues encoding the NIa protease motif and Myc are shown in italics and bold, respectively. (B) Immunoblot analysis of Myc-tagged AGII deletion mutants. Total extracts (10 μl) of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibodies. All samples were collected from developmentally equivalent leaves at 21 d.p.i. Relative loading of protein in each lane is shown by Ponceau staining. The positions of molecular-mass standards (in kDa) are indicated on the left. Relative amounts of Myc-CP fusion protein were determined by a densitometric scan of the anti-Myc signal and are shown at the bottom. (C) Immunoblot analysis of AGII, AGII-MycΔ33, and ZYMV-MycΔ33. Total extracts (15 μl) of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibodies. All samples were collected from developmentally equivalent leaves at 21 d.p.i. The positions of molecular-mass standards (in kDa) are indicated on the left.

FIG. 5.

The Myc tag is exposed on the surfaces of chimeric virions. (A) Comparative detection of CP and Myc epitopes on AGII and Myc-tagged deletion mutant viruses. The level of each virion was determined by DAS-ELISA with the indicated antibody and is the average of three independent samples taken from three different plants 21 d.p.i. (B) Immunogold labeling of AGII, AGII-Myc, AGII-MycΔ13, and AGII-MycΔ23. Partially purified AGII, AGII-Myc, AGII-MycΔ13, and AGII-MycΔ23 virions were incubated with anti-Myc monoclonal antibody. The micrographs are each a composite from several fields of view. Bar (top right micrograph), 150 nm. O.D. 405, optical density at 405 nm.

RT-PCR of viral progeny and direct sequencing of the amplified product confirmed the presence of the Myc sequence in the CP-NT of various deletion mutants. Immunoblotting of total protein extracts from systemically infected squash leaves with anti-Myc monoclonal antibody detected a specific protein band in all Myc-tagged mutants and not in parental AGII (Fig. 4B). The increase in gel mobility of detected bands was consistent with the predicted reduced molecular weight of each deleted CP-NT. A similar level of Myc-CP fusion protein was detected in AGII-Myc, AGII-MycΔ8, and AGII-MycΔ13 (Fig. 4B, relative Myc-CP). However, extended CP-NT truncations caused a stepwise decrease in the relative amount of Myc-CP fusion protein (Fig. 4B, relative Myc-CP). Protein bands with similar gel mobilities were also detected by anti-CP polyclonal antibody (Fig. 4B). In addition, immunoblotting with AB6 monoclonal antibody, which recognizes CP-NT residues Gly₂₂ to Thr₂₈ (see reference 7 and Fig. 1), detected chimeric CPs with truncations of up to 23 aa residues (Fig. 4B). No band was detected in CP-NT deletions greater than 23 aa, demonstrating that the expressed Myc-CP fusion protein did not contain the amino acid residues comprising the AB6-specific epitope (Fig. 4B). Furthermore, weak detection of AGII-MycΔ23 CP by AB6 antibody is consistent with the loss of two amino acid residues from the AB6 epitope and does not reflect the AGII-MycΔ23 CP accumulation level.

To verify that our results were not unique to the AGII virus (15), which is an attenuated ZYMV, a ZYMV-MycΔ33 clone was constructed as was described for AGII-MycΔ33. Infection of squash seedlings with ZYMV-MycΔ33 resulted in a systemic infection with characteristics similar to those of AGII-MycΔ33 (Table 1), but as expected, with severe symptoms. Moreover, immunoblot analysis of leaves verified the presence of chimeric CP with gel mobility similar to that of Myc-CPΔ33 (Fig. 4C).

The Myc peptide fused to the CP-NT is presented on the viral surface.

To establish that the Myc tag was exposed on the viral surface, quantitative DAS-ELISA of samples with anti-Myc antibody was performed, with samples taken from the same leaves as were used for Western analysis. An anti-Myc ELISA signal was detected with all mutant virus samples and not with the AGII sample, suggesting that the Myc epitope was indeed exposed on the chimeric viral surface (Fig. 5A, anti-Myc). Nevertheless, stronger signals were apparent with AGII-MycΔ38 and Δ43, although their CP accumulation did not seem to be greater according to Western blot analysis (Fig. 5A, anti-Myc versus Fig. 4B, relative Myc-CP). This might indicate that the Myc peptide displayed on a short NT is more accessible to anti-Myc antibody than that in other mutants containing longer NTs. Additionally, a lower anti-CP ELISA signal was measured for all mutants when compared to that elicited by AGII. This probably results from the deletion of anti-CP epitopes and their masking by the fused Myc peptide (Fig. 5A, anti-CP).

Immunogold-labeling experiments were performed to compare representative chimeric viruses and AGII. The morphologies of all virus particles were similar (Fig. 5 and data not shown). AGII-Myc, AGII-MycΔ13, and AGII-MycΔ23 were successfully gold labeled when incubated with a monoclonal antibody against Myc. In contrast, no labeling was apparent with AGII. Taken together, our data provide conclusive evidence that the Myc peptide fused to intact or truncated CP-NT was presented on the viral surface and that its antigenic determinants were exposed.

The systemic infectivity of AGII with FMDV peptide fused to its CP-NT can be restored by fusion of a Myc tag.

To assess the ability of other foreign sequences to allow systemic infectivity of AGII containing CP with truncated NT, the 16-aa FMDV CP immunogenic epitope (33) was fused to AGIIΔ13 (AGII-FMDVΔ13) (Fig. 6A). As a positive control, the FMDV was fused to AGII CP to create AGII-FMDV (Fig. 6A). Neither cDNA clone was infectious, suggesting that FMDV disrupts viral infectivity. The possibility of restoring viral infectivity by fusion of Myc upstream of the FMDV was tested. The sequence encoding the FMDV peptide was inserted into the AGII-MycΔ13 to create a translational fusion with Myc on its NT. This created a 31-aa foreign peptide fused to CPΔ13 NT which was designated AGII-Myc-FMDVΔ13 (Fig. 6A). The new clone was infectious on various cucurbits, and typical symptoms appeared 4 days later than those elicited by AGII (Table 1). The chimeric virus was genetically stable in plants and kept Myc and FMDV sequences intact for at least 30 days or three subsequent passages in squash plants, as determined by RT-PCR of viral progeny and direct sequencing of the amplified product. Immunoblotting of squash leaf extracts with either anti-Myc monoclonal antibody or anti-FMDV and anti-CP polyclonal antibodies detected a protein band with a similar mobility, suggesting that both tags were fused to the same coat protein (Fig. 6B, lane AGII-Myc-FMDVΔ13). In contrast, anti-FMDV antibody did not detect any band in extracts from AGII or AGII-MycΔ13 (Fig. 6B). DAS-ELISA of the above extracts using anti-Myc or anti-FMDV antibodies detected both tags (Fig. 6C). These results suggest that both Myc and FMDV epitopes are exposed on the surfaces of AGII-Myc-FMDVΔ13 virions.

FIG. 6.

Characterization of FMDV-tagged AGII mutants in systemically infected squash leaves. (A) Amino acid sequences of FMDV-tagged AGII mutants at the NIb/CP insertion point. Residues encoding FMDV and Myc tags are shown in bold and underlined, respectively. Residues encoding NIa protease motif are shown in italics. (B) Immunoblot analysis of AGII, AGII-MycΔ13, and AGII-Myc-FMDVΔ13. Total extracts of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibodies. All samples were collected from developmentally equivalent leaves at 21 d.p.i. The positions of molecular-mass standards (in kDa) are indicated on the left. (C) DAS-ELISA analysis of AGII-MycΔ13 and AGII-Myc-FMDVΔ13 samples shown in panel B. Analysis was performed with either anti-Myc or anti-FMDV antibody in two different ELISA plates. Each result is the average of three independent samples taken from three different plants. O.D. 405, optical density at 405 nm.

DISCUSSION

The CP-NT is exposed on the virion surface (29) and is highly variable in length and sequence among different potyviruses (31) and their strains (7). It has been shown, by deletion analysis, that the CP-NT of TEV potyvirus is involved in long-distance movement (9). Furthermore, studies have shown that single changes of the CP-NT affect potyviral accumulation and systemic movement (2, 3, 20). Nevertheless, to date, the exact function of the variable CP-NT in viral systemic movement remains unclear. In the present study, we demonstrated for the first time that the entire CP-NT sequence of ZYMV-AGII could be deleted or replaced by a nonviral sequence while maintaining viral systemic infection.

The HC-Pro of the attenuated ZYMV virus AGII differs from that of the wild type by a single amino acid change (15). As the HC-Pro is known to associate with the CP-NT (6, 22) we wished to confirm that our results are not restricted to AGII but apply to the wild-type ZYMV as well. The wild-type-based mutant ZYMV-MycΔ33 showed a systemic infectivity similar to that of the attenuated mutant AGII-MycΔ33. We therefore concluded that the difference in HC-Pro between these two mutants is irrelevant for systemic infection.

We have shown that the fusion of two totally unrelated foreign sequences, encoding His or Myc peptide, to the intact or truncated AGII CP-NT domain did not interrupt virion assembly and permitted systemic infection, without alteration of symptom expression in ZYMV-susceptible cucurbits. It is noteworthy that Fernandez-Fernandez et al. (12) were able to demonstrate that the insertion of various sizes of foreign sequences inside the plum pox virus CP-NT did not prevent viral systemic spread. Together, these findings suggest that the length and sequence of the authentic AGII CP-NT are not critical factors in establishing viral systemic infectivity. This conclusion is reinforced by the systemic infectivity of AGII-MycΔ43 lacking the entire surface-exposed CP-NT (Table 1). This is in contrast to what has been shown in TEV in tobacco where deletion of most of the CP-NT abolished viral long- distance movement, suggesting the possible involvement of a phloem-specific host factor that recognizes TEV CP-NT to facilitate viral long-distance movement (9). Our data suggest that a different mechanism exists for ZYMV systemic spread and may imply that interactions between CP-NT and a host factor are not involved in the establishment of viral systemic infection. It has been shown that squash, unlike tobacco, is characterized by the presence of unusually large numbers of plasmodesmata at the interface between minor vein companion cell-sieve element complex and the surrounding cells (34). Since viruses utilize these plasmodesma connections for loading into the plant vascular system, structural differences in this system might suggest different requirements for the establishment of systemic movement between tobacco and squash.

The decrease in CP accumulation, deduced from the combined Western blot analysis with anti-Myc and AB6, observed for mutants that contained NT deletions of more than 13 amino acids, and the reduced infectivity rate and delayed symptom appearance seen in AGII-MycΔ38 and AGII-MycΔ43 may imply that as the CP-NT becomes shorter, it probably lacks certain amino acid residues that are required for optimal virus accumulation and spread. A similar conclusion can be drawn from a number of studies demonstrating that altered amino acids in the CP-NT region could modulate virus movement (20) and accumulation (3).

Although Myc peptide fusion supported viral systemic infection with truncations of up to 43 aa from the CP-NT, its fusion to a deletion mutant lacking 5 aa from the CP core region (AGII-MycΔ48) did not allow systemic infection. This is consistent with the behavior of various potyvirus core mutants that have been produced previously (10, 35). As the core region is essential for virion formation (17), replication (10), and cell-to-cell movement (9), we could assume that our core deletion mutant also disrupts viral encapsidation and causes dysfunctional viral movement.

In contrast to the Myc peptide (15 aa), fusion of similarly sized FMDV peptide (17 aa) to a wild-type (AGII-FMDV) or truncated CP-NT (AGII-FMDVΔ13) did not support systemic infectivity, suggesting that fused FMDV interrupts the assembly of CP subunits into a stable virion which is necessary for systemic spread. Nevertheless, the fusion of a Myc peptide at the NT of FMDV-CP (AGII-Myc-FMDVΔ13), to generate a Δ13-truncated CP-NT fused to both Myc and FMDV, restored viral systemic infectivity and enabled the presentation of both foreign peptides on the viral surface. This demonstrates that a terminally placed peptide can facilitate the presentation of another foreign peptide that by itself could not be presented.

We have proved by Ni²⁺ affinity purification and immunogold labeling that the N-terminally fused His and Myc peptides are exposed on the viral surface and can cause a complete masking of the CP-NT immunodominant epitopes. This is in accordance with the prediction that the potyviral CP-NT domain is exposed on the viral surface and can serve as an anchor for a fused foreign peptide (12, 18).

Taken together, our findings suggest that a foreign peptide can substitute for part or all of the wild-type ZYMV CP-NT and still permit viral systemic infection. This conclusion might be extended to other potyviruses as well. Furthermore, we have shown that a foreign epitope of at least 31 aa can be presented on the ZYMV virion surface, paving the way for the use of ZYMV as an epitope presentation system.