Abstract
Male infertility is a multifactorial disease due to spermatogenesis impairment, with etiology remaining unknown for roughly one-third of infertile cases. Several studies have demonstrated that genetic variants are male infertility risk factors. CFAP43 and TEX14 are involved in the spermatogenesis process. The present study aimed to assess the association between single-nucleotide polymorphisms (SNPs) in CFAP43 (rs17116635 and rs10883979) and TEX14 (rs79813370 and rs34818467) and idiopathic male infertility in a Vietnamese population. A cohort of 206 infertile men and 195 controls were recruited for the study. CFAP43 and TEX14 SNPs were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Genotypes of randomly selected samples, accounting for 10% of the total, were confirmed using Sanger sequencing. The obtained data were analyzed using statistical methods. The results showed that 4 SNPs (rs17116635, rs10883979, rs79813370, and rs34818467) were in accordance with Hardy-Weinberg Equilibrium (HWE; P > .05). CFAP43 rs10883979 and TEX14 rs79813370 were associated with male infertility. For CFAP43 rs10883979, in the recessive model, the combination AA + AG was associated with male infertility when compared to the GG genotype (OR = 0.26; 95% CI: 0.06–0.85; P = .02). For TEX14 rs79813370, a protective effect against infertility risk was identified in the presence of the T allele of rs79813370 when compared to the G allele (OR = 0.48; 95% CI: 0.32–0.72; P < .001). Our results suggest that CFAP43 rs10883979 and TEX14 rs79813370 are likely associated with male infertility in the Vietnamese population, in which the G allele of rs79813370 may be a risk factor for male infertility.
Keywords: CFAP43, infertility, polymorphism, TEX14, Vietnamese
1. Introduction
Infertility is defined as a reproductive disease featured by the failure to initiate a clinical pregnancy after at least 1 year of regular, unprotected sexual intercourse.[1] Male factors were responsible for roughly half of the infertile cases,[2] with about 7% of the global male population being affected.[3,4] The prevalence of male infertility varies between regions, highest in Northern and Central Europe at 8% to 12% and lowest in North America at 4.5% to 6%.[5] Meanwhile, the rate in Asia, the most populous region in the world, is virtually unknown. In Vietnam, this disease is on the rise, with the age-standardized prevalence rate of male infertility increasing by 0.55% from 1990 to 2017.[6] The disease manifested through multiple semen phenotypes, including complete lack of sperm (azoospermia), reduced sperm count (oligozoospermia), decreased sperm motility (asthenozoospermia), abnormal sperm morphology (teratozoospermia), or the combination of quantitative and qualitative defects (oligoasthenoteratozoospermia).[7] Over the last 2 decades, many studies have identified various genes involved in spermatogenesis related to male infertility,[8,9] including cilia- and flagella-associated proteins 43 (CFAP43) and testis-expressed 14 (TEX14).
CFAP43, also known as WDR96, is located on chromosome 10q25.1, contains 38 exons, and encodes a WD-repeat-domain (WDR) protein expressed explicitly or preferentially in the testis.[10] This protein is essential for sperm flagella production and proper sperm motility, and its absence is detrimental to sperm axoneme assembly, resulting in aborted sperm flagella and male infertility.[11] The knockout mouse models of the CFAP43 ortholog gene resulted in male mice with multiple morphological abnormalities of sperm flagella (MMAF) phenotype, infertility, complete sperm immobility, and axonal malformations. In addition, depletion of CFAP43 also resulted in sperm head abnormalities and oligozoospermia, demonstrating that, in mice, CFAP43-mediated intra-manchette transport is crucial for sperm head shaping and sperm flagella formation.[12] Multiple mutations in CFAP43 have been found in MMAF patients, and in the studied MMAF cohorts, biallelic mutations of CFAP43 have been estimated to make up about 4% to 31% of cases.[10,13–20]
TEX14, located on chromosome 17q22, encodes a 1497 amino acid protein exclusively expressed in the testis during meiosis.[21] The loss of this protein, whose function is to form the germ-cell intracellular bridges in vertebrates, might disrupt spermatogenesis and cause infertility.[22–24] TEX14 gene mutations with an autosomal recessive pattern were identified in infertile men with spermatogenic failure.[25–28] In addition, genetic variants in this gene were associated with the development of testicular germ cell cancer[29] and a higher risk of breast cancer.[30]
The 2 genes TEX14 and CFAP43 participate in spermatogenesis at different cellular stages[31] and are highly expressed in the testis, especially in primary and secondary spermatocytes.[32] While the role of genetic variants of CFAP43 and TEX14 in the pathogenesis of male infertility has been reported, there likely exist undescribed polymorphisms within CFAP43 and TEX14 associated with male infertility. Four polymorphisms, CFAP43 rs17116635, CFAP43 rs10883979, TEX14 rs79813370, and TEX14 rs34818467, have been found in the 1000 Genomes Project for Vietnamese population with minor allele frequencies of 0.07; 0.18; 0.11 and 0.13, respectively. The 3 SNPs, CFAP43 rs17116635, CFAP43 rs10883979, and TEX14 rs79813370, are missense variants, while the remaining SNP is a splice-site one. In addition, all 4 SNPs have high Remap densities in the ReMap Atlas of Regulatory Regions (http://www.genome.ucsc.edu), indicating that these SNPs can affect the binding of multiple transcription factors and potentially alter gene expression.[33] Given the increasing frequency of male infertility and the importance of genetic contributors, we conducted this study to investigate the correlation of CFAP43 (rs17116635, rs10883979) and TEX14 (rs79813370, rs34818467) with idiopathic male infertility in a Vietnamese population.
2. Materials and methods
2.1. Study subjects
A total of 206 men with idiopathic infertility in the age range of 25 to 45 were recruited from Hanoi Medical University Hospital. Infertile men with chromosomal abnormalities, Y chromosomal macro- or microdeletions, obstructive azoospermia, and a history of diseases affecting fertility were all excluded from the study. The control group included 195 healthy men in the same age group who had fathered at least 1 child without seeking assisted reproductive technology. All subjects were of Vietnamese ethnicity and gave written informed consent to donate their blood. Semen data for all the subjects were recorded by the physicians, including age, pH, ejaculate volume, total sperm, sperm count, motility, vitality, and normal morphology (Table 1). The study was approved by the Institutional Review Board of the Institute of Genome Research, Vietnam Academy of Science and Technology (No: 9-2019/NCHG-HĐĐĐ), and all experimental protocols on human subjects were in accordance with the Helsinki Declaration of 1975, as revised in 2013.
Table 1.
Semen characteristics of the studied participants.
| Characteristics | Controls | Cases | P value |
|---|---|---|---|
| Age | 34.17 ± 6.13 | 33.13 ± 5.78 | .07 |
| pH | 7.51 ± 0.05 | 7.24 ± 0.40 | .13 |
| Ejaculate volume (mL) | 2.82 ± 0.86 | 2.83 ± 0.57 | .99 |
| Total sperm/ ejaculate (106) | 62.56 ± 31.65 | 1.81 ± 1.83 | <.001 |
| Sperm count (106/mL) | 174.75 ± 97.13 | 5.05 ± 5.52 | <.001 |
| Motility | <.001 | ||
| Progressive motility, PR (%) | 45.02 ± 12.74 | 13.02 ± 11.32 | <.001 |
| Fast progressive (%) | 14.49 ± 7.42 | 3.02 ± 4.05 | <.001 |
| Slow progressive (%) | 30.24 ± 8.14 | 10.00 ± 8.69 | <.001 |
| Non-progressive, NP (%) | 29.26 ± 10.18 | 6.93 ± 7.03 | <.001 |
| Motile (PR + NP) (%) | 74.35 ± 15.20 | 23.28 ± 20.89 | <.001 |
| Immotile, IM (%) | 25.72 ± 15.23 | 51.72 ± 34.81 | .03 |
| Vitality (%) | 79.13 ± 13.76 | 26.92 ± 23.60 | <.001 |
| Normal morphology (%) | 4.87 ± 0.73 | 0.82 ± 0.75 | <.001 |
Data are presented as mean ± standard deviations.
IM = immotile, n = number, NP = non-progressive, PR = progressive motility.
P values calculated by independent t test.
P < .05 indicates statistical significance.
2.2. SNP genotyping
Genomic DNA was extracted from the blood samples of participants using GeneJET Whole Blood Genomic DNA Purification Mini Kit (ThermoFisher, Waltham). To genotype the polymorphisms of CFAP43 (rs17116635 and rs10883979) and TEX14 (rs79813370 and rs34818467), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used. Specific pairs of primers for amplification of the DNA region containing the polymorphisms are listed in Table 2. If the polymorphism is not present at a recognition site of a restriction enzyme, nucleotides near the 3′ end of the primer forward/ reverse might be mutated to create a restriction site. After that, the PCR products of rs17116635, rs10883979, rs79813370, and rs34818467 were digested with restriction enzymes RsaI, MunI, Eco130I, and NdeI, respectively. To validate PCR-RFLP results, 10% of the samples were randomly selected to be purified by PCR purification kit (ThermoFisher, Waltham) and subsequently sequenced using ABI PRISM 3500 genetic analyzer (Applied Bio-systems, Carlsbad). The obtained sequences were then compared with reference sequences of CFAP43 (NM_025145.7) and TEX14 (NM_001201457.2) published in GenBank. The Sanger sequencing results indicated 100% concordance with genotypes obtained from PCR-RFLP.
Table 2.
Primer information.
| Gene/SNP | Location | Primer (5′-3′) | Amplicon size (bp) | Tm, T (°C) |
|---|---|---|---|---|
| CFAP43/ rs17116635 | 10q25.1 | F: ACTTCCAATGGCAAGCAAGG R: GCAGAGGCTTGGAGGTAGGA |
681 | 62 |
| CFAP43/ rs10883979 | 10q25.1 | F: GAGCTTGGGTGGTGAAAACC R: CTGTTTCCACATAGAGCCTTGG |
518 | 61 |
|
TEX14/ rs79813370 |
17q22 | F: GCCCAGTGCATAGGGGTATTC R: AGGTGTTCCCTGTGTTTGAGT |
372 | 60 |
|
TEX14/ rs34818467 |
17q22 | F: TACATGGCTCTGTACATGGAGCT R: AAGTGATGGAGGAGGCACTGCATA |
270 | 57 |
SNP = single nucleotide polymorphism, Tm = annealing temperature.
2.3. Statistical analysis
Acquired data were statistically processed using Microsoft Excel (Microsoft Corp., Washington) and R version 4.2.2.[34] The function “HWExact” from “HardyWeinberg” package[35–37] was used to calculate the Hardy-Weinberg equilibrium (HWE) of the population. The function “oddsratio” from package “epitools”[38] was used to evaluate the association between the studied polymorphisms and male infertility in allele form and 3 test models (additive, dominant, and recessive). Differences in demographic and semen parameters between the patient and control groups were evaluated using an independent t test. Fisher’s exact test was selected for SNPs with expected sample sizes less than 5 and the Chi-squared test was used for those with larger expected sample sizes. An odds ratio with a confidence interval of 95% was used to estimate the association. All statistical tests were 2-sided. Calculation results were considered statistically significant if the P value < .05.
3. Results
3.1. Comparison of demographic and clinical characteristics between patient and control groups
Demographic and clinical data of a total of 401 subjects, including 206 infertile patients and 195 controls, are described in Table 1. Statistical analysis demonstrated significant differences between patient and control groups in total sperm, sperm count, motility, and normal morphology (P < .001), whereas there was no significant association in terms of age, pH, and ejaculate volume (P > .05; Table 1).
3.2. Genetic analysis of CFAP43 and TEX14 polymorphisms
Single nucleotide polymorphisms CFAP43 (rs17116635 and rs10883979) and TEX14 (rs79813370 and rs34818467) were genotyped for all studied subjects. Statistical results showed that all 4 SNPs followed Hardy-Weinberg equilibrium (HWE; P > .05; Table 3).
Table 3.
General information on the studied single nucleotide polymorphisms (SNPs).
| Gene/SNP | Position | Type of variant | Allele | MAF in case | HWE in case | MAF in control | HWE in control | HWE in all population |
|---|---|---|---|---|---|---|---|---|
| CFAP43/rs17116635 | 10:104186084 | Missense | C > T | 0.09 | + | 0.09 | + | + |
| CFAP43/rs10883979 | 10:104197956 | Missense | A > G | 0.18 | + | 0.20 | + | + |
| TEX14/rs79813370 | 17:58616316 | Missense | G > T | 0.10 | + | 0.20 | + | + |
| TEX14/rs34818467 | 17:58565748 | Splice site | A > G | 0.15 | + | 0.12 | + | + |
Note: Position refers to the GRCh38.p14 assembly.
MAF = Minor allele frequency, HWE = Hardy–Weinberg equilibrium was checked by Chi-squared test.
Statistical analyses were performed on allele form and 3 test models of the minor allele (additive, dominant, and recessive; Table 4). For CFAP43 rs10883979, both patient and control groups showed high frequencies of AA genotype at 66.5% and 65.64%, respectively. In comparison to the AA genotype, the frequency of the GG genotype was significantly different between the 2 groups and associated with a protective effect against male infertility risk (OR = 0.27; 95% CI: 0.06–0.89; P = .03). No significant difference in the AG genotype between the 2 groups was obtained compared to the AA genotype (P = .66). Similarly, in the recessive model, the GG genotype was associated with a reduced infertility risk compared to the AA + AG genotype group (OR = 0.26; 95% CI: 0.06–0.85; P = .02). For TEX14 rs79813370, a significant difference in genotypes was obtained in the additive model (P = .001). The frequency of the GT genotype differed significantly between the infertile and control groups (17.96% and 32.82%, respectively). This genotype was associated with a protective effect against male infertility (OR = 0.44; 95% CI: 0.27–0.69; P < .001) compared to the GG genotype. No significant correlation of the TT genotype between the 2 groups was obtained in comparison to the GG genotype (P = .19). In the dominant model, the combination of the GT and TT genotype groups reduced susceptibility to infertility in men compared to the GG genotype (OR = 0.43; 95% CI: 0.27–0.69; P < .001); the T allele lowered the risk of male infertility (OR = 0.48; 95% CI: 0.32–0.72; P < .001) in comparison to the G allele.
Table 4.
Association of CFAP43 and TEX14 SNPs with male infertility.
| SNP | Genotype | Control (n = 195) | Case (n = 206) | OR | 95% CI | P value |
|---|---|---|---|---|---|---|
|
CFAP43 rs17116635 |
Additive | .84* | ||||
| CC | 160 (82.05%) | 171 (83.01%) | 1.00 | |||
| CT | 34 (17.44%) | 35 (16.99%) | 0.96 | 0.57–1.63 | .89** | |
| TT | 1 (0.51%) | 0 (0.00%) | 0.00 | 0.00–36.72 | .49* | |
| Recessive | ||||||
| CC + CT | 194 (99.49%) | 206 (100.00%) | 1.00 | |||
| TT | 1 (0.51%) | 0 (0.00%) | 0.00 | 0.00–36.92 | .49* | |
| Dominant | ||||||
| CC | 160 (82.05%) | 171 (83.01%) | 1.00 | |||
| CT + TT | 35 (17.95%) | 35 (16.99%) | 0.94 | 0.54–1.62 | .90** | |
| Allele | ||||||
| C | 354 (90.77%) | 377 (91.50%) | 1.00 | |||
| T | 36 (9.23%) | 35 (8.50%) | 0.91 | 0.56–1.49 | .71** | |
|
CFAP43 rs10883979 |
Additive | .07** | ||||
| AA | 128 (65.64%) | 137 (66.50%) | 1.00 | |||
| AG | 56 (28.72%) | 66 (32.04%) | 1.10 | 0.72–1.70 | .66** | |
| GG | 11 (5.64%) | 3 (1.46%) | 0.27 | 0.06–0.89 | .03 ** | |
| Recessive | ||||||
| AA + AG | 184 (94.36%) | 203 (98.54%) | 1.00 | |||
| GG | 11 (5.64%) | 3 (1.46%) | 0.26 | 0.06–0.85 | .02 ** | |
| Dominant | ||||||
| AA | 128 (65.64%) | 137 (66.50%) | 1.00 | |||
| AG + GG | 67 (34.36%) | 69 (33.50%) | 0.96 | 0.62–1.49 | .92** | |
| Allele | ||||||
| A | 312 (80.00%) | 340 (82.52%) | 1.00 | |||
| G | 78 (20.00%) | 72 (17.48%) | 0.85 | 0.59–1.21 | .36** | |
|
TEX14 rs79813370 |
Additive | .001 * | ||||
| GG | 125 (64.10%) | 166 (80.58%) | 1.00 | |||
| GT | 64 (32.82%) | 37 (17.96%) | 0.44 | 0.27–0.69 | <.001 ** | |
| TT | 6 (3.08%) | 3 (1.46%) | 0.38 | 0.06–1.81 | .19* | |
| Recessive | ||||||
| GG + GT | 189 (96.92%) | 203 (98.54%) | 1.00 | |||
| TT | 6 (3.08%) | 3 (1.46%) | 0.47 | 0.07–2.22 | .33* | |
| Dominant | ||||||
| GG | 125 (64.10%) | 166 (80.58%) | 1.00 | |||
| GT + TT | 70 (35.90%) | 40 (19.42%) | 0.43 | 0.27–0.69 | <.001 ** | |
| Allele | ||||||
| G | 314 (80.51%) | 369 (89.56%) | 1.00 | |||
| T | 76 (19.49%) | 43 (10.44%) | 0.48 | 0.32–0.72 | <.001 ** | |
|
TEX14 rs34818467 |
Additive | .19* | ||||
| AA | 151 (77.44%) | 147 (71.36%) | 1.00 | |||
| AG | 41 (21.03%) | 58 (28.16%) | 1.45 | 0.92–2.31 | .11** | |
| GG | 3 (1.54%) | 1 (0.49%) | 0.34 | 0.01–4.33 | .62* | |
| Recessive | ||||||
| AA + AG | 192 (98.46%) | 205 (99.51%) | 1.00 | |||
| GG | 3 (1.54%) | 1 (0.49%) | 0.31 | 0.01–3.94 | .36* | |
| Dominant | ||||||
| AA | 151 (77.44%) | 147 (71.36%) | 1.00 | |||
| AG + GG | 44 (22.56%) | 59 (28.64%) | 1.38 | 0.86–2.22 | .17** | |
| Allele | ||||||
| A | 343 (87.95%) | 352 (85.44%) | 1.00 | |||
| G | 47 (12.05%) | 60 (14.56%) | 1.24 | 0.83–1.88 | .30** | |
95% CI = 95% confidence interval, n = number, OR = odds ratio, SNP = single nucleotide polymorphism.
P < .05 (in bold) indicates statistical significance.
P values calculated by Fisher’s exact test.
P values calculated by Chi-squared test.
4. Discussion
Male infertility is caused by deterioration in spermatogenesis, a critical process in the male reproduction system regulated by a multitude of genes.[3,31] Over the last decades, thousands of genes involved in the spermatogenic process have been discovered to be related to male infertility.[31] However, in approximately 30% of cases, the causes of infertility are still unknown,[2] suggesting that novel genes or SNPs may be linked with male infertility. In this study, blood samples from 206 men with idiopathic infertility and 195 healthy controls from the Vietnamese population were collected and analyzed to assess the association of the polymorphisms of CFAP43 (rs17116635 and rs10883979) and TEX14 (rs79813370 and rs34818467) with the risk of male infertility.
CFAP43 encodes a protein located between doublet microtubules 5 and 6 and para-flagellar rods in the flagella axonemes of many animals.[10,13] Its absence may make the entire complex unstable, resulting in both peri-axonemal and axonemal defects.[39] The most well-known disease linked to the defects of CFAP43 is MMAF, a severe form of asthenoteratozoospermia characterized by morphological abnormalities of the flagellum, such as absent, short, curled, or abnormal size, thereby impairing sperm motility. In 2017, Tang et al[10] first identified the loss of a bi-allelic function mutation in the CFAP43 gene in 3 out of 30 Han patients with MMAF and also showed that male mice lacking Cfap43 had the MMAF phenotype. In a later study, Coutton et al[13] identified CFAP43 mutations accounting for 12.8% of the analyzed MMAF patients (10/78) originating from North Africa, Europe, and the Middle East, and these mutations convincingly showed that loss of function of CFAP43 had been linked to azoospermia and abnormalities of the flagellum in humans. In subsequent studies on different cohorts, including Chinese,[16,18] Pakistani,[15] Argentinian,[20] and French[19] individuals with severe sperm motility disorders, mutations in CFAP43 were also identified. Given the important role that CFAP43 plays in sperm morphology, this research is the first-ever case-control study of polymorphisms in this gene with results showing an association between the polymorphism rs10883979 and male infertility in the Vietnamese population.
TEX14 is highly expressed in germ cells and participates in spermatocyte meiotic divisions in spermatogenesis. It promotes the conversion of midbodies into intact intercellular bridges (ICBs), which are required for chromosome segregation to occur after crossing over has been completed.[22] However, the precise role of intact intercellular bridges has not been determined and is only predicted to be involved in the communication and synchronization of germ cells within a syncytium.[24] Previous studies have suggested that mutations on TEX14, especially missense and splice site variants, were frequently found in patients with azoospermia and oligospermia.[25,26,40] However, few studies on the role of the TEX14 gene in susceptibility to infertility have been conducted. A follow-up genome-wide association study assessed the role of TEX14 SNPs (rs389389, rs7220834, rs35927726, rs35195402, rs35081269, rs34960869) in male infertility in a Caucasian population, showing no correlation between this gene and male infertility.[41] In the present study, an association of the polymorphism TEX14 rs79813370 with male infertility was found. To the best of our knowledge, the current case-control study is the first report of an association between TEX14 rs7913370 and male infertility worldwide.
This study was the first report to investigate the genotype distributions and the effects of CFAP43 (rs17116635 and rs10883979) and TEX14 (rs79813370 and rs34818467) on male infertility worldwide. Additionally, only CFAP43 rs10883979 has so far been studied in case-control research on Late-onset Alzheimer’s Disease.[42] Since the findings of this study were novel, several limitations should be considered. First, all participants (both case and control groups) were recruited from the same hospital, potentially introducing selection bias. Second, more extensive studies with participants collected from different sampling sites and different ethnic populations should be conducted to further validate the findings here. We can also perform quantitative RT-PCR or RNA sequencing to determine whether the studied SNPs are associated with differential expression of the studied genes or of other genes, respectively.
5. Conclusion
Our study suggested that CFAP43 rs10883979 and TEX14 rs79813370 were significantly associated with the risk of idiopathic male infertility in the Vietnamese population. Additionally, the G allele of rs79813370 may be a risk factor for male infertility. To obtain more insights into the association of the 2 genes CFAP43 and TEX14 and male infertility, further investigation on the 4 studied SNPs and others on these genes should be implemented in different populations.
Acknowledgments
We thank all sample donors for contributing to this study.
Author contributions
Conceptualization: Nong Van Hai, Nguyen Thuy Duong.
Data curation: Nguyen Duy Bac, Pham Van Quyet, Trinh The Son, Luong Thi Lan Anh.
Formal analysis: Tran Huu Dinh, Nguyen Phuong Anh, Nguyen Thuy Duong.
Funding acquisition: Nguyen Thuy Duong.
Investigation: Tran Huu Dinh, Nguyen Phuong Anh, Dinh Huong Thao, La Duc Duy, Pham Van Quyet, Nguyen Xuan Canh.
Methodology: Nguyen Xuan Canh, Nguyen Thuy Duong.
Project administration: Nguyen Thuy Duong.
Supervision: Nong Van Hai, Nguyen Thuy Duong.
Validation: Tran Huu Dinh, Nguyen Phuong Anh, Dinh Huong Thao.
Writing – original draft: Tran Huu Dinh, Nguyen Phuong Anh.
Writing – review & editing: Nong Van Hai, Nguyen Thuy Duong.
Abbreviations:
- 95% CI
- 95% confidence interval
- CFAP43
- cilia- and flagella-associated proteins 43
- DNA
- deoxyribonucleic acid
- HWE
- Hardy–Weinberg equilibrium
- MMAF
- multiple morphological abnormalities of sperm flagella
- OR
- odds ratio
- PCR-RFLP
- polymerase chain reaction-restriction fragment length polymorphism
- SNPs
- single nucleotide polymorphisms
- TEX14
- testis-expressed 14
This research was funded by the Ministry of Science and Technology, Vietnam under grant number DTDL.CN.60/19.
The authors have no conflicts of interest to disclose.
The datasets generated during and/or analyzed during the current study are not publicly available, but are available from the corresponding author on reasonable request.
How to cite this article: Dinh TH, Phuong Anh N, Thao DH, Duy LD, Bac ND, Quyet PV, Son TT, Lan Anh LT, Canh NX, Hai NV, Duong NT. Single nucleotide polymorphisms of CFAP43 and TEX14 associated with idiopathic male infertility in a Vietnamese population. Medicine 2024;103:39(e39839).
Contributor Information
Tran Huu Dinh, Email: tranhuudinh@igr.ac.vn.
Nguyen Phuong Anh, Email: npanh@igr.ac.vn.
Dinh Huong Thao, Email: thdinh95@igr.ac.vn.
La Duc Duy, Email: duyld@igr.ac.vn.
Nguyen Duy Bac, Email: nguyenduybac@vmmu.edu.vn.
Pham Van Quyet, Email: quyetvph@vmmu.edu.vn.
Trinh The Son, Email: trinhtheson@vmmu.edu.vn.
Luong Thi Lan Anh, Email: luongthilananh@hmu.edu.vn.
Nguyen Xuan Canh, Email: nxcanh@vnua.edu.vn.
Nong Van Hai, Email: vhnong@igr.ac.vn.
References
- [1].Zegers-Hochschild F, Adamson GD, Dyer S, et al. The international glossary on infertility and fertility care, 2017. Fertil Steril. 2017;108:393–406. [DOI] [PubMed] [Google Scholar]
- [2].Fainberg J, Kashanian JA. Recent advances in understanding and managing male infertility. F1000Res. 2019;8:F1000 Faculty Rev–670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [3].Krausz C, Escamilla AR, Chianese C. Genetics of male infertility: from research to clinic. Reproduction. 2015;150:R159–74. [DOI] [PubMed] [Google Scholar]
- [4].Krausz C, Riera-Escamilla A. Genetics of male infertility. Nat Rev Urol. 2018;15:369–84. [DOI] [PubMed] [Google Scholar]
- [5].Agarwal A, Mulgund A, Hamada A, Chyatte MR. A unique view on male infertility around the globe. Reprod Biol Endocrinol. 2015;13:37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Sun H, Gong TT, Jiang YT, Zhang S, Zhao YH, Wu QJ. Global, regional, and national prevalence and disability-adjusted life-years for infertility in 195 countries and territories, 1990-2017: results from a global burden of disease study, 2017. Aging (Albany NY). 2019;11:10952–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7].Pereira R, Sousa M. Morphological and molecular bases of male infertility: a closer look at sperm flagellum. Genes (Basel). 2023;14:383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Cioppi F, Rosta V, Krausz C. Genetics of azoospermia. Int J Mol Sci. 2021;22:3264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [9].Cannarella R, Condorelli RA, Mongioi LM, La Vignera S, Calogero AE. Molecular biology of spermatogenesis: novel targets of apparently idiopathic male infertility. Int J Mol Sci. 2020;21:1728. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Tang S, Wang X, Li W, et al. Biallelic mutations in CFAP43 and CFAP44 cause male infertility with multiple morphological abnormalities of the sperm flagella. Am J Hum Genet. 2017;100:854–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11].Toure A, Martinez G, Kherraf ZE, et al. The genetic architecture of morphological abnormalities of the sperm tail. Hum Genet. 2021;140:21–42. [DOI] [PubMed] [Google Scholar]
- [12].Yu Y, Wang J, Zhou L, Li H, Zheng B, Yang S. CFAP43-mediated intra-manchette transport is required for sperm head shaping and flagella formation. Zygote. 2021;29:75–81. [DOI] [PubMed] [Google Scholar]
- [13].Coutton C, Vargas AS, Amiri-Yekta A, et al. Mutations in CFAP43 and CFAP44 cause male infertility and flagellum defects in Trypanosoma and human. Nat Commun. 2018;9:686. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [14].Morimoto Y, Yoshida S, Kinoshita A, et al. Nonsense mutation in CFAP43 causes normal-pressure hydrocephalus with ciliary abnormalities. Neurology. 2019;92:e2364–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15].Khan I, Shah B, Dil S, et al. Novel biallelic loss-of-function mutations in CFAP43 cause multiple morphological abnormalities of the sperm flagellum in Pakistani families. Asian J Androl. 2021;23:627–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Sha YW, Wang X, Su ZY, et al. Patients with multiple morphological abnormalities of the sperm flagella harbouring CFAP44 or CFAP43 mutations have a good pregnancy outcome following intracytoplasmic sperm injection. Andrologia. 2019;51:e13151. [DOI] [PubMed] [Google Scholar]
- [17].Sha YW, Wang X, Xu X, et al. Novel Mutations in CFAP44 and CFAP43 cause Multiple Morphological Abnormalities of the Sperm Flagella (MMAF). Reprod Sci. 2019;26:26–34. [DOI] [PubMed] [Google Scholar]
- [18].Wu H, Li W, He X, et al. NovelCFAP43 andCFAP44 mutations cause male infertility with multiple morphological abnormalities of the sperm flagella (MMAF). Reprod Biomed Online. 2019;38:769–78. [DOI] [PubMed] [Google Scholar]
- [19].Ferreux L, Bourdon M, Chargui A, et al. Genetic diagnosis, sperm phenotype and ICSI outcome in case of severe asthenozoospermia with multiple morphological abnormalities of the flagellum. Hum Reprod. 2021;36:2848–60. [DOI] [PubMed] [Google Scholar]
- [20].Oud MS, Houston BJ, Volozonoka L, et al. Exome sequencing reveals variants in known and novel candidate genes for severe sperm motility disorders. Hum Reprod. 2021;36:2597–611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [21].Cannarella R, Condorelli RA, Duca Y, La Vignera S, Calogero AE. New insights into the genetics of spermatogenic failure: a review of the literature. Hum Genet. 2019;138:125–40. [DOI] [PubMed] [Google Scholar]
- [22].Greenbaum MP, Yan W, Wu MH, et al. TEX14 is essential for intercellular bridges and fertility in male mice. Proc Natl Acad Sci U S A. 2006;103:4982–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [23].Kim HJ, Yoon J, Matsuura A, et al. Structural and biochemical insights into the role of testis-expressed gene 14 (TEX14) in forming the stable intercellular bridges of germ cells. Proc Natl Acad Sci U S A. 2015;112:12372–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Rezende-Melo CA, Caldeira-Brant AL, Drumond-Bock AL, et al. Spermatogonial asynchrony in Tex14 mutant mice lacking intercellular bridges. Reproduction. 2020;160:205–15. [DOI] [PubMed] [Google Scholar]
- [25].Araujo TF, Friedrich C, Grangeiro CHP, et al. Sequence analysis of 37 candidate genes for male infertility: challenges in variant assessment and validating genes. Andrology. 2020;8:434–41. [DOI] [PubMed] [Google Scholar]
- [26].Fakhro KA, Elbardisi H, Arafa M, et al. Point-of-care whole-exome sequencing of idiopathic male infertility. Genet Med. 2018;20:1365–73. [DOI] [PubMed] [Google Scholar]
- [27].Gershoni M, Hauser R, Yogev L, et al. A familial study of azoospermic men identifies three novel causative mutations in three new human azoospermia genes. Genet Med. 2017;19:998–1006. [DOI] [PubMed] [Google Scholar]
- [28].Krausz C, Riera-Escamilla A, Moreno-Mendoza D, et al. Genetic dissection of spermatogenic arrest through exome analysis: clinical implications for the management of azoospermic men. Genet Med. 2020;22:1956–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [29].Chung CC, Kanetsky PA, Wang Z, et al. Meta-analysis identifies four new loci associated with testicular germ cell tumor. Nat Genet. 2013;45:680–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Kelemen LE, Wang X, Fredericksen ZS, et al. Genetic variation in the chromosome 17q23 amplicon and breast cancer risk. Cancer Epidemiol Biomarkers Prev. 2009;18:1864–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [31].Houston BJ, Riera-Escamilla A, Wyrwoll MJ, et al. A systematic review of the validated monogenic causes of human male infertility: 2020 update and a discussion of emerging gene-disease relationships. Hum Reprod Update. 2021;28:15–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Mahyari E, Guo J, Lima AC, et al. Comparative single-cell analysis of biopsies clarifies pathogenic mechanisms in Klinefelter syndrome. Am J Hum Genet. 2021;108:1924–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [33].Hammal F, de Langen P, Bergon A, Lopez F, Ballester B. ReMap 2022: a database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments. Nucleic Acids Res. 2022;50:D316–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34].R Core Team. R: a language and environment for statistical computing. R Foundation for Statistical Computing. Available at: https://www.R-project.org/. Accessed June 2022. [Google Scholar]
- [35].Graffelman J. Exploring diallelic genetic markers: the HardyWeinberg package. J Stat Softw. 2015;64:1–23. [Google Scholar]
- [36].Graffelman J, Camarena JM. Graphical tests for Hardy-Weinberg equilibrium based on the ternary plot. Hum Hered. 2008;65:77–84. [DOI] [PubMed] [Google Scholar]
- [37].Graffelman J, Weir BS. Testing for Hardy-Weinberg equilibrium at biallelic genetic markers on the X chromosome. Heredity (Edinb). 2016;116:558–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [38].Aragon T. epitools: Epidemiology Tools. Available at: https://CRAN.R-project.org/package=epitools. Accessed June 2022. [Google Scholar]
- [39].Wang WL, Tu CF, Tan YQ. Insight on multiple morphological abnormalities of sperm flagella in male infertility: what is new? Asian J Androl. 2020;22:236–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [40].An M, Liu Y, Zhang M, et al. Targeted next-generation sequencing panel screening of 668 Chinese patients with non-obstructive azoospermia. J Assist Reprod Genet. 2021;38:1997–2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [41].Aston KI, Krausz C, Laface I, Ruiz-Castane E, Carrell DT. Evaluation of 172 candidate polymorphisms for association with oligozoospermia or azoospermia in a large cohort of men of European descent. Hum Reprod. 2010;25:1383–97. [DOI] [PubMed] [Google Scholar]
- [42].Grupe A, Li Y, Rowland C, et al. A scan of chromosome 10 identifies a novel locus showing strong association with late-onset Alzheimer disease. Am J Hum Genet. 2006;78:78–88. [DOI] [PMC free article] [PubMed] [Google Scholar]