Abstract
Background
At present, fat transplantation is widely used in the plastic surgery industry, but the long-term preservation rate of transplanted fat decreases because of complications such as oil cysts due to the inability in macrophages to metabolize absorption. In cell-assisted lipotransfer technology, adipose-derived stem cells (ASCs) can influence the inflammatory response of grafts through the immunoregulation in macrophages, and the lipid metabolism in macrophages plays an important role in this process. Therefore, we hypothesized ASCs could improve the retention rate of fat grafts by regulating the progress of lipid metabolism in macrophages.
Methods
We established fat transplantation and ASC-assisted fat transplantation model in C57BL/6 mice in vivo, and bone marrow-derived macrophages cocultured with apoptotic adipocytes were treated with or without ASCs in vitro. Graft retention, tissue structure, fibrosis, macrophage phenotype transformation, lipid deposition, mitochondrial morphology, oxygen consumption rate (OCR), fatty acid β-oxidation (FAO) level, and ATP production were assessed. Additionally, fat transplantation and ASC-assisted fat transplantation model was treated with etomoxir which inhibits mitochondrial FAO. Macrophages pretreated with etomoxir were co-cultured with apoptotic adipocytes and treated with or without ASCs. The method aboved was used for detection and verification.
Results
In vivo, ASC-assisted fat transplantation improved macrophage mitochondrial expression and FAO level, promoted the early transformation of M2 macrophages, reduced the long-term lipid deposition of macrophages, and improved the retention rate of fat grafts. In vitro, ASCs up-regulated the level of mitochondrial FAO, OCR and ATP production in macrophages, reduced lipid deposition of macrophages and promoted M2 macrophages polarization by paracine function. The ability of ASCs in group pretreated with etomoxir to reduce the foaming of macrophages, promote the transformation to M2 macrophages, and improve the retention rate of fat transplantation was weakened.
Conclusions
ASCs increased the retention rate of transplanted fat by upregulating mitochondrial FAO to promote M2 polaration in macrophages. In addition, ASCs up-regulate mitochondrial FAO by paracrine effect to reduce foam cells formation and promote M2 transformation in macrophages in vitro.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13287-024-03953-4.
Keywords: Fat transplantation, Adipose-derived stem cell, Macrophage, Lipid metabolism, Mitochondrial fatty acid β-oxidation
Introduction
At present, fat transplantation technology is widely used in plastic surgery and reconstruction [1–4]. However, after fat transplantation, due to the necrosis and apoptosis of many fat cells in the early ischaemic and hypoxic environment of the recipient area, oil droplets are released outside the fat cells, aggravating graft inflammation and leading to complications such as oil cysts, which reduce the long-term retention rate of transplanted fat [5, 6].
In recent years, cell-assisted fat transplantation technology has been shown to significantly improve the retention rate of transplanted fat [7, 8]. Adipose-derived stem cells play an important role in improving the retention rate and reducing complications, and the underlying mechanism is believed to involve the immune regulation of macrophages dominated by ASCs [9–12]. According to their different activation states, macrophages can be divided into classically activated M1 macrophages and alternatively activated M2 macrophages [13]. After removing dead cells and oil droplets, M1-type macrophages in grafts transform into M2-type macrophages, which are involved in repair and regeneration [14, 15]. Our previous studies showed that an appropriate concentration of ASCs can promote the transformation of M1 to M2 macrophages in a paracrine manner and improve the retention rate of transplanted fat.
In recent years, cell metabolism has become a key regulator of macrophage activation, function and biology [16]. Metabolic changes contribute to the regulation of macrophage activation and the acquisition of new functions as adaptations to specific environments [17–19]. After fat transplantation, M1-type macrophages engulf necrotic adipocytes in the early stage, with metabolic energy supplied mainly by glycolysis and the pentose phosphate pathway; however, oxidative phosphorylation (OXPHOS) is impaired. After engulfing necrotic adipocytes, the metabolic energy supply of macrophages changes to mitochondrial FAO, and the cells gradually transform from the M1 to M2 phenotype to reduce inflammation and initiate regeneration [20–22]. However, some M1 macrophages cannot completely metabolize lipid droplets after fat transplantation; thus, the formation of macrophage foam cells (MFCs) aggravates graft inflammation and reduces the retention rate [23, 24]. Therefore, under the high-fat environment of fat transplantation, ASCs may promote the polarization of macrophages from the M1 to M2 phenotype and increase the retention rate by altering the energy metabolism pathway of macrophages.
In this study, an in vivo ASC-assisted fat transplantation model and in vitro high-fat macrophage model cocultured with ASCs were established and treated with etomoxir. By assessing lipid deposition, macrophage polarization, and mitochondrial morphology and function in macrophages, the key role of ASCs in regulating mitochondrial FAO in promoting transplanted fat retention in macrophages was determined.
Methods
Cell culture and coculture strategy
The 4-week-old C57BL/6 mice were sacrificed by cervical dislocation method and the fat pad in their groin was removed. The fat tissue was washed with PBS and cut into pieces. The pieces were digested in 0.075% type I collagenase (Sigma Aldrich, USA) at 37 °C for 40 min. Cell fragments were filtered from the samples, which were then centrifuged at 1000 rpm for 5 min. The upper layer (adipocytes) was cultured in DMEM (Gibco, CA) containing 10% foetal bovine serum (Gibco, CA). The bottom layer (cell precipitate) was added to red blood cell lysis buffer (Roche, CH) to remove red blood cells, after which the samples were centrifuged and cultured in complete adipose mesenchymal stem cell culture medium (Cyagen, CN). The morphology of the third-passage ASCs exhibits the characteristic spindle shape indicative of mesenchymal stem cells, as depicted in Supplementary Fig. S1A. Additionally, the flow cytometry analysis of the third-passage ASCs has been conducted, revealing the phenotype CD31-/CD34-/CD45-/CD29 + /CD44 + /CD105 + (Fig. S1 B).
After euthanizing 6- to 8-week-old C57BL/6 mice by cervical dislocation method, the tibia and femur were surgically removed, and the bone marrow was collected, filtered with a sieve, and centrifuged at 1000 rpm for 5 min. After centrifugation, the bottom layer (cell precipitate) was resuspended in red blood cell lysis buffer to remove red blood cells, followed by centrifugations, after which the supernatant was discarded. Monocyte macrophages were cultivated in 1640 complete culture medium (Gibco, CA) containing 20 ng/ml mouse macrophage stimulating factor (M-CSF) (PeproTech, USA), and differentiation was induced for 6–7 days to obtain M0 macrophages. All cell cultures were placed in a Thermo Fisher (USA) cell culture incubator at 37 °C with 5% CO2.
Adipocytes were seeded into plates and cultured for 24 h. The medium was replaced with DMEM (serum-free) containing 10 ng/ml TNF-α (PeproTech, USA) for 24 h, after which the medium containing TNF-α was removed. Bone marrow-derived macrophages pretreated with 106 200 μM etomoxir (MedChemExpress, CN) for 24 h were directly cocultured with adipocytes in a transwell plate, while equal amounts of ASCs were added to the transwell chamber for indirect coculture. Prior to the formal experiment, we performed preliminary analyses to determine the effects of etomoxir at various concentration and time gradients on the relative expression of CPT-1α protein in bone marrow-derived macrophages (Fig. S1 C–F).
Experimental animals and ASC-assisted fat transplantation
All experiments were approved by the Ethics Committee of the First Affiliated Hospital of Harbin Medical University and the work has been reported in line with the ARRIVE guidelines 2.0. C57BL/6 mice were provided by Liaoning Changsheng Biotechnology Co., Ltd. The diet was purchased from Liaoning Changsheng Biotechnology Co., Ltd.
The 6- to 8-week-old C57BL/6 mice were sacrificed by cervical dislocation method and the fat pad in their groin was removed. The fat tissue was washed with PBS and cut into pieces. ASC-conditioned medium (ASC-CM) was prepared from the 3rd-5th passage of 80% confluent ASCs and cultured with serum-free DMEM for 24 h. The supernatant was collected and filtered through a 0.22 μm filter to remove cells. Researchers randomly divided 6-week-old male C57BL/6 mice into control group and ASC-assisted fat transplantation group, which were anesthetized by intraperitoneal injection of 50 mg/kg sodium pentobarbital (Merck, DE). Then, 0.3 ml of prepared C57BL/6 adipose tissue was mixed with 100 μl of ASC-CM with a concentration of 3 × 105, or 3 × 104 ASCs suspended in 100 μL of PBS, and the mixture was injected into the subcutaneous tissue of the back of C57BL/6 mice with a 1-ml syringe. Fat was subcutaneously injected into a consistent location below the scapula on the dorsal aspect of the mice. Each mouse received a single injection of fat at this site. The volume of fat administered was standardized at 0.3 ml to ensure uniformity across all subjects. Furthermore, all fat transplantation procedures were conducted following a rigorously defined protocol to guarantee the consistency of surgical techniques among the experimental groups. The mice were fed with standard routine after operation, excluding mice that died due to anesthesia accidents, postoperative infections, and other reasons. The grafts were removed at 1, 4, and 12 weeks after transplantation, and graft volume was measured by the drainage method. A single mouse was used as the experimental unit in this study, to eliminate the effect of individual differences in the experiment, we performed seven biological replicates for each group of mice. The animals were euthanized by cervical dislocation after the experiment.
Cell oxygen consumption rate (OCR)
After bone marrow-derived macrophages were loaded with lipids, the cells were seeded in an XF96 cell culture plate. A Seahorse XFp Cell Energy Phenotyping Kit was used for the OCR assays. After washing with XF cleaning solution, the cells were incubated for 20 min in oligomycin (1 μM), the uncoupling agent FCCP (1 μM), rotenone (1 μM) and antimycin (1 μM). Mitochondrial respiration data were obtained on a Seahorse Xfe96 instrument.
Transmission electron microscopy
Graft tissue samples and high-fat-treated macrophages were collected, fixed with precooled 3% glutaraldehyde at 4 °C for 4 h, and dehydrated with an alcohol gradient, after which the samples were mounted for TEM. Imaging was performed on a Thermo Scientific Talos F200X transmission electron microscope.
AqPCR
Total RNA was isolated from graft tissue samples and high-fat-treated macrophages using TRIzol (Invitrogen, USA) reagent. After assessing the purity and integrity of the extracted RNA, cDNA was amplified (40 cycles) using the QuantiTect Reverse Transcription Kit (Qiagen) and the Rotor-Gene 3000 Real-Time PCR Detection System (Corbett Research, Sydney, Australia). The expression levels were calculated by the 2−ΔΔCt method. The following primers were used: iNOS (Invitrogen), forward 5’- CCAGCCTTGCATCCTCATT -3’, reverse 5’-CACTCTCTTGCGGACCATCT-3’; IL-6 (Invitrogen), forward 5’- TTTCCACGATTTCCCAGAGA -3’, reverse 5’—GTTGCCTTCTTGGGACTGAT -3’; ARG-1 (Invitrogen), forward 5’- CTGACATCAACACTCCCCTG -3’, reverse 5’—GCAGATATGCAGGGAGTCAC -3’; IL-10 (Invitrogen), forward 5’- AACATACTGCTAACCGACTC -3’, reverse 5’—CACTGCCTTGCTCTTATT -3’; PPARα (Invitrogen), forward 5’- CCTTGGCGTGTCTTCATAAC -3’, reverse 5’—GATGGCACCAAGGACAGTAG -3’; PGC-1α (Invitrogen), forward 5’- AAGGTCCCCAGGCAGTAGAT -3’, reverse 5’—TCCCTCTTGAGCCTTTCGT -3’; CPT-1α (Invitrogen), forward 5’- GGGCCGATCATGGTTAACAG -3’, reverse 5’—CGTGCGACGATACAGCAGTA -3’; and GAPDH (Invitrogen), forward 5’- GGCCTCCAAGGAGTAAGAAA -3’, reverse 5’—GCCCCTCCTGTTATTATGG -3’.
Western blot
The graft tissue samples and high-fat-treated macrophages were lysed with RIPA buffer (Solarbio, CN), and the protein concentrations in lysates were determined with a BCA protein assay kit (Thermo Fisher Scientific, USA). Western blot analysis was performed using β-actin or GAPDH as controls. Primary antibodies against PPARα, PGC-1α and CPT-1α were purchased from Abcam. Signals were detected using an ECL Plus detection system (Thermo Fisher Scientific), and the signal intensity was quantified using ImageJ software.
Immunofluorescence
The graft tissue samples and high-fat-treated macrophages were fixed with 4% paraformaldehyde for 30 min at 4 °C and dehydrated with a sucrose gradient. After the tissues or cells were embedded and dehydrated, they were washed twice with PBS solution. The tissues or cells were incubated with primary antibodies (anti-MAC2, anti-perilipin, anti-CD206, anti-BODIPY, and anti-TOM20 (Abcam, USA)), DAPI (to stain nuclei) and cover slipped. Images were acquired and analysed on a C1Si confocal laser scanning microscope (Nikon, Tokyo, Japan).
Flow cytometry
Bone marrow-derived macrophages were collected after treatment, and cell pellets were obtained by centrifugation. A total of 5 × 106 cells and anti-CD206 and anti-CD11c antibodies (Thermo Fisher Scientific, USA) were added to a flow tube and incubated at 4 °C for 30–40 min in the dark. The cells were immobilized and permeabilized using fixation buffers and osmotic buffers (BD Biosciences, USA). The collection was performed on a Coulter Epics-XL flow cytometer using System II software (Coulter Corporation, USA). The analysis was performed using FCS Express software (De Novo Software, USA).
HE and Masson’s trichrome staining
Full-thickness biopsies of the grafts were obtained at 1, 4 and 12 weeks after grafting. The samples were fixed in 4% paraformaldehyde for 24 h, dehydrated, embedded in paraffin, and stained with haematoxylin and eosin (H&E) and Masson’s trichrome. The samples were sectioned and examined under an Olympus BX51 microscope. Images were acquired using an Olympus DP71 digital camera. The quantification of the fibrosis area determined by Masson staining in all groups over time was performed with ImageJ software.
FFA detection in the culture supernatant
The culture supernatant of the macrophages was incubated at room temperature for 1 h, followed by centrifugation at 3500 rpm for 15 min at 4 °C. The supernatant was removed, and a Solarbio (CN) assay kit was used to measure the content of FFAs in the culture supernatant.
Statistical analysis
All data were analyzed using the IBM SPSS version 20.0 software (IBM Corp., Armonk, NY, USA). Data were expressed as mean ± SD. Two-way analysis of variance was used to compare groups at multiple time points. The independent Student’s t-test was used to compare two groups at a single time point. A two-tailed P-value less than 0.05 was considered statistically significant.
Results
ASC-assisted fat transplantation improved the retention rate of transplanted fat, reduced macrophage foaming, and promoted the polarization of macrophages towards the M2 phenotype
The volume retention rates for fat grafts in the stem cell-assisted fat transplantation group at 1 week, 4 week, and 12 week were significantly greater than those in the normal fat transplantation group (Fig. 1A, B). The adipose tissue from the transplantation area of mice after fat transplantation was harvested for HE staining, and the results showed that the inflammatory cell infiltration of adipose tissue in the ASC group was significantly less than that in the control group at 1 week after transplantation; more new adipose cells existed in the ASC group at 4 week, and more new blood vessels existed in the ASC group at 12 week. There were more oil sacs and vacuoles in the control group (Fig. 1C). Masson staining revealed significantly less collagen deposition in the adipose tissue of the ASC group than in that of the control group at 1 week, 4 week and 12 week after transplantation (Fig. 1D). Immunofluorescence revealed that the number of cells with double-positive MAC2 and CD206 expression was significantly greater in the ASC group than in the control group (Fig. 1E) and that the ratio of M2 macrophages to M1 macrophages in the visual field at 1 week and 4 week was significantly greater in the ASC group than in the normal fat transplantation group (Fig. 1F). The total number of macrophages in the fluorescent visual field was slightly greater in the ASC group than in the normal fat transplantation group at 1 week but decreased significantly at 4 week and 12 week and was lower than that in the normal fat transplantation group (Fig. 1G). The adipose tissue at the transplantation site at 4 week after fat transplantation was observed under an electron microscope, and the results showed that the intracellular lipid droplet deposition of macrophages in adipose tissue was significantly lower (Fig. 1H). qPCR revealed that the levels of iNOS and IL-6 in the ASC group were significantly lower than those in the normal fat transplantation group and that the levels of Arg1 and IL-10 in the ASC group were significantly greater than those in the normal fat transplantation group (Fig. 1I-L).
Fig. 1.
Comparison of retention rate, lipid deposition degree and polarization level of macrophages between different groups. A Appearance of fat grafts at week 1, week 4 and week 12 after fat transplantation in each group. B Fat graft volume retention rate at week 1, 4 and 12 after fat transplantation in each group. C Hematoxylin and eosin (H&E) staining of fat grafts was performed at 1 week, 4 weeks, and 12 weeks post-transplantation in each group. The newly-formed adipocytes are delineated with red lines, and the oil sacs are indicated with a black asterisk, with the scale = 100 μm. D Masson three-color staining of fat grafts at week 1, week 4 and week 12 after fat transplantation, with the scale = 100 μm. E Immunofluorescence was used to detect macrophage infiltration in each group at week 1, 4 and 12 after fat transplantation, with MAC2(red) representing macrophages. We defined MAC2 + CD206- cells as M1 macrophages and MAC2 + CD206 + cells as M2 macrophages. F Quantitative analysis of the ratio of the number of M2 macrophages to the number of M1 macrophages over time. G Quantitative analysis of the total number of macrophages in each group over time. H The fat grafts were observed 4 weeks after fat transplantation under electron microscope. I The relative expression of iNOS mRNA in fat grafts at 1, 4 and 12 weeks after q-PCR detected fat transplantation. J The relative expression of IL-6 mRNA in fat grafts at 1, 4 and 12 weeks after q-PCR detected fat transplantation. K The relative expression of ARG-1 mRNA in fat grafts at 1, 4 and 12 weeks after q-PCR detected fat transplantation. L The relative expression of IL-10 mRNA in fat grafts at 1, 4 and 12 weeks after q-PCR detected fat transplantation. Con group was normal Fat Transplantation Group, ASC Group was ASCS Assistant Fat Transplantation Group. Data are expressed as the means ± standard deviation. nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, n = 7
ASCs increased the number of macrophage mitochondria and FAO levels in adipose tissue
In the ASC-assisted fat transplantation group, the number of mitochondria in macrophages was significantly greater than that in the normal fat transplantation group (Fig. 2A, B). WB revealed that at 1 week and 4 weeks after fat transplantation, the protein levels of PPARα, PGC-1α and CPT-1α, which are closely related to lipid metabolism, in the adipose tissue of the transplantation area were significantly greater in the ASC-assisted fat transplantation group than in the normal fat transplantation group (Fig. 2C–F). In the ASC group, the levels of PPARα and PGC-1α proteins were higher than those in the control group at the 12-week mark post-transplantation (Fig. S2 A-D). Moreover, at 1 week and 4 week, the relative mRNA expression levels of PPARα, PGC-1α and CPT-1α in the ASC group were significantly greater than those in the normal fat transplantation group (Fig. 2G–J).
Fig. 2.
Comparison of mitochondrial morphology and function between different groups. A The mitochondria of macrophages in each group were detected by immunofluorescence. MAC2(red) represented macrophages and TOM20 (blue-green) represented mitochondria. B Quantitative statistical analysis of the proportion of mitochondrial area in macrophages in immunofluorescence results. C The relative expression levels of PPAR α, PGC-1 α and CPT-1 α were detected by immunoblotting in the fat grafts of each group at 1 week and 4 weeks after Fat Transplantation. Full-length blots/gels are presented in Supplementary Fig. S1. D Quantitative statistical analysis of the relative expression of PPARα protein in 1 week and 4 week fat graft from western blot analysis. E Quantitative statistical analysis of the relative expression of PGC-1α protein in 1 week and 4 week fat graft from western blot analysis. F Quantitative statistical analysis of the relative expression of CPT-1α protein in 1 week and 4 week fat graft from western blot analysis. G The relative expression of PPARα mRNA in fat grafts at 1, 4 and 12 weeks after q-PCR detected fat transplantation. H The relative expression of PGC-1α mRNA in fat grafts at 1, 4 and 12 weeks after q-PCR detected fat transplantation. I The relative expression of CPT-1α mRNA in fat grafts at 1, 4 and 12 weeks after q-PCR detected fat transplantation. Data are expressed as the means ± standard deviation. nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, n = 7
ASCs promoted early phagocytosis and digestion by macrophages, reduced late intracellular lipid droplet deposition, and promoted M2 polarization in macrophages.
There were more BODIPY-labelled intracellular lipid droplets in the 24 h MFASC group than in the MF group, and there was less deposition of intracellular lipid droplets in the 72 h ASC group than in the MF group, which also had larger and more aggregated lipid droplets (Fig. 3A, B). Electron microscopy revealed that the number of MFCs was significantly lower in the MFA group than in the MF group (Fig. 3C). qPCR revealed that the iNOS and IL-6 levels in the ASC group were significantly lower than those in the MF group, while the ARG1 and IL-10 levels were significantly greater in the MF group (Fig. 3D–G). The flow cytometry results showed that the M2/M1 ratio in the MFA group was significantly greater than that in the MF group (Fig. 3H, I). Moreover, the FFA level in the cell culture supernatant in the MFA group was lower than that in the MF group (Fig. 3J).
Fig. 3.
Lipid deposition and macrophage polarization were compared in different groups. A Immunofluorescence detected the lipid deposition of macrophages in each group. MAC2 (red) represented macrophages and Bodipy (yellow) represented intracellular lipid droplets. B Immunofluorescence results measured the proportion of lipid droplet area in macrophages. C The lipid droplets in macrophages of each group were observed by electron microscopy. D The relative expression of iNOS mRNA in macrophages at different times was detected by q-PCR. E The relative expression of IL-6 mRNA in macrophages at different times was detected by q-PCR. F The relative expression of ARG-1 mRNA in macrophages of each group at different time was detected by q-PCR. G The relative expression of IL-10 mRNA in macrophages of each group at different time was detected by q-PCR. H The expressions of CD206 and CD11c in macrophages of each group were detected by flow cytometry at different time points. We defined CD206−CD11c+ in Q4 as M1 macrophages, and CD206+CD11c− in Q1 as M2 macrophages. I The ratio of the number of M2 macrophages to the number of M1 macrophages in flow cytometry was quantitatively analyzed over time. J The content of free fatty acids in the macrophage culture supernatant of each group at different time was analyzed. The M group consisted of bone marrow derived macrophages, the MF group consisted of bone marrow derived macrophages directly co-cultured with primary adipocytes, and the MFA group consisted of bone marrow derived macrophages directly co-cultured with primary adipocytes and indirectly co-cultured with ASC through transwell chamber. Data are expressed as the means ± standard deviation. nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, n = 7
ASCs improved the mitochondrial status of high-fat-treated macrophages and increased FAO levels.
The immunofluorescence results showed that the number of mitochondria decreased significantly after the coculture of macrophages and adipocytes and that the number of mitochondria increased after ASC intervention. Additionally, ASCs promoted the phagocytosis and digestion of lipid droplets at 24 h and reduced late intracellular lipid droplet deposition (Fig. 4A–C). The electron microscopy results showed that the mitochondria in the MF group swelled significantly in the early stage of the coculture of macrophages and adipocytes; mitochondria in the late stage had a compact shape; and ASCs significantly normalized mitochondrial morphology. Moreover, at 72 h, there were still more undigested lipid droplets in the macrophages of the MF group and fewer intracellular lipid droplets in the macrophages of the ASC group (Fig. 4D).
Fig. 4.
Comparison of the number and morphology of mitochondria in different groups of macrophages. A Immunofluorescence detected the mitochondria and lipid deposition of macrophages in each group. MAC2(red) represented macrophages, TOM20 (blue-green) represented mitochondria, and Bodipy (yellow) represented intracellular lipid droplets. B Quantitative statistical analysis of the proportion of lipid droplet area in macrophages in immunofluorescence results. C Quantitative statistical analysis of the proportion of mitochondrial area in macrophages in immunofluorescence results. D The deposition of mitochondria and lipid droplets in macrophages in each group was observed by electron microscopy. Mitochondria in macrophages were labeled by M and lipid droplets in macrophages were labeled by LD. Data are expressed as the means ± standard deviation. nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, n = 7
The ATP production and Maximal Respiration levels in the MFA group were significantly greater than those in the MF group (Fig. 5A–F). In addition, the WB results showed that the protein expression of PPAR α, PGC-1 α, and CPT-1 α closely related to lipid metabolism in the MF group was higher than that in the M group at 24 h, and the MFA group was also higher. At 72 h, the protein expression level of the MF group was lower than or no difference from the M group, but the protein expression of the MFA group was significantly higher than that of the MF group (Fig. 5G–J). The qPCR results also showed that the mRNA expression of PPAR α, PGC-1 α, and CPT-1 α in the MF group was higher than that in the M group but lower than that in the MFA group at 24 h. At 72 h, the mRNA expression level in the MFA group was higher than that in the MF group, while the mRNA expression level in the MF group was lower than that in the M group or there was no difference between the two (Fig. 5K–M).
Fig. 5.
Comparison of mitochondrial function in different groups of macrophages. A The oxygen consumption rate of macrophages in different groups at 24 h was detected and analyzed. B The oxygen consumption rate of macrophages in different groups at 72 h was detected and analyzed. C The 24-h ATP production of macrophages in different groups was quantitatively analyzed. D The 72-h ATP production of macrophages in different groups was quantitatively analyzed. E The 24-h Maximal Respiration of macrophages in different groups was quantitatively analyzed. F The 72-h Maximal Respiration of macrophages in different groups was quantitatively analyzed. G The relative expression levels of PPARα, PGC-1α and CPT-1α in macrophages of each group were detected by western blot. Full-length blots/gels are presented in Supplementary Fig. S1. H Quantitative statistical analysis of relative expression of PPARα protein in macrophages from western blot analysis. I Quantitative statistical analysis of relative expression of PGC-1α protein in macrophages from western blot analysis. J Quantitative statistical analysis of relative expression of CPT-1α protein in macrophages from western blot analysis. K The relative expression of PPARα mRNA in macrophages of each group at different times was detected by q-PCR. L The relative expression of PGC-1α mRNA in macrophages of each group at different time was detected by q-PCR. M The relative expression of CPT-1α mRNA in macrophages of each group at different time was detected by q-PCR. Data are expressed as the means ± standard deviation. nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, n = 7
ASCs improved the retention rate of transplanted fat by upregulating macrophage FAO in adipose tissue and promote the polarization of macrophages towards the M2 phenotype.
The application of ASC-CM significantly improved the retention rate of transplanted fat, but the therapeutic effect of ASC-CM in the CM + E group was offset by etomoxir (Fig. 6A-B). HE staining and Masson staining were performed on the adipose tissue of the 12 week graft area after fat transplantation, and the degree of fibrosis of the fat graft was determined at different time points. ASC-CM significantly reduced the degree of graft fibrosis, but the degree of fibrosis in the E and CME groups was more severe (Fig. 6C, E). Twelve weeks after fat transplantation, the CM group exhibited normal adipose tissue morphology, but the therapeutic effect of ASC-CM on the fat transplantation process was reversed after etomoxir treatment; moreover, the fat structure of the E and CME groups was unclear, and there were many oil capsules (Fig. 6D, E). WB showed that after etomoxir pretreatment, the protein expression of PPARα, PGC-1α and CPT-1α in the fat graft samples decreased significantly and that treatment with ASC-CM did not alleviate this decrease (Fig. 6F–I). qPCR revealed that the expression of PPARα, PGC-1α, CPT-1α and other genes significantly decreased after the addition of etomoxir and that ASC-CM did not reverse this decrease (Fig. 6J–L). Immunofluorescence revealed that ASC-CM significantly increased the number of M2-type macrophages and the ratio of M2/M1 macrophages in the adipose tissue of the transplanted area at 4 week after fat transplantation, but those in the E and CME group was significantly reduced. At 1 week, the number of infiltrating macrophages in the E and CME groups was slightly lower than that in the con and CM groups, but at 4 week, the number of infiltrating macrophages in the E and CME groups (Mainly M1 macrophages) was significantly increased and remained at a high level until 12 week (Fig. 6M–O). qPCR showed that the expression of M1 macrophage markers in the CM group was significantly downregulated at 1 week and 4 week. Meanwhile, the expression of M2 macrophage markers in the CM group increased at 1 week and 4 week, and etomoxir treatment significantly inhibited the M2-promoting effect of ASCs (Fig. 6P–S).
Fig. 6.
Comparison of retention rate, lipid deposition degree and polarization level of macrophages between different groups. A Appearance of fat grafts after fat transplantation. B Fat graft volume retention rate after fat transplantation in different groups. C The proportion of fibrotic area of fat graft in each group after fat transplantation was quantitatively analyzed in Masson trichromatic staining results. D, E HE staining and Masson three-color staining of fat grafts 12 weeks after fat transplantation in each group, the scale = 100 μm. F The relative expression levels of PPAR α, PGC-1 α and CPT-1 α were detected by immunoblotting in the fat grafts of each group at 1 and 4 weeks after Fat Transplantation. Full-length blots/gels are presented in Supplementary Fig. S1. G–I Quantitative statistical analysis of the relative expression of PPARα, PGC -1α and CPT -1α protein in 1 week and 4 week fat graft from western blot analysis. J–L The relative expression of PPARα, PGC -1α and CPT -1α mRNA in fat grafts after q-PCR detected fat transplantation. M Immunofluorescence was used to detect macrophage infiltration in each group after fat transplantation. N The ratio of the number of M2 macrophages to the number of M1 macrophages over time was quantitatively analyzed. O Quantitative analysis of the total number of macrophages in each group over time. P–S The relative expression of iNOS, IL-6, IL-10 and ARG1 mRNA in fat grafts after q-PCR detected fat transplantation. The con group was the normal fat transplantation group, the E group was intraperitoneal injection of Etomoxir within one week after fat transplantation, the CM group was fat transplantation combined with ASCs-CM for auxiliary intervention, and the CME group was fat transplantation combined with ASCs-CM for auxiliary intervention and intraperitoneal injection of Etomoxir within one week after fat transplantation. Data are expressed as the means ± standard deviation. nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, n = 7
ASCs reduced foam macrophage formation by increasing mitochondrial FAO and promoted the polarization of macrophages towards the M2 phenotype
After etomoxir pretreatment, ATP production and maximum respiratory level of macrophages were significantly reduced, and ASC in MEFA group could no longer play the role of promoting FAO in macrophages (Fig. 7A–F). WB results showed that the expression of PPARα, PGC-1α and CPT-1α in macrophages pretreated with etomoxir decreased significantly and remained at a low level after coculture with ASCs (Fig. 7G–N). Within the E group, the protein levels of PPARα, PGC-1α, and CPT-1α were comparatively lower than the control group's levels. Conversely, the CM group demonstrated enhanced levels of these proteins compared to the control. The CME group, subjected to etomoxir treatment, showed a decrease in protein levels relative to the CM group (Fig. S2 E–H). qPCR revealed that the expression of PPARα, PGC-1α, CPT-1α and other genes significantly decreased after the addition of etomoxir and that ASCs did not reverse the decreasing expression trends (Fig. 7O–Q).
Fig. 7.
Mitochondrial FAO related indicators of macrophages in different groups were compared. A The oxygen consumption rate of macrophages in different groups at 24 h was detected and analyzed. B The oxygen consumption rate of macrophages in different groups at 72 h was detected and analyzed. C The 24-h ATP production of macrophages in different groups was quantitatively analyzed. D The 72-h ATP production of macrophages in different groups was quantitatively analyzed. E The 24-h Maximal Respiration of macrophages in different groups was quantitatively analyzed. F The 72-h Maximal Respiration of macrophages in different groups was quantitatively analyzed. G, K The relative expression levels of PPARα, PGC-1α and CPT-1α in macrophages of each group were detected by western blot. Full-length blots/gels are presented in Supplementary Fig. S1. H–J, L–N Quantitative statistical analysis of relative expression of PPARα, PGC-1α and CPT-1α protein in macrophages from western blot analysis. O–Q The relative expression of PPARα, PGC-1α and CPT-1α mRNA in macrophages of each group at different times was detected by q-PCR. The M group consisted of bone marrow derived macrophages, the MF group consisted of bone marrow derived macrophages directly co-cultured with primary adipocytes, and the MFA group consisted of bone marrow derived macrophages directly co-cultured with primary adipocytes and indirectly co-cultured with ASC through transwell chamber. The degree of lipid deposition and the level of macrophage polarization were compared. In the ME group, bone marrow derived macrophages pretreated with Etomoxir, in the MEF group, bone marrow derived macrophages pretreated with Etomoxir were directly co-cultured with primary adipocytes, and in the MEFA group, bone marrow derived macrophages pretreated with Etomoxir were directly co-cultured with primary adipocytes. Indirect co-culture with ASC via transwell chamber. Data are expressed as the means ± standard deviation. nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, n = 7
Immunofluorescence revealed that after etomoxir pretreatment, the number of mitochondria in the ME, MEF and MEFA groups significantly decreased, lipid drop uptake decreased at 24 h, and lipid deposition increased at 72 h (Fig. 8A–C). The flow cytometry results showed that ASCs significantly increased the M2/M1 ratio, but this increase decreased after etomoxir treatment (Fig. 8D, E). qPCR results showed that the expression of M1-type macrophages markers in the ASC group was significantly lower than that in the control group and that the expression of M2-type macrophages markers was significantly greater than that in the control group. Etomoxir treatment significantly inhibited the M2-promoting effect of ASCs (Fig. 8F–I).
Fig. 8.
Lipid deposition and polarization of macrophages in different groups were compared. A Immunofluorescence detected the mitochondria and lipid deposition of macrophages in each group. B Quantitative statistical analysis of the proportion of lipid droplet area in macrophages in immunofluorescence results. C Quantitative statistical analysis of the proportion of mitochondrial area in macrophages in immunofluorescence results. D The expressions of CD206 and CD11c in macrophages of each group were detected by flow cytometry at different time points. E The ratio of the number of M2 macrophages to the number of M1 macrophages in flow cytometry was quantitatively analyzed over time. F–I The relative expression of iNOS, IL-6, ARG1 and IL-10 mRNA in macrophages at different times was detected by q-PCR. Data are expressed as the means ± standard deviation. nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, n = 7
Discussion
Autologous fat transplantation is an important method for soft tissue defect repair and plays an important role in the clinical treatment of plastic and reconstructive surgery [1–4]. Adipose stem cells are stem cells with multidirectional differentiation potential that are isolated from adipose tissue and have regenerative, immune and anti-inflammatory properties [25, 26]. Recent studies suggest that ASC-assisted fat transplantation can reduce the inflammatory response around the recipient area and improve the retention rate and that the mechanism mainly involves ASCs regulating immune cells, mainly macrophages, through paracrine signalling [7–9, 27]. In the early stage after fat transplantation, under the condition of ischemia and hypoxia, the adipocytes underwent necrosis and apoptosis, and M1 macrophages phagocytose necrotic adipocyte fragments and metabolize lipids. With the transformation to the M2 type, blood vessels grow and initiate host-derived blood-derived stem cells to differentiate into new fat cells in the adipose tissue environment [28]. However, after fat transplantation, M1 macrophages clear apoptotic/dead fat cells through endocytosis. This results in the formation of foamy macrophages rich in lipid droplets, initiating necrotic apoptosis and aggravating graft fibrosis, which greatly affect the process of cell regeneration [15, 29, 30]. Our previous studies showed that ASCs can activate CD4 + Th2 cells in a paracrine manner, promote the polarization of macrophages towards the M2 phenotype, affect fibrosis and the retention rate of fat transplantation. Also, ASCs can inhibit the activation of the NLRP3 inflammasome and inhibit the inflammatory response of macrophages [31, 32]. However, the relationship between lipid metabolism and the transformation of macrophages induced by ASCs during fat transplantation remains unclear. Therefore, we investigated the ASC-induced metabolic reprogramming of macrophages during fat transplantation through in vivo and in vitro models.
In our mouse ASC-assisted fat transplantation model, we found that ASCs can accelerate the infiltration of macrophages in the early stage to phagocytose necrotic adipocytes, advance the transformation of macrophages from the M1 to M2 phenotype, reduce the deposition of MFCs in the late stage, accelerate the transformation of grafts from the inflammatory stage to the regenerative stage, reduce the formation of foam cells, and improve the retention rate of transplanted fat [33, 34].
Adipocyte necrosis and apoptosis occur in the early ischaemic and hypoxic environment of grafts [35, 36]. Therefore, we directly cocultured bone marrow-derived macrophages with primary adipocytes pretreated with TNF-α to simulate the in vivo environment after fat transplantation. Additionally, ASCs were placed in a transwell chamber for indirect coculture with bone marrow-derived macrophages to simulate the paracrine effect of ASCs after fat transplantation. The results showed that ASCs promoted the phagocytosis and digestion of necrotic adipocytes by macrophages in the early stage and reduced the deposition of intracellular lipid droplets in the late stage. Flow cytometry and qPCR results showed that ASCs could significantly promote the transformation of high-fat diet-treated macrophages into M2 macrophages. In addition, ASCs can enhance the utilization of FFAs by high-fat macrophages and reduce the exclusion of extracellular FFAs. These findings suggested that ASCs may promote the transformation of macrophages by altering lipid metabolism in a high-lipid inflammatory environment.
Recent studies suggest that the main metabolic mode of M1 macrophages is glycolysis and that the most important metabolic mode of M2 macrophages is mitochondrial FAO [13]. Triglycerides contained in lipid droplets in macrophages are hydrolysed to FFAs by lipase and participate in FAO, which jointly occurs in peroxisomes and mitochondria, providing long-term energy for cells [13, 18, 21, 22]. Studies have shown that exosomes derived from human umbilical cord mesenchymal stem cells effectively reduce lipid deposition and ameliorate HFD-induced hepatic steatosis [37]. ASC transplantation significantly improves liver function, promotes lipid metabolism and decreases the intrahepatic content of lipids [38]. Therefore, we speculated that ASCs accelerated the transformation of macrophages from the M1 to M2 phenotype by increasing lipid phagocytosis and digestion and utilization in macrophages. Increased lipid uptake fuels FAO, which is regulated by the CPT-mediated import of FAs into the mitochondria. Some studies suggest that such FAO supports alternative macrophage activation, in part by producing a pool of acetyl-CoA that can be used to drive histone acetylation in and alternative activation of macrophages [39, 40].
Therefore, we examined the morphology and function of mitochondria in macrophages in fat grafts and found that ASCs could increase the number of mitochondria and upregulate the expression of FAO-related genes and proteins. Additionally, ASCs improved the mitochondrial morphology of high-fat treated macrophages, increased the OCR and production of ATP, and increased the expression of FAO-related genes and proteins. ASCs improved mitochondrial morphology and function. These results suggest that ASCs may improve the lipid metabolism of macrophages and promote their polarization towards the M2 phenotype by activating mitochondrial FAO.
Etomoxir irreversibly inhibits CPT1, which provides a gateway for fatty acid transfer through the mitochondrial membrane, and blocks the initiation of FAO [41, 42]. To further verify the role of FAO in ASC-assisted fat transplantation, we used etomoxir to inhibit early mitochondrial FAO in macrophages. In previous studies, it has been confirmed that ASCs can affect macrophages during fat transplantation through a paracrine mechanism. To prevent etomoxir from interfering with ASCs, we used ASC-CM to replace ASCs in the model group. The results showed that in the presence of etomoxir, ASC-CM did not improve the retention rate of transplanted fat, and the effect of promoting the polarization of M2-type macrophages was also reversed. This suggests that ASCs promote the polarization of macrophages towards the M2 phenotype through the activation of FAO, which affects the early inflammation level of the transplantation area and ultimately increases the graft retention rate. After the in vitro pretreatment of macrophages with etomoxir, the number of mitochondria in the macrophages decreased significantly, which significantly reduced the phagocytosis and digestion of lipid droplets in the early stage, increased the presence of intracellular large lipid droplets in the late stage, and intensified the formation of MFCs. Moreover, ASCs could not reverse the effect of etomoxir. In the presence of etomoxir, ASCs could not promote the polarization of macrophages towards the M2 phenotype. These results suggest that ASCs regulate the lipid metabolism of macrophages by activating mitochondrial FAO, promote the polarization of macrophages towards the M2 phenotype, and increase the retention rate of transplanted fat.
We observed that the number of mitochondria in early high-fat-treated macrophages was increased by ASCs. According to the literature, UC-MSCs (umbilical cord-derived mesenchymal stromal cells) activate mitochondrial biogenesis through the AMPK-PGC-1α axis and decrease sarcopenia-related skeletal muscle atrophy and dysfunction [43]. By transferring mitochondria to hepatocytes, bone marrow mesenchymal stem cells increase the number of healthy mitochondria in target cells, correct mitochondrial dysfunction, and alleviate steatosis in nonalcoholic fatty liver disease (NAFLD) [44]. We hypothesize that ASCs may increase the number of early mitochondria in high-fat-treated macrophages in vitro through a variety of pathways, including the activation of mitochondrial biosynthesis and the transfer of healthy mitochondria to macrophages through mitochondrial transfer. We also observed that ASCs can promote the early phagocytosis of lipid droplets by macrophages. Sufficient mitochondria can better supply energy for lipid phagocytosis and digestion, resulting in fine lipid droplets in macrophages in the transition stage.
At late time points in high-fat-treated macrophages, the number of intracellular mitochondria decreased, similar to the morphology of mitochondria in ferroptotic cells, and the shrinkage of mitochondria was significantly reduced after ASC intervention. Some studies have shown that iron death occurs in cells during fat transplantation and that glutathione can inhibit the deposition of lipid peroxides [45]. Moreover, studies have shown that mesenchymal stem cells (MSCs) stabilize the neuronal mitochondrial quality control system, alleviate neuronal ferroptosis and ultimately promote functional recovery after spinal cord injury [46]. Therefore, we speculated that ASCs can secrete antioxidant substances, reduce the deposition of lipid peroxides in macrophages, ameliorate iron death in macrophages during fat transplantation, alleviate graft inflammation and fibrosis, and improve the retention rate of fat transplantation.
Macrophage infiltration in the ASC group was greater than that in the control group at 1 W after fat transplantation but decreased significantly at 4 W and was lower than that in the control group. According to our previous studies, an appropriate concentration of ASCs can promote rapid entry and rapid exit of macrophages, possibly because ASCs promote the early phagocytosis and digestion of lipid drops by macrophages, which causes them to transition into M2 macrophages earlier, initiates the growth of blood vessels, fat regeneration and ECM remodelling, enables the fat graft to pass through the inflammatory period more quickly, and reduces the degree of graft fibrosis [32, 47].
This study also has some limitations as follows. The inhibition of macrophage mitochondrial FAO by the intraperitoneal injection of etomoxir in mice without targeted knockout of the macrophage CPT-1α gene may affect blood-derived stem cells and local grafts. Additionally, how ASCs regulate macrophages through paracrine activity and the detailed mechanism underlying the relationship between FAO and macrophage polarization have not been elucidated. The literature has shown that acetyl-CoA (Ac-CoA) from FAO, on the one hand, supplies energy for the TCA cycle; on the other hand, it shuttles to the cytoplasm outside mitochondria in the form of citric acid and is decomposed again into Ac-CoA, and its biological function in the cytoplasm is mainly to promote the acetylation of cell functional proteins, regulate gene expression and alter cell biological function [48, 49]. Studies have shown that IL-4 activates macrophage mitochondrial FAO to increase Ac-CoA, promote the acetylation of H3 lysine 9, and upregulate the expression of the M2 gene [22]. It has been suggested that H3K9Ac is a key site for the activation of the M2 phenotype [50]. The activation of FAO by ASCs may upregulate the M2 transcription factor through the increase in histone acetylation by the metabolite Ac-CoA, a process that needs to be further studied.
The findings of this study suggest that FAO can be used as a powerful target to regulate the retention rate of transplanted fat in clinical settings and that L-carnitine (carnitine), an agonist of AMPK, PGC-1α and PPARα, can be used to regulate the intermediate metabolism of fatty acids and increase the retention rate of transplanted fat. The promotion of fatty acid oxidation via stem cells is expected to be applied in the treatment of other diseases involving abnormal mitochondrial lipid metabolism, such as nonalcoholic hepatitis.
Conclusion
In the process of ASC-assisted fat transplantation, ASCs can activate lipid metabolism by increasing mitochondrial FAO in macrophages, promote the early infiltration of macrophages and polarization towards the M2 phenotype, reduce graft fibrosis and improve the retention rate. In an in vitro high-fat-treated macrophage model, ASCs promote the early phagocytosis and digestion of lipid droplets by increasing mitochondrial FAO and can be polarized into M2 macrophages, reducing foam cell formation (Fig. 9).
Fig. 9.
ASCs regulates lipid metabolism in macrophages. After fat transplantation, macrophages first surrounded and engulfed necrotic cells or oil droplets of fat grafts. After entering the cell, triglycerides are lipolized into free fatty acids under the action of a series of lipases, which entered mitochondria through CPT-1α to participate in metabolism. ASCs up-regulate the expression of PPARα in macrophages through paracrine action and up-regulate FAO through CPT-1α to increase the production of ATP, thus promoting the polarization of macrophages towards M2
Supplementary Information
Acknowledgements
The authors declare that artificial intelligence is not used in this study.
Author contributions
JL and TG designed the study, analyzed the data and wrote the manuscript. YL, QW, YD, RL, JL, and JF prepared the figures and table. SL and XC reviewed and revised the manuscript. All authors approved the final manuscript. All authors read and approved the final manuscript.
Funding
Sai Luo was supported by National Natural Science Foundation of China [82102356], Outstanding Young Medical Talents Training Funding Project of The First Affiliated Hospital of Harbin Medical University [2021J05]. Xinyao Chen was supported by "New era Heilongjiang Province Excellent Master's and Doctoral Dissertation" Funding Project [LJYXL2022-079], Undergraduate Innovation and Entrepreneurship Training Program of Heilongjiang Province [S202310226027, S202310226074], Undergraduate Innovation and Entrepreneurship Training Program of Harbin Medical University [202310226013, 202310226027], Harbin Medical University Youth Science Foundation [2023-KYYWF-0142]. Jiapeng Li was supported by Graduate research and practice innovation project of Harbin Medical University [YJSCX2023-206HYD]. Yuyang Du was supported by Undergraduate Innovation and Entrepreneurship Training Program of Heilongjiang Province [S2020150038], Undergraduate Innovation and Entrepreneurship Training Program of Harbin Medical University [202310226103].
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
The study was approved by Ethics Committee for Laboratory Animal Management and Welfare of the First Affiliated Hospital of Harbin Medical University. IACUC Number: 2021122, February 15, 2021. Title of the approved project: Mechanism of adipose stem cells up-regulate fatty acid β oxidation, induce M2 macrophage polarization and promote fat transplantation regeneration.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Jiapeng Li, Tingting Guo have contributed equally and are co-first author.
Change history
11/20/2024
A Correction to this paper has been published: 10.1186/s13287-024-04046-y
Contributor Information
Xinyao Chen, Email: 304251054@qq.com.
Sai Luo, Email: luosai7766@163.com.
References
- 1.Zheng D-N, Li Q-F, Lei H, Zheng S-W, Xie Y-Z, Xu Q-H, et al. Autologous fat grafting to the breast for cosmetic enhancement: experience in 66 patients with long-term follow up. J Plast Reconstr Aesthet Surg. 2008;61:792–8. 10.1016/j.bjps.2007.08.036. [DOI] [PubMed] [Google Scholar]
- 2.Resnick CM, Partridge J, Dang RR, Burashed HM, Padwa BL, Mulliken JB. Augmentation of the median tubercle with Dermis-Fat Graft in children with repaired cleft lip. Plast Reconstr Surg. 2018;141:540e. 10.1097/PRS.0000000000004237. [DOI] [PubMed] [Google Scholar]
- 3.Coleman SR. Structural fat grafting: more than a permanent filler. Plast Reconstr Surg. 2006;118:108S-120S. 10.1097/01.prs.0000234610.81672.e7. [DOI] [PubMed] [Google Scholar]
- 4.Rodriguez-Unda NA, Novak MD, Rohrich RJ. Techniques in facial fat grafting: optimal results based on the science of facial aging. Plast Reconstr Surg. 2023;152:e1040-3. 10.1097/PRS.0000000000010314. [DOI] [PubMed] [Google Scholar]
- 5.Huang C-W, Yen Y-H, Lu S-Y, Pu C-M. Oil cyst formation after Lower Blepharoplasty with Fat Grafts. Ann Plast Surg. 2022. 10.1097/sap.0000000000003086. [DOI] [PubMed] [Google Scholar]
- 6.Mandrekas AD, Zambacos GJ, Kittas C. Cyst formation after fat injection. Plast Reconstr Surg. 1998;102:1708–9. 10.1097/00006534-199810000-00060. [DOI] [PubMed] [Google Scholar]
- 7.Chiu C-H. Does stromal vascular fraction ensure a higher survival in Autologous Fat grafting for breast augmentation? A volumetric study using 3-Dimensional laser scanning. Aesthet Surg J. 2019;39:41–52. 10.1093/asj/sjy030. [DOI] [PubMed] [Google Scholar]
- 8.Paik KJ, Zielins ER, Atashroo DA, Maan ZN, Duscher D, Luan A, et al. Studies in fat grafting: Part V. cell-assisted lipotransfer to enhance fat graft retention is dose dependent. Plast Reconstr Surg. 2015;136:67–75. 10.1097/PRS.0000000000001367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yang Z, Lu H, Gao Q, Yuan X, Hu Y, Qi Z. Enhancing fat transplantation efficiency in a mouse model through pretreatment of adipose-derived stem cells with RIP3 inhibitors. Aesthetic Plast Surg. 2024. 10.1007/s00266-024-03981-8. [DOI] [PubMed] [Google Scholar]
- 10.Dong Z, Fu R, Liu L, Lu F. Stromal vascular fraction (SVF) cells enhance long-term survival of autologous fat grafting through the facilitation of M2 macrophages. Cell Biol Int. 2013;37:855–9. 10.1002/cbin.10099. [DOI] [PubMed] [Google Scholar]
- 11.Dong Z, Peng Z, Chang Q, Lu F. The survival condition and immunoregulatory function of adipose stromal vascular fraction (SVF) in the early stage of nonvascularized adipose transplantation. PLoS ONE. 2013;8:e80364. 10.1371/journal.pone.0080364. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhang Y, Xiao L-L, Li J-X, Liu H-W, Li S-H, Wu Y-Y, et al. Improved fat transplantation survival by using the conditioned medium of vascular endothelial growth factor transfected human adipose-derived stem cells. Kaohsiung J Med Sci. 2017;33:379–84. 10.1016/j.kjms.2017.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Galván-Peña S, O’Neill LAJ. Metabolic reprograming in macrophage polarization. Front Immunol. 2014. 10.3389/fimmu.2014.00420. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Schott MB, Weller SG, Schulze RJ, Krueger EW, Drizyte-Miller K, Casey CA, et al. Lipid droplet size directs lipolysis and lipophagy catabolism in hepatocytes. J Cell Biol. 2019;218:3320–35. 10.1083/jcb.201803153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Eto H, Kato H, Suga H, Aoi N, Doi K, Kuno S, et al. The fate of adipocytes after nonvascularized fat grafting: evidence of early death and replacement of adipocytes. Plast Reconstr Surg. 2012;129:1081–92. 10.1097/PRS.0b013e31824a2b19. [DOI] [PubMed] [Google Scholar]
- 16.O’Neill LAJ, Pearce EJ. Immunometabolism governs dendritic cell and macrophage function. J Cell Biol. 2016. 10.1083/jcb.2121oia306. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Van Teijlingen Bakker N, Pearce EJ. Cell-intrinsic metabolic regulation of mononuclear phagocyte activation: findings from the tip of the iceberg. Immunol Rev. 2020;295:54–67. 10.1111/imr.12848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhu L, Zhao Q, Yang T, Ding W, Zhao Y. Cellular metabolism and macrophage functional polarization. Int Rev Immunol. 2015;34:82–100. 10.3109/08830185.2014.969421. [DOI] [PubMed] [Google Scholar]
- 19.Jung J, Zeng H, Horng T. Metabolism as a guiding force for immunity. Nat Cell Biol. 2019;21:85–93. 10.1038/s41556-018-0217-x. [DOI] [PubMed] [Google Scholar]
- 20.Malandrino MI, Fucho R, Weber M, Calderon-Dominguez M, Mir JF, Valcarcel L, et al. Enhanced fatty acid oxidation in adipocytes and macrophages reduces lipid-induced triglyceride accumulation and inflammation. Am J Physiol Endocrinol Metab. 2015;308:E756-69. 10.1152/ajpendo.00362.2014. [DOI] [PubMed] [Google Scholar]
- 21.Mills EL, O’Neill LA. Reprogramming mitochondrial metabolism in macrophages as an anti-inflammatory signal: HIGHLIGHTS. Eur J Immunol. 2016;46:13–21. 10.1002/eji.201445427. [DOI] [PubMed] [Google Scholar]
- 22.Yan J, Horng T. Lipid metabolism in regulation of macrophage functions. Trends Cell Biol. 2020;30:979–89. 10.1016/j.tcb.2020.09.006. [DOI] [PubMed] [Google Scholar]
- 23.Játiva S, Calle P, Torrico S, Muñoz Á, García M, Martinez I, et al. Mitochondrial transplantation enhances phagocytic function and decreases lipid Accumulation in Foam Cell macrophages. Biomedicines. 2022. 10.3390/biomedicines10020329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Chen X, Deng Z, Feng J, Chang Q, Lu F, Yuan Y. Necroptosis in macrophage foam cells promotes Fat Graft Fibrosis in mice. Front Cell Dev Biol. 2021;9:651360. 10.3389/fcell.2021.651360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Sandiarini-Kamayana J. The use of adipose-derived stem cells in cell assisted lipotransfer as potential regenerative therapy in breast reconstruction. Scripta Med. 2022. 10.5937/scriptamed53-36491. [Google Scholar]
- 26.Frese L, Dijkman PP, Hoerstrup SS. Adipose tissue-derived stem cells in Regenerative Medicine. Transfus Med Hemother. 2016. 10.1159/000448180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Jiang A, Li M, Duan W, Dong Y, Wang Y. Improvement of the survival of human autologous fat transplantation by adipose-derived stem-cells-assisted lipotransfer combined with bFGF. ScientificWorldJournal. 2015;2015:968057. 10.1155/2015/968057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Kato H, Mineda K, Eto H, Doi K, Kuno S, Kinoshita K, et al. Degeneration, regeneration, and cicatrization after fat grafting: dynamic total tissue remodeling during the first 3 months. Plast Reconstr Surg. 2014;133:e303–13. 10.1097/PRS.0000000000000066. [DOI] [PubMed] [Google Scholar]
- 29.Dang J, Yang J, Yu Z, Chen L, Zhang Z, Wang K, et al. Bone marrow mesenchymal stem cells enhance angiogenesis and promote fat retention in fat grafting via polarized macrophages. Stem Cell Res Ther. 2022;13:52. 10.1186/s13287-022-02709-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Nomura M, Liu J, Yu Z-X, Yamazaki T, Yan Y, Kawagishi H, et al. Macrophage fatty acid oxidation inhibits atherosclerosis progression. J Mol Cell Cardiol. 2019;127:270–6. 10.1016/j.yjmcc.2019.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Li X, Luo S, Chen X, Li S, Hao L, Yang D. Adipose-derived stem cells attenuate acne-related inflammation via suppression of NLRP3 inflammasome. Stem Cell Res Ther. 2022;13:334. 10.1186/s13287-022-03007-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chen X, Chen Y, Wang Z, Dong Z, Yao Y, Li Y, et al. Adipose-derived stem cells regulate CD4 + T-cell-mediated macrophage polarization and fibrosis in fat grafting in a mouse model. Heliyon. 2022;8:e11538. 10.1016/j.heliyon.2022.e11538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Cai J, Feng J, Liu K, Zhou S, Lu F. Early macrophage infiltration improves fat graft survival by inducing angiogenesis and hematopoietic stem cell recruitment. Plast Reconstr Surg. 2018;141:376–86. 10.1097/PRS.0000000000004028. [DOI] [PubMed] [Google Scholar]
- 34.Niu X, Lai Z, Chen X, Lu F, Gao J, Yuan YA, Short-Term. High-Fat Diet improved the survival of Fat grafts in mice by promoting macrophage infiltration and angiogenesis. Front Cell Dev Biol. 2022;10:856839. 10.3389/fcell.2022.856839. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Nishimura T, Hashimoto H, Nakanishi I, Furukawa M. Microvascular angiogenesis and apoptosis in the survival of free Fat grafts. Laryngoscope. 2000. 10.1097/00005537-200008000-00021. [DOI] [PubMed] [Google Scholar]
- 36.Yi Y, Hu W, Zhao C, Wu M, Zeng H, Xiong M, et al. Deciphering the emerging roles of adipocytes and adipose-derived stem cells in fat transplantation. Cell Transpl. 2021;30:963689721997799. 10.1177/0963689721997799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Yang F, Wu Y, Chen Y, Xi J, Chu Y, Jin J, et al. Human umbilical cord mesenchymal stem cell-derived exosomes ameliorate liver steatosis by promoting fatty acid oxidation and reducing fatty acid synthesis. JHEP Rep. 2023;5:100746. 10.1016/j.jhepr.2023.100746. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Liao N, Pan F, Wang Y, Zheng Y, Xu B, Chen W, et al. Adipose tissue-derived stem cells promote the reversion of non-alcoholic fatty liver disease: an in vivo study. Int J Mol Med. 2016;37:1389–96. 10.3892/ijmm.2016.2528. [DOI] [PubMed] [Google Scholar]
- 39.Cameron AM, Lawless SJ, Pearce EJ. Metabolism and acetylation in innate immune cell function and fate. Semin Immunol. 2016. 10.1016/j.smim.2016.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Langston PK, Nambu A, Jung J, Shibata M, Aksoylar H-I, Lei J, et al. Glycerol phosphate shuttle enzyme GPD2 regulates macrophage inflammatory responses. Nat Immunol. 2019. 10.1038/s41590-019-0453-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wunderling K, Leopold C, Jamitzky I, Yaghmour M, Zink F, Kratky D, et al. Hepatic synthesis of triacylglycerols containing medium-chain fatty acids is dominated by diacylglycerol acyltransferase 1 and efficiently inhibited by etomoxir. Mol Metab. 2021;45:101150. 10.1016/j.molmet.2020.101150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Shim J-K, Choi S, Yoon S-J, Choi RJ, Park J, Lee EH, et al. Etomoxir, a carnitine palmitoyltransferase 1 inhibitor, combined with temozolomide reduces stemness and invasiveness in patient-derived glioblastoma tumorspheres. Cancer Cell Int. 2022;22:309. 10.1186/s12935-022-02731-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Piao L, Huang Z, Inoue A, Kuzuya M, Cheng XW. Human umbilical cord-derived mesenchymal stromal cells ameliorate aging-associated skeletal muscle atrophy and dysfunction by modulating apoptosis and mitochondrial damage in SAMP10 mice. Stem Cell Res Ther. 2022;13:226. 10.1186/s13287-022-02895-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Bi Y, Guo X, Zhang M, Zhu K, Shi C, Fan B, et al. Bone marrow derived-mesenchymal stem cell improves diabetes-associated fatty liver via mitochondria transformation in mice. Stem Cell Res Ther. 2021;12:602. 10.1186/s13287-021-02663-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Li Z, Lu J, Dong Z, Liang J, Li S, Han W, et al. Glutathione supplementation improves fat graft survival by inhibiting ferroptosis via the SLC7A11/GPX4 axis. Stem Cell Res Ther. 2024;15:25. 10.1186/s13287-024-03644-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Yao S, Pang M, Wang Y, Wang X, Lin Y, Lv Y, et al. Mesenchymal stem cell attenuates spinal cord injury by inhibiting mitochondrial quality control-associated neuronal ferroptosis. Redox Biol. 2023;67:102871. 10.1016/j.redox.2023.102871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Gao Z, Zhang C, Peng F, Chen Q, Zhao Y, Chen L, et al. Hypoxic mesenchymal stem cell-derived extracellular vesicles ameliorate renal fibrosis after ischemia-reperfusion injure by restoring CPT1A mediated fatty acid oxidation. Stem Cell Res Ther. 2022;13:191. 10.1186/s13287-022-02861-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Shi L, Tu BP. Acetyl-CoA and the regulation of metabolism: mechanisms and consequences. Curr Opin Cell Biol. 2015. 10.1016/j.ceb.2015.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Zhang Q, Fang Y, Lv C, Zhu Y, Xia Y, Wei Z, et al. Norisoboldine induces the development of Treg cells by promoting fatty acid oxidation-mediated H3K27 acetylation of Foxp3. FASEB J. 2022. 10.1096/fj.202101643r. [DOI] [PubMed] [Google Scholar]
- 50.Mullican SE, Gaddis CA, Alenghat T, Nair MG, Giacomin PR, Everett LJ, et al. Histone deacetylase 3 is an epigenomic brake in macrophage alternative activation. Genes Dev. 2011;25:2480–8. 10.1101/gad.175950.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.









