Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2024 Sep 30;14:22661. doi: 10.1038/s41598-024-72783-4

Murine neonatal cardiac regeneration depends on Insulin-like growth factor 1 receptor signaling

Thomas Schuetz 1,2,3,#, Theresa Dolejsi 1,3,#, Eva Beck 1, Fabio Fugger 1, Alexander Bild 1, Marie-Theres Duin 1, Jasmina Gavranovic-Novakovic 1, Erika Hilbold 4, Thomas Hoffmann 5, Johannes Zuber 5, Axel Bauer 1, Frank Ruschitzka 3,6, Christian Bär 4,7, Josef Martin Penninger 2,8,9,10,✉, Bernhard Johannes Haubner 1,2,3,6,✉
PMCID: PMC11443045  PMID: 39349545

Abstract

Unlike adult mammals, the hearts of neonatal mice possess the ability to completely regenerate from myocardial infarction (MI). This observation has sparked vast interest in deciphering the potentially lifesaving and morbidity-reducing mechanisms involved in neonatal cardiac regeneration. In mice, the regenerative potential is lost within the first week of life and coincides with a reduction of Insulin-like growth factor 1 receptor (Igf1r) expression in the heart. Igf1r is a well-known regulator of cardiomyocyte maturation and proliferation in neonatal mice. To test the role of Igf1r as a pivotal factor in cardiac regeneration, we knocked down (KD) Igf1r specifically in cardiomyocytes using recombinant adeno-associated virus (rAAV) delivery and troponin T promotor driven shRNAmirs. Cardiomyocyte specific Igf1r KD versus control mice were subjected to experimental MI by permanent ligation of the left anterior descending artery (LAD). Cardiac functional and morphological data were analyzed over a 21-day period. Neonatal Igf1r KD mice showed reduced systolic cardiac function and increased fibrotic cardiac remodeling 21 days post injury. This cardiac phenotype was associated with reduced cardiomyocyte nuclei mitosis and decreased AKT and ERK phosphorylation in Igf1r KD, compared to control neonatal mouse hearts. Our in vivo murine data show that Igf1r KD shifts neonatal cardiac regeneration to a more adult-like scarring phenotype, identifying cardiomyocyte-specific Igf1r signaling as a crucial component of neonatal cardiac regeneration.

Keywords: Neonatal cardiac regeneration, Myocardial infarction, Insulin-like growth factor 1 receptor, LAD ligation

Subject terms: Cardiac regeneration, Experimental models of disease, Myocardial infarction, Heart failure

Introduction

Coronary artery disease and irreversible cardiac damage after myocardial infarction (MI) remains the leading cause of disabling heart failure in humans1–4. Despite evidence of lifelong cardiomyocyte turnover5, the signals that could be utilized to increase cardiomyocyte proliferation in adults and thereby support cardiac regeneration after myocardial tissue injury are largely elusive.

In contrast to adult mammalian hearts, neonatal mice have been shown to fully–structurally and functionally–regenerate the cardiac tissue following MI, comparable to lower vertebrates such as newts and zebrafish6–10. However, this capability of neonatal mammals disappears within the first week of life11. It has now been demonstrated that not only mice but also larger mammals, such as pigs and opossums, have the capacity of neonatal cardiac regeneration12,13. Notably, we also provided first evidence of neonatal cardiac regeneration in humans14. It is important to highlight that the type of injury, e.g., apical resection vs. ischemic injury by ligation of the left anterior descending artery (LAD) versus cryoinjury, plays an important role in the outcome of neonatal cardiac regeneration15–18.

Scientific advances gained from all these models form the basis of novel approaches to study cardiac regeneration in an in vivo mammalian system19–21. In-depth analysis of the protein coding and noncoding transcriptome of neonatal mouse hearts after MI uncovered large similarities between physiological postnatal development and post-MI neonatal cardiac regeneration, suggesting common regulatory pathways22. Moreover, it has also been shown that on a transcriptional level the cardiac healing process is completed within 10 days post injury (dpi)22.

We have previously shown that one of the most prominent transcripts deregulated during neonatal regeneration is Insulin-like growth factor 1 receptor (Igf1r). IGF1R consists of an approximately 400 kDa α2β2-heterotetrameric complex that links extracellular signals to intracellular pathways such as AKT through its intrinsic tyrosine kinase activity23. The canonical AKT and ERK pathways are well established in cardiomyocyte proliferation, hypertrophy, homeostasis, and cardiac development24–28. IGF1R is the main receptor for Insulin-like growth factor 1 (IGF1) and Insulin-like growth factor 2 (IGF2)29. Recently, it has been shown that paracrine IGF2-signaling via the insulin receptor (INSR) is essential for neonatal cardiac regeneration following apex resection30. It is also known that macrophage derived IGF1 is necessary for murine skeletal muscle regeneration31. Furthermore, the local intramyocardial expression of IGF1 enhances cardiac repair in adult mice32.

However, the role of Igf1r in neonatal cardiac regeneration following a complex ischemic myocardial injury is still unclear. We therefore assessed the effect of recombinant Adeno-associated virus (rAAV) mediated Igf1r knockdown (KD) on mouse neonatal cardiac regeneration.

Materials and methods

Figure 1 illustrates the basic experimental setup. Briefly, mice were injected with rAAV Igf1r KD or a Renilla (Ren) control (CTRL) virus directly after birth (postnatal day 0; P0). At P1 mice were randomized into either a LAD ligation or SHAM control group. Induction of MI was confirmed 1 dpi (corresponds to P2) by echocardiographic assessment of the left ventricular (LV) ejection fraction (EF). Three weeks later, at 21 dpi and after a final echocardiography, hearts were harvested and processed for further histological or molecular analyses.

Fig. 1.

Fig. 1

Experimental overview. On the first day of life (P0) recombinant adeno-associated viruses were injected directly into the thoracic cavity of the neonatal mice. On P1, mice were randomized into either a SHAM control surgery group or into a left anterior descending artery (LAD) ligation group. 1 day post injury (dpi) echocardiography was performed to assess effective induction of myocardial infarction (MI) in the LAD group by measurement of the left ventricular ejection fraction (LVEF). On 21 dpi, following a final echocardiography, hearts were harvested for further analysis.

Short hairpin RNA miRs

For experimental KD of our gene of interest, we used synthetic short hairpin RNAs (shRNAs) based on a previously described platform33,34. For improved KD efficiency these shRNAs were embedded into an endogenous microRNA, termed “shRNAmir”. Three different hairpins (Igf1r.4971, Igf1r.3855, and Igf1r.1934), each one targeting Igf1r, were used to control for off-target effects. A hairpin targeting the Renilla luciferase (Ren), a gene/protein inexistent in mammals, was used for the control group. The KD efficiency of all the hairpins was tested and verified in vitro in mouse embryonic fibroblasts (MEFs) using retroviral vectors (RVs) as previously published33. In short, MEFs expressing a dTomato reporter tagged with target sites of the probed shRNAs were transduced with the indicated shRNAs and the decreased dTomato expression was measured. Consequently, in this in vitro evaluation KD efficiency of Ren.713 does not represent the KD of Igf1r but of the tagged dTomato reporter.

Retroviruses

For further in vitro confirmation of successful Igf1r KD a retrovirus-based system was established. Ecotropic pseudotyped retroviral vectors containing the respective shRNAmir were generated using standard cloning techniques based on a previously described platform33,35. NIH3T3 mouse fibroblasts (Merck KGaA, Darmstadt, Germany) were transduced with the retroviral particles. IGF1R content was tested by immunoblotting.

Neonatal mouse cardiomyocyte cell culture

To test the ability of the hairpins to specifically knock-down Igf1r in cardiomyocytes, we applied small interfering RNA (siRNA) that specifically binds the sequences used for shRNAs onto cultured neonatal mouse cardiomyocytes. Neonatal mouse cardiomyocytes were isolated from 0.5- to 3-day-old mouse pups using a Neonatal Heart Dissociation Kit (Miltenyi, Bergisch Gladbach, Germany) according to the manufacturer’s protocol.

Ren or Igf1r siRNA (Eurofins, Ebersberg, Germany) was transfected to neonatal mouse cardiomyocytes at a concentration of 100 nM using Lipofectamine 2000 (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) in Opti-MEM medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). The transfection mix was replaced by supplemented MEM medium after 5 h. Further experiments were conducted 72 h after siRNA transfection. Knock-down of Igf1r was tested by quantitative real-time PCR and on a protein level by Western blotting. Detailed protocols, workflows, primer and siRNA sequences are listed in the supplementary information file.

Recombinant Adeno-Associated-Viruses (rAAV)

For in vivo testing, rAAV2/9 were generated as previously described36. Serotype 2/9 was chosen over other serotypes because of its high affinity for cardiomyocytes37. 293FT cells (Thermo Fisher Scientific, Waltham, MA, USA) were used for production of rAAV2/9 using the triple transfection method with helper plasmids pAdΔF6 and plasmid pAAV2/9 (Penn Vector Core, University of Pennsylvania, PA, USA).

The shRNAs described above were cloned into the multiple cloning site of the plasmid represented in Fig. 2E. To ensure cardiomyocyte specific expression of the desired plasmid, the construct of reporter and shRNA is under the control of a cardiomyocyte specific troponin T promoter. rAAVs were produced in “clean” batches containing only one of the hairpins.

Fig. 2.

Fig. 2

Efficient IGF1R knockdown in the neonatal heart. A Time course of Igf1r mRNA expression in vivo in whole hearts during postnatal (P) days 1 to 7, analyzed by qPCR. qPCR was performed in biological triplicates. BIn vitro KD efficiency of the Renilla control, and the three indicated Igf1r KD hairpins used for in vivo and in vitro experiments. Mouse embryonic fibroblasts (MEFs) expressing a dTomato reporter tagged with target sites of the probed shRNAmir were transduced with the indicated shRNAs. Note that “expression” refers to the expression of the dTomato reporter tagged with the target site for the responding shRNAmirs. Therefore, the Ren.713 hairpin reduced expression of the reporter tagged with the Ren target site, not with the Igf1r target sites. d = day. C Immunoblotting of in vitro IGF1R KD efficiency using the indicated hairpins, the Renilla control hairpin delivered by retroviruses, and the empty retrovirus control, tested in NIH3T3 cells. Cells were harvested on day 4 after 1st infection. GAPDH protein expression is shown as a loading control. D In vitro Igf1r knockdown efficiency of the respective siRNAs and controls in neonatal mouse cardiomyocytes determined by qPCR. The target gene expression levels were normalized to the house keeping gene TATA-binding protein (TBP). E Representative Western blot of in vitro Igf1r knockdown efficiency of the respective siRNA and controls in neonatal mouse cardiomyocytes. For Western blotting, two runs of neonatal mouse cardiomyocyte cell culture with four cell culture wells per siRNA were performed; four cell culture wells were pooled per Western blot sample. Graph indicates mean relative signaling intensity of IGF1R relative to GAPDH ± SD, normalized to Ren.713. F In vivo luciferase imaging to confirm recombinant adeno-associated virus (rAAV) infection of the heart. The upper panel shows the plasmid sequence of the rAAV used, containing a luciferase as a reporter gene under the control of a cardiomyocyte specific troponin T promoter. The lower panel shows two mice after injection of the rAAVs on the left and a control mouse on the right into which no rAAVs were injected. Color represents the light emitted by the luciferase. While there is some leakiness of the reporter in the liver, constructs are expressed exclusively in the hearts of the mice. ITR = Inverted terminal repeat. TropT = Cardiomyocyte specific troponin T promoter. Luc2 = Firefly luciferase. MCS = Multiple cloning site. PolA = Poly-A tail. G Representative images of immunohistochemical staining of hearts to confirm in vivo plasmid expression. The upper panel shows the plasmid sequence containing GFP as a reporter gene, under the control of a cardiomyocyte specific troponin T promoter. The lower panels show the sections stained for GFP expression. Hairpins were subcloned into the multiple cloning site (MCS). The panels on the left show a negative control heart, the panels on the right represent a heart 5 days after injection of the rAAVs constructs. Brown marks GFP. Blue represents counterstaining with Hematoxylin. Areas chosen for magnification are marked with a black box. The red triangle marks the aortic valve, the orange triangle the aorta. Both do not express GFP, implicating the construct is not expressed in these tissues, i.e. fibroblasts, myofibroblasts, and smooth muscle cells, in contrast to cardiomyocytes (cyan triangle and bottom magnification panel). ITR = Inverted terminal repeat. TropT = Cardiomyocyte specific troponin T promoter. GFP = Green fluorescent protein. PolA = Poly-A tail. H Representative Western blots of in vivo rAAV KD efficiency of the three Igf1r KD hairpins compared to the Ren.713 control hairpin. Hearts were harvested on P5 after rAAV injections on day one after birth and blotted for IGF1R and GAPDH protein levels. Bar graphs indicate mean relative signaling intensity of IGF1R relative to GAPDH ± SD, normalized to Ren.713. Values are normalized to the Ren.713 group. One-way ANOVA with Dunnett’s correction for multiple comparisons was used for statistical analysis in panels A, D, E. Unpaired two-tailed Student’s t-Test were used for statistical analysis in panel H. Full blots are supplied in Supplementary Fig. 3.

rAAV vectors were purified using an Optiprep density gradient medium (D-1556, Merck KGaA, Darmstadt, Germany) by ultracentrifugation and stored on − 80 °C until further use. Virus concentrations were quantified using quantitative PCR against the GFP reporter sequences of the plasmids containing the shRNAmir. Primers for titration of rAAVs were CGAAGGCTACGTCCAGGAGC (forward) and CGATGTTGTGGCGGATCTTG (reverse), amplifying a 248 bp oligonucleotide.

Immunoblotting

For in vitro and in vivo KD confirmation proteins were extracted from in vitro NIH3T3 cells and in vivo left ventricles, respectively. Proteins were extracted using Tissue Protein Extraction Reagent (T-PER, Thermo Fisher Scientific, Waltham, MA, USA) or Mammalian Protein Extraction Reagent (M-PER, Thermo Fisher Scientific, Waltham, MA, USA), containing Halt Protease and Phosphatase Inhibitor Cocktail (PIERCE, Rockford, USA). Western Blotting was performed as described previously24. Antibodies against IGF1R-β (#3027, Cell Signaling Technology, Danvers, MA, USA), AKT (#4691S, Cell Signaling Technology, Danvers, MA, USA), phospho-AKT (#4060 s, Cell Signaling Technology, Danvers, MA, USA), ERK (#9102, Cell Signaling Technology, Danvers, MA, USA), and phospho-ERK (#9101, Cell Signaling Technology, Danvers, MA, USA) were used. An Anti-GAPDH-antibody (ab8245, Abcam, Cambridge, UK) served as a loading control. For in vivo confirmation, Igf1r KD hearts were harvested 5 days post infection (P5). Blots were quantified in a relative manner using the FIJI software38. Full blots are presented in Suppl. Figure 3.

Animals and neonatal LAD ligation surgery

All animal experiments were performed in accordance with institutional guidelines and approved by the Austrian Animal Ethical Board (BMWF-66.015/0024-WF/V/3b/2014 and BMWFW-66.011/0133-WF/V/3b/2017). Experiments complied with the ARRIVE guidelines. Mice of both sexes on a C57BL6/J background were used in all experiments.

5 × 1013 rAAV vector genomes per kilogram (vg/kg) bodyweight were injected directly into the thoracic cavity of P0 mice via a subxiphoidal approach using a microliter syringe (Hamilton Bonaduz AG, Bonaduz, Switzerland) with a 30-gauge needle, as previously described36. Each mouse received only one type of the rAAVs/shRNAs, the different Igf1r KD hairpins were never mixed in one mouse. On P1 either ligation of the LAD for induction of MI or SHAM surgery as control were performed using a protocol previously published in detail by our group7,11. In short, P1 mice were anesthetized using ice-water to induce hypothermic cardiac and respiratory arrest. Subsequently mice were placed onto a cool pack and LAD ligation, or SHAM surgery were performed using a M80 Leica stereomicroscope (Leica, Wetzlar, Germany). Induction of MI was achieved by ligation of the LAD using a 10–0 Ethilon thread. Mice of the SHAM groups underwent the same procedure as mice of the LAD groups, without ligation of the LAD. After surgery, mice were placed onto a 38 °C warming pad until spontaneous recovery. Peri-interventional analgesia was performed by subcutaneous application of buprenorphine (0.05 mg/kg). Hearts were harvested for further analyses at indicated time points. At the time of euthanasia, body and heart weights and tibia lengths were measured.

Quantitative real-time PCR

Left ventricles of P1, P3, P5, and P7 wild type mice were harvested and immediately snap frozen in liquid nitrogen. RNA was isolated using a RNeasy Kit (Qiagen, Hilden, Germany). Reverse transcription was performed using iScript (Bio-Rad Laboratories, Hercules, CA, USA). Quantitative real-time PCR was performed on a StepOnePlus machine (Applied Biosystems, Waltham, MA, USA). miScript SYBR Green PCR Kit (Qiagen, Hilden, Germany) was used as mastermix. Sequences of the Igf1r forward and the reverse primer are AAAGGAATGAAGTCTGGCTCCG and GGCCCACAGATTTCTCCACTC, respectively. Transcript levels were normalized to β-Actin and Mrpl32 and further normalized to P7 levels. Reactions were performed on biological triplicates and technical duplicates. Relative mRNA levels were calculated with the ΔΔCt method39.

Echocardiography

On days 1 and 21 post injury transthoracic echocardiography was performed on the mice using a Fujifilm VisualSonics Preclinical Imaging Platform (VEVO 770 or VEVO 2100) with appropriate high frequency scanheads. Parasternal long axis B-mode and M-mode images were acquired, left ventricular end-diastolic (LVEDV), end-systolic volumes (LVESV) measured, and EF calculated using the system’s internal software.

Histology and staining protocols

Hearts were harvested at indicated time points, fixed in 4% paraformaldehyde overnight, and subsequently put in 50% EtOH at 4 °C until dehydration and paraffin-embedding was performed. 2.5 µm thick sections were cut from the samples using a microtome. Masson’s trichrome with aniline blue stains were prepared using the Bio Optica staining kit (#04–010,802, Milan, Italy). All sections were scanned with a Panoramic SCAN scanner from 3D HISTECH (Budapest, Hungary).

Fibrosis was analyzed by quantification of blue tissue content, depicting connective tissue, in left ventricles in tissue sections stained with trichrome using FIJI38. The valve-apparatus of the left ventricle was excluded from measurements. At least two sections at different, defined positions within the hearts were analyzed per heart. The percentage of the total fibrotic area was calculated as the sum of blue-stained areas divided by the total left-ventricular area.

For immunofluorescence staining, standard protocols were followed. Phospho-Histone H3 was detected using an antibody from Biocare Medical (#ACI3130C; The Hague, The Netherlands) and a Tyramide SuperBoost Kit (#B40922, Thermo Fisher Scientific, Waltham, MA, USA). 4’,6-Diamidino-2-phenylindol (DAPI) was used for counterstaining. Cardiomyocytes were labeled using an anti-troponin T antibody (#MS295P, Thermo Fisher Scientific, Waltham, MA, USA).

To label cell membranes and analyze cardiomyocyte cross sectional area (CSA) stains using wheat germ agglutinin (WGA) conjugated to Alexa Fluor™ 488 (#W11261 Thermo Fisher Scientific, Waltham, MA, USA) were performed using standard protocols. DAPI was used for counterstaining. Sections were scanned with a Panoramic SCAN scanner from 3D HISTECH (Budapest, Hungary) at a magnification of 20x. CSA of cardiomyocytes cut transversally in the middle of the left ventricular free wall was measured in pixels using the CellProfiler cell image analysis software40,41.

Immunohistochemistry to detect GFP was performed to check for successful infection and expression of the plasmids. A chicken anti-GFP antibody (#GFP-1020, Aves Labs, Davis, CA, USA) was used to label GFP. Sections were counterstained with Hematoxylin.

Bioluminescence imaging

For confirmation of successful transduction and expression of rAAVs in cardiomyocytes a plasmid containing a troponin T driven luciferase reporter was established and injected into P1 mice. Luciferase (LUC2) activity was measured 24 h after virus injection using an IVIS Spectrum in vivo imaging system (PerkinElmer, Waltham, MA, USA).

Data analysis and statistics

If not stated otherwise, data are presented as mean ± standard deviation (SD). Prism 9 and 10 (GraphPad Software, Boston, MA, USA) were used for statistical analysis. For statistical analysis on two groups unpaired two-tailed Student’s t-Test was performed. For statistical analysis on experiments with three or more groups one factor ANOVA was used. If it was required to analyze two factors (e.g., type of surgery and KD of Igf1r) two-way ANOVA was performed. Tukey’s correction for multiple comparisons was used in case groups were compared with every other group, or Dunnett’s correction for multiple comparisons was used in case groups were compared with a control group, as recommended by the GraphPad Prism software. No statistical analysis was performed on experiments with more than two factors (e.g., timepoint, LAD/SHAM surgery, and KD of Igf1r). A (adjusted) p-value < 0.05 was considered statistically significant. Exact p-values are provided for each comparison. Each comparison performed is displayed in the respective graph. Statistically significant p-values are set in bold font.

Results

Expression of Igf1r declines during the first postnatal week of life

Igf1r is a well-established pro-proliferative gene in physiological and pathological conditions and has been identified as a candidate gene for neonatal cardiac regeneration in a large-scale mRNA expression study by our group22. To confirm the candidate status, we performed RT-qPCR of left ventricular heart tissue of wild type P1, P3, P5, and P7 mice and found a significant decline of Igf1r expression during the first week of life (Fig. 2A). Igf1r expression on P1 was 2.3 times higher compared to P7, which points towards a possible involvement in the regenerative phenotype of neonatal mouse hearts.

shRNAmir-mediated knockdown of Igf1r in vitro and in vivo

To test the role of Igf1r during neonatal cardiac regeneration, we used an in vivo KD strategy using shRNAmirs. This approach was chosen since conventional full body and cardiomyocyte conditional Igf1r KO are embryonically lethal (Supp. Figure 2B)42.

The target specificity of the hairpins was confirmed using a previously published in vitro fluorescence-based reporter assay33,43. Each hairpin achieved an in vitro KD efficiency of the dTomato reporter tagged with the target site for the responding shRNAmirs of about 30% after 3 days, 60% after 6 days, and 80% after 8 days (Fig. 2B).

To confirm in vitro KD efficiency at the protein level, IGF1R levels were analyzed in NIH3T3 cells after infection with retroviral vectors delivering the tested shRNAmirs. Western blotting of the cell lysates presented a robust decrease in IGF1R protein expression using all three shRNAmirs in comparison to their respective controls (Fig. 2C). To test, if the sequence of our shRNAmirs can also exert their impact in murine cardiomyocytes, we carried out additional in vitro tests. siRNAs containing our shRNAmir sequence were applied to cultured neonatal mouse cardiomyocytes. Expression of Igf1r mRNA was analyzed by qPCR (Fig. 2D) and the protein level of IGF1R was assessed by means of immunoblotting (Fig. 2E). Both approaches confirmed that the sequence of our hairpins indeed possess the ability to reduce Igf1r expression in neonatal murine cardiomyocytes. After confirming successful downregulation of IGF1R in vitro, we applied the shRNAmir hairpins in vivo using rAAVs. To increase the tropism of the generated rAAVs for cardiomyocytes, rAAV2/9 serotype was used44,45. Moreover, the shRNAmir and the reporter were expressed under the control of a cardiomyocyte specific troponin T promoter. Infection efficiency and tropism for the heart were confirmed by immunohistochemistry and luciferase in vivo imaging. Using the luciferase platform, some minor (off-target) expression of the construct, only with long bioluminescence acquisition, in the liver was observed, but otherwise it was exclusively expressed in the hearts of the mice (Fig. 2F). While cardiomyocytes constitute the main cell type of the murine heart by mass and volume, endothelial cells and fibroblasts are present in much higher numbers46. However, these cell types are abundant in the whole body, therefore, if the construct would be expressed in these cells, one would expect to detect a luciferase signal in the whole body.

Furthermore, to confirm expression in cardiomyocytes, immunohistochemical staining was performed on P5 hearts (Fig. 2G). As shown by high magnification images compared to a negative control, GFP expression was clearly visible within cardiomyocytes. Of note, the aortic valve apparatus and the aorta did not exhibit GFP expression, therefore effectively ruling out the expression of the construct in cells building up the aortic valve, i.e. fibroblasts, myofibroblasts, and smooth muscle cells47.

To check the KD efficiency of our shRNAmirs, immunoblotting was performed on hearts five days after injection of the rAAVs. Significant reduction of IGF1R expression was observed for all three hairpins (Fig. 2H).

Thus, the intrathoracic injection of rAAVs into P0 mice resulted in a robust expression of the desired construct in the heart and most importantly, a marked KD of IGF1R was observed. Hence, this setup allowed us to test the role of IGF1R during neonatal mouse cardiac regeneration.

In vivo Igf1r knockdown impairs functional neonatal cardiac regeneration

To study the effect of Igf1r on neonatal cardiac regeneration, we injected Igf1r KD or Ren KD control rAAVs directly into the thorax of neonatal mice on their day of birth (P0). On the following day (P1) mice underwent either LAD ligation or SHAM control surgery. To confirm successful induction of MI after LAD ligation, we analyzed the left ventricular function by echocardiography on P2, corresponding to 1 dpi. Hearts were harvested 21dpi after performing final echocardiographic measurements. The experimental timeline of the in vivo KD regeneration experiments is presented in Fig. 1. LAD ligation in neonatal mice successfully induced MI, as evidenced by significantly reduced LVEF 1 dpi compared to SHAM mice (Fig. 3A, 3C, and Suppl. Figure 1). In clinical routine LVEF is the main functional parameter of the heart, used to categorize heart failure in humans and its value is decisive for further treatment decisions4. As previously shown by our group, the extent of MI in neonatal mice is comparable to that in older mice11.

Fig. 3.

Fig. 3

Knockdown (KD) of Igf1r disrupts neonatal cardiac regeneration. A Echocardiographic analysis at 1 dpi and 21 dpi of Igf1r KD or Renilla KD control (CTRL) mice with either experimentally induced MI by LAD ligation surgery (LAD) or SHAM surgery. B Percentages of left ventricular ejection fraction (LVEF) of the four different experimental groups assessed at 21 dpi. Each dot corresponds to one individual mouse. C Time course of LVEF at 1 dpi and 21 dpi of SHAM and LAD treated mice injected with different Igf1r KD (Igf1r.4971/Igf1r.3855/Igf1r.1934) hairpins compared to the Ren KD (Ren.713) control hairpin. N represents numbers of mice per group at 21 dpi. D Statistical analysis of LVEF of individual Igf1r KD hairpin LAD groups compared to the Ren.713 LAD group 21 dpi. E and F Assessment of left ventricular end diastolic volumes (LVEDV) and left ventricular end systolic volumes (LVESV) in the indicated cohorts at 21 dpi. G Representative diastolic and systolic echocardiographic images of hearts of the indicated groups. Upper row: Echocardiography at 1 dpi. Lower row: Echocardiography at 21 dpi. Systole/diastole of one beat is presented. Note the difference between 21 dpi Ren.713 LAD systole and Igf1r LAD systole. H Representative Masson’s trichrome stained histological sections of hearts harvested 21 dpi. Red depicts cardiomyocytes. Blue depicts collagen fibers. Black depicts nuclei. I Statistical analysis of left ventricular (LV) fibrosis in the respective groups. Each point in the graph represents one biological sample (heart). Per heart two sections per level (two levels, one at 1,000 µm and one at 1,500 µm) were stained and analyzed. Therefore, four different tissue sections were analyzed per heart and the average was then entered into the graph. J Representative wheat germ agglutinin (WGA) staining of hearts harvested 21 dpi. Green depicts cell membranes and fibrotic scar tissue labeled by WGA conjugated to Alexa Fluor™ 488. Blue depicts nuclei labeled with DAPI. Note the pronounced fibrosis in the Igf1r KD LAD section. K Analysis of cardiomyocyte cross sectional area (CSA). Regions in the middle of the free left-ventricular wall, below the site of LAD ligation/SHAM surgery were chosen, where cardiomyocytes are cut transversally to get representative results. The mean CSA of cardiomyocytes per heart was used for statistical analysis. Size is measured in pixels2. All graphs represent mean ± SD. Two-way ANOVA with Tukey’s multiple comparisons test was used for statistical analysis of panels B, E, F, I, K. One-way ANOVA with Dunnett’s correction for multiple comparisons was used for statistical analysis in panel D.

Physiologically systolic function decreases in mice within the first weeks of life21. Hence, cardiac function of both SHAM groups, irrespective of the shRNAmir treatment, decreased as expected throughout the experimental period. Mice that were subjected to the control Renilla shRNAmir rAAV and underwent LAD ligation with subsequent MI as evidenced 1 dpi by echocardiography, regained their systolic function to a level comparable to the SHAM cohorts (Fig. 3A,C and Suppl. Figure 1). In contrast, mice with reduced IGF1R levels could not recover the initial loss in LVEF after LAD ligation (Fig. 3A-G, Suppl. Figure 1), suggesting an impaired cardiac regenerative potential. Of note, in Igf1r KD mice, SHAM surgery (SHAM/KD) did not alter left ventricular function compared to SHAM mice with control rAAVs (SHAM/CTRL), indicating that the observed knockdown of Igf1r without induction of myocardial infarction does not have an obvious impact on cardiac function.

To further strengthen this observation and to exclude off-target effects, we applied the two additional Igf1r KD shRNAmirs using the same experimental set-up. We could indeed confirm the phenotype of reduced cardiac functional recovery in all three Igf1r KD cohorts subjected to LAD ligation (Fig. 3C,D and Suppl. Figure 1). In addition, adverse remodeling of the left ventricles was evidenced by significantly increased systolic and diastolic volumes in the Igf1r KD group subjected to MI (Fig. 3E-G).

Together, all three tested Igf1r KD cohorts showed reduced cardiac functional recovery, indicating that Igf1r KD by rAAVs impedes functional cardiac regeneration in neonatal mice.

In vivo knockdown of Igf1r promotes fibrotic scarring after neonatal myocardial infarction

We next analyzed the extent of fibrosis in mice that underwent neonatal myocardial infarction. At 21 dpi, using Masson-Trichrome, staining no gross changes were detected in the SHAM hearts regardless of the treatments. Neither the Ren SHAM control group nor the Igf1r KD SHAM group showed any histopathological signs of remodeling (Fig. 3H and I). In line with the functional recovery, we did not identify scarring in hearts that were subjected to control Ren shRNAmirs and underwent MI surgery, confirming our previous studies. However, mice that were treated with Igf1r KD rAAVs together with LAD ligation presented significantly enhanced fibrosis and scar tissue at the anterior wall at 21 dpi (Fig. 3H-J). No differences in heart weight were observed between the groups (Suppl. Figure 2C). To elucidate if hypertrophy plays a role in the recovery process, WGA stains were performed on 21 dpi sections and cardiomyocyte cross sectional area (CSA) was analyzed. Indeed, there was a slight but statistically significant increase in cardiomyocyte CSA in the Igf1r KD LAD group compared to the other groups. Taken together, the histological phenotype supports our functional findings and confirms the assumption that Igf1r is necessary for a complete neonatal heart regeneration after ischemic injury. The increased CSA of the remaining cardiomyocytes may be a compensatory mechanism for the loss of cardiomyocytes in the Igf1r LAD group, as demonstrated in adult animals and human patients48.

Phosphorylation of AKT and ERK are altered by Igf1r knockdown

IGF1R is a receptor that activates, among other pathways, the PI3K/AKT and ERK pathways to promote growth and proliferation28. To test the effect of Igf1r KD on the AKT and ERK pathways, we performed immunoblotting on heart protein lysates following LAD and SHAM surgery.

On P0 Igf1r KD or Ren KD viruses were injected intrathoracically into neonatal mice. LAD ligation or SHAM surgery were performed the following day (P1). Successful induction of MI was confirmed by echocardiography at P2 (corresponds to 1 dpi), and the left ventricles were harvested and prepared for immunoblotting at the indicated time points. Time course analysis revealed the most prominent effect of Igf1r KD on phosphorylation of AKT and ERK after 4 dpi (Supp. Figure 2A). Western blotting revealed that KD of Igf1r in combination with induction of MI significantly decreases phosphorylation of AKT and ERK compared to Ren KD controls 4 dpi (Fig. 4A). This confirmed that the cardiomyocyte specific reduction of IGF1R modifies the proliferative PI3K/AKT and ERK signaling following MI.

Fig. 4.

Fig. 4

IGF1R controls AKT and ERK phosphorylation and cardiomyocyte proliferation. A Representative Western blots and quantification of the IGF1R downstream AKT/Phospho-AKT and ERK/Phospho-ERK pathways. Igf1r (KD) and Renilla (CTRL) knockdown recombinant Adeno-associated viruses (rAAVs) were injected on postnatal (P) day 0 and left anterior descending artery (LAD) ligation surgery was performed on P1. Hearts were harvested 5 days after birth (i.e. 4 days post injury (dpi)). Bar graphs indicate mean relative signaling intensity ± SD. B Immunofluorescence images of hearts harvested at 4 dpi. rAAVs for induction of Igf1r KD or control (Ren.713) were injected on the 1st day of life (P0). Blue represents nuclear staining with DAPI. Green represents the proliferation marker phospho-Histone H3 (pHH3). Red represents cardiomyocytes labeled with an anti-troponin T antibody. Areas chosen for magnification are marked in the top row with a white square. The middle row equals the lower row without the red (troponin T) color channel. White triangles mark pHH3 positive nuclei of cardiomyocytes. Yellow triangles mark pHH3 positive nuclei of troponin T negative cells, i.e. non-cardiomyocytes. C Statistical analysis of pHH3 positive cardiomyocyte nuclei in the left ventricular free wall. All graphs represent mean ± SD. Unpaired two-tailed Student’s t-Tests were used for statistical analysis in panel A. Two-way ANOVA with Dunnett’s multiple comparisons test was used for statistical analysis of panel C.

Igf1r knockdown reduces karyokinesis

Finally, we tested the hypothesis that Igf1r KD and hence reduced AKT/ERK phosphorylation following a profound myocardial damage leads to reduced cardiomyocyte karyokinesis. To test this notion, we performed immunofluorescence staining using anti-phospho-Histone H3 (pHH3) and anti-troponin-T (cardiac isoform) antibodies counterstained with DAPI on tissue sections of 4 dpi hearts of all four interventional groups. pHH3 is a marker that is expressed exclusively during mitosis49,50, while troponin T is a striated muscle structural protein with a cardiac isoform used as marker for cardiomyocytes51. In Igf1r KD mice, pHH3 staining was markedly reduced in the left ventricular infarction zone compared to Renilla control mice (Fig. 4B and C). Of note, Igf1r KD hearts harvested at 4 dpi following LAD ligation displayed a loss of apical myocardial tissue compared to the control groups (Fig. 4B), while the initial infarct size should be the same between the Renilla control and Igf1r KD groups, as confirmed by echocardiography. This corroborates our previous findings in which we showed normal cardiac function of wild-type C57BL6/J mice after LAD ligation on the first day of life at 7 dpi21. Thus, cardiomyocyte-specific abrogation of Igf1r expression resulted in reduced cardiomyocyte nuclei mitosis following neonatal myocardial ischemia injury. However, as described in great detail in a review by Auchampach and colleagues, further experiments are needed to prove that KD of Igf1r alters cardiomyocyte proliferation52.

Discussion

Neonatal cardiac regeneration spurred a massive interest in the field of basic cardiovascular research in the last decades. Multiple mechanisms have been reported, such as changes in the coding and non-coding transcripts of neonatal cardiomyocytes22,53,54, maturation of the immune system21, effects of oxygen pressure55, modulation by the autonomous nervous system56, and changes in the extracellular matrix57. This multiplicity of mechanisms highlights that there does not exist a single master switch to regenerate the heart.

Our current study shows that hearts of neonatal mice, in which cardiomyocyte specific Igf1r KD was induced by infection with rAAVs delivering shRNAmir, loose their capacity to fully regenerate from MI compared to their respective controls. Importantly, neither the KD of Igf1r without induction of MI nor the Renilla control rAAVs alone had an impact on the postnatal development in the absence of MI. Neonatal cardiac regeneration occurs during the proliferative phase of neonatal mouse cardiomyocytes within the first week of life6,7. The loss of cardiac regeneration is paralleled by the withdrawal of cardiomyocytes from the cell cycle into G0 phase58,59. IGF1R is a key molecule for cardiomyocyte proliferation and survival60,61. Reduced IGF1R signaling goes hand in hand with decreased phosphorylation of AKT and ERK28,62, which in turn regulates cardiomyocyte proliferation60,63. In line with previous publications, our experimental data demonstrate that IGF1R is one factor contributing to neonatal heart regeneration. While we did not perform experiments to elucidate the influence of Igf1r KD on cardiomyocyte proliferation, our analysis of pHH3 staining suggests reduced mitosis in cardiomyocytes, potentially inhibiting cardiomyocyte proliferation. Further research in this direction is needed to confirm and expand the knowledge on the specific mechanisms.

This is further corroborated by the fact that expression of IGF1R is necessary for embryonic development of the heart since the cardiomyocyte specific loss of IGF1R causes intrauterine death (Supp. Figure 2B and29). Intramyocardial Igf1 overexpression is known to improve cardiac function in adult mice32. However, activation of the IGF1/IGF1R pathway is a double-edged sword. IGF1R overexpression seems to be beneficial during the first 6 months of life, but later this experimental condition results in an impaired left ventricular ejection fraction and a reduction of the lifespan62. Although these studies do not directly address neonatal cardiac regeneration, they further support a key role of IGF1R in heart physiology and cardiac disease, most likely depended on aging. Human observational data also hint at a positive correlation of IGF-1 plasma levels in acute MI patients64. The detailed spatial and temporal aspects of IGF-1 signaling in concert with other regeneration promoting factors require further studies and might be the key for therapeutic success.

Neonatal cardiac regeneration is a multi-layered process involving several compartments and factors. Even though we show the contribution of IGF1R to neonatal cardiomyocyte proliferation, we cannot exclude additional IGF1R dependent mechanisms in our experimental setting, e.g. fibroblast proliferation, fibrotic response, cell death. This needs to be addressed in future research projects.

A limitation of our study is that neonatal cardiac regeneration is yet untested in Igf1r knockout mice. This is owed to the fact that IGF1R signaling is required during embryonic development and its full body KO as well as cardiomyocyte specific KO using a Nkx2.5-Cre recombinase-based system is lethal in utero. However, our data clearly shows that Igf1r KD using rAAVs robustly induces KD of IGF1R specifically in the heart. By using the appropriate control groups, we excluded that the observed differences might be caused by the delivery of rAAVs. The virus-based platform reported here could therefore be readily used to test other candidate genes in the same experimental setting.

Conclusions

Here, we identify cardiomyocyte specific IGF1R signaling as an integral mechanism of the cardiac regeneration program in the murine neonatal myocardial infarction model. Together with previous reports, these results lay the groundwork for further efforts to develop an IGF-1/IGF1R-targeted therapeutic approach to advance adult heart regeneration.

Supplementary Information

Acknowledgements

We thank all lab members for their support and constructive discussion. Histological work up of samples was performed by the Histology Facility at Vienna BioCenter Core Facilities (VBCF), member of the Vienna BioCenter (VBC), Austria. We especially thank M. Grivej, J. Klughofer, T. Engelmaier, and A. Piszczek for histology services; I. Kozieradzki for technical support; T. Lendl for bioinformatics support.

Author contributions

T.S., T.D., and BJ.H. designed, executed, and analyzed most of the experiments, drafted the manuscript and the figures. E.B. and J.GN. performed the Western blots. E.B., F.F., A.Bi., and MT.D. performed cell culture experiments and rAAV production. T.H. and J.Z. designed and tested the shRNAmir system. E.H. performed the siRNA experiments in cultured murine neonatal cardiomyocytes. E.H., A.Ba., F.R., C.B., JM.P. designed, analyzed, and critically discussed the experiments. All authors edited and approved the manuscript.

Funding

This work was supported by the Austrian Science Fund (FWF, research grant ERA-CVD JTC2018 INNOVATION, I 4161-B, to B.J.H.), by the Austrian Society of Cardiology (to T.S. and T.D.), by the intramural funding program of the Medical University Innsbruck for young scientists (MUI-START, Project [2017-01-014], to B.J.H.), by the the Federal Ministry of Education and Research (BMBF, Germany, research grant ERA-CVD JTC2018 INNOVATION, 01KL1903, to C.B.) and Medizinischer Forschungsfonds Tirol (MFF, to B.J.H.). The lab of J.M.P. received funding from the Austrian Academy of Sciences, the Medical University of Vienna, the T. von Zastrow foundation, the Canada 150 Research Chairs Program F18-01336 and the Leducq Foundation with the Transatlantic Network of Excellence grant “ReVAMP — Recalibrating Mechanotransduction in Vascular Malformations “ (21CVD03). The J.M.P lab also gratefully acknowledges funding by the German Federal Ministry of Education and Research (BMBF) under the project "Microbial Stargazing—Erforschung von Resilienzmechanismen von Mikroben und Menschen" (Ref. 01KX2324).

Data availability

Data are available from the corresponding authors upon reasonable request.

Declaration

Competing interests

FR has not received personal payments by pharmaceutical companies or device manufacturers in the last 3 years (remuneration for the time spent in activities, such as participation as steering committee member of clinical trials and member of the Pfizer Research Award selection committee in Switzerland, were made directly to the University of Zurich). The Department of Cardiology (University Hospital of Zurich/University of Zurich) reports research-, educational- and/or travel grants from Abbott, Abiomed, Alnylam, Amarin, Amgen, Astra Zeneca, At the Limits Ltd., Bayer, Biotronik, BMS, Boehringer Ingelheim, Boston Scientific, Bracco, CM Microport, Concept Medical, CTI, Daiichi Sankyo, Edwards Lifesciences, FomF GmbH, Hamilton Health Sciences, IHF, Innosuisse, IumiraDX, Kantar, LabPoint, MedAlliance, Medcon International, Medical Education Global Solutions, Medtronic, MicroPort, Monocle, Novartis, Novo Nordisk, OM Pharma, Pfizer, Quintiles Switzerland Sarl, RecorMedical, Roche Diagnostics, Roche Pharma, Sahajanand IN, Sanofi, Sarstedt AG, Servier, Terumo Deutschland, Trama Solutions, V-Wave, Vifor, ZOLL. These grants do not impact on Prof. Ruschitzka’s personal remuneration.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Thomas Schuetz and Theresa Dolejsi are the first authors and contributed equally.

Contributor Information

Josef Martin Penninger, Email: josef.penninger@helmholtz-hzi.de.

Bernhard Johannes Haubner, Email: bernhard.haubner@usz.ch.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-72783-4.

References

  • 1.Townsend, N. et al. Cardiovascular disease in Europe: Epidemiological update 2016. Eur. Heart J.37, 3232–3245 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Vedin, O. et al. Significance of ischemic heart disease in patients with heart failure and preserved, midrange, and reduced ejection fraction. Circ. Heart Fail.10, e003875 (2018). [DOI] [PubMed] [Google Scholar]
  • 3.James, S. L. et al. Global, regional, and national incidence, prevalence, and years lived with disability for 354 diseases and injuries for 195 countries and territories, 1990–2017: A systematic analysis for the global burden of disease study 2017. Lancet392, 1789–1858 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.McDonagh, T. A. et al. esc guidelines for the diagnosis and treatment of acute and chronic heart failure developed by the task force for the diagnosis and treatment of acute and chronic heart failure of the European society of cardiology (esc) with the special contribution of the heart failure association (hfa) of the esc. Eur. Heart J.42, ehab368 (2021). [DOI] [PubMed] [Google Scholar]
  • 5.Bergmann, O. et al. Evidence for cardiomyocyte renewal in humans. Science324, 98–102 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Porrello, E. R. et al. Transient regenerative potential of the neonatal mouse heart. Science331, 1078–1080 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Haubner, B. J. et al. Complete cardiac regeneration in a mouse model of myocardial infarction. Aging Albany Ny4, 966–977 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Oberpriller, J. O. & Oberpriller, J. C. Response of the adult newt ventricle to injury. J. Exp. Zool.187, 249–259 (1974). [DOI] [PubMed] [Google Scholar]
  • 9.Poss, K. D., Wilson, L. G. & Keating, M. T. Heart regeneration in zebrafish. Science298, 2188–2190 (2002). [DOI] [PubMed] [Google Scholar]
  • 10.Costa, A. et al. Neonatal injury models: Integral tools to decipher the molecular basis of cardiac regeneration. Basic Res. Cardiol.117, 26 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Haubner, B. J., Schuetz, T. & Penninger, J. M. A reproducible protocol for neonatal ischemic injury and cardiac regeneration in neonatal mice. Basic Res. Cardiol.111, 1–10 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ye, L. et al. Early regenerative capacity in the porcine heart. Circulation138, 2798–2808 (2018). [DOI] [PubMed] [Google Scholar]
  • 13.Nishiyama, C. et al. Prolonged myocardial regenerative capacity in neonatal opossum. Circulation146, 125–139 (2021). [DOI] [PubMed] [Google Scholar]
  • 14.Haubner, B. J. et al. Functional recovery of a human neonatal heart after severe myocardial infarction. Circ. Res.118, 216–221 (2015). [DOI] [PubMed] [Google Scholar]
  • 15.Darehzereshki, A. et al. Differential regenerative capacity of neonatal mouse hearts after cryoinjury. Dev. Biol.399, 1–9 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Polizzotti, B. D. et al. Neuregulin stimulation of cardiomyocyte regeneration in mice and human myocardium reveals a therapeutic window. Sci. Transl. Med.7, 281ra45 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Polizzotti, B. D., Ganapathy, B., Haubner, B. J., Penninger, J. M. & Kühn, B. A cryoinjury model in neonatal mice for cardiac translational and regeneration research. Nat. Protoc.11, 542–552 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Konfino, T., Landa, N., Ben-Mordechai, T. & Leor, J. The type of injury dictates the mode of repair in neonatal and adult heart. J. Am. Heart Assoc.4, e001320–e001320 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ferrini, A., Stevens, M. M., Sattler, S. & Rosenthal, N. Toward regeneration of the heart: bioengineering strategies for immunomodulation. Front. Cardiovasc. Med.6, 1–19 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Doppler, S. A. et al. Mammalian heart regeneration: the race to the finish line. Circ. Res.120, 630–632 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Dolejsi, T. et al. Adult t-cells impair neonatal cardiac regeneration. Eur. Hear. J.43, 2698–2709 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Adamowicz, M. et al. Functionally conserved noncoding regulators of cardiomyocyte proliferation and regeneration in mouse and human. Circ. Genom. Precis. Med.11, H2183 (2018). [DOI] [PubMed] [Google Scholar]
  • 23.Adams, T. E., Epa, V. C., Garrett, T. P. & Ward, C. W. Structure and function of the type 1 insulin-like growth factor receptor. Cell. Mol. Life Sci.57, 1050–1093 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Haubner, B. J. et al. PI3Kgamma protects from myocardial ischemia and reperfusion injury through a kinase-independent pathway. PLoS ONE5, e9350 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kim, J. et al. Insulin-like growth factor i receptor signaling is required for exercise-induced cardiac hypertrophy. Mol. Endocrinol.22, 2531–2543 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Foncea, R. et al. Extracellular regulated kinase, but not protein kinase c, is an antiapoptotic signal of insulin-like growth factor-1 on cultured cardiac myocytes. Biochem. Biophys. Res. Commun.273, 736–744 (2000). [DOI] [PubMed] [Google Scholar]
  • 27.Li, P. et al. IGF signaling directs ventricular cardiomyocyte proliferation during embryonic heart development. Development138, 1795–1805 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Troncoso, R., Ibarra, C., Vicencio, J. M., Jaimovich, E. & Lavandero, S. New insights into igf-1 signaling in the heart. Trends Endocrinol. Metab.25, 128–137 (2014). [DOI] [PubMed] [Google Scholar]
  • 29.Wang, K. et al. Differential roles of insulin like growth factor 1 receptor and insulin receptor during embryonic heart development. BMC Dev. Biol.19, 1–8 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shen, H. et al. Mononuclear diploid cardiomyocytes support neonatal mouse heart regeneration in response to paracrine igf2 signaling. Elife9, 169–224 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tonkin, J. et al. Monocyte/macrophage-derived igf-1 orchestrates murine skeletal muscle regeneration and modulates autocrine polarization. Mol. Ther.23, 1189–1200 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Santini, M. P. et al. Enhancing repair of the mammalian heart. Circ. Res.100, 1732–1740 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Fellmann, C. et al. An optimized microrna backbone for effective single-copy rnai. Cell. Reports5, 1704–1713 (2013). [DOI] [PubMed] [Google Scholar]
  • 34.Zuber, J. et al. An integrated approach to dissecting oncogene addiction implicates a myb-coordinated self-renewal program as essential for leukemia maintenance. Genes Dev.25, 1628–1640 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zuber, J. et al. Toolkit for evaluating genes required for proliferation and survival using tetracycline-regulated rnai. Nat. Biotechnol.29, 79–83 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Jiang, J., Wakimoto, H., Seidman, J. G. & Seidman, C. E. Allele-specific silencing of mutant myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science342, 111–114 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Prasad, K. M., Yang, Z., Bleich, D. & Nadler, J. L. Adeno-associated virus vector mediated gene transfer to pancreatic beta cells. Gene Ther.7, 1553–1561 (2000). [DOI] [PubMed] [Google Scholar]
  • 38.Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods9, 676–682 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Schmittgen, T. D. & Livak, K. J. Analyzing real-time pcr data by the comparative ct method. Nat. Protoc.3, 1101–1108 (2008). [DOI] [PubMed] [Google Scholar]
  • 40.Stirling, D. R. et al. Cell Profiler 4: Improvements in speed, utility and usability. BMC Bioinform.22, 433 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ward, A. O., Janbandhu, V., Chapman, G., Dunwoodie, S. L. & Harvey, R. P. An image analysis protocol using cellprofiler for automated quantification of post-ischemic cardiac parameters. STAR Protoc.3, 101097 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Liu, J. P., Baker, J., Perkins, A. S., Robertson, E. J. & Efstratiadis, A. Mice carrying null mutations of the genes encoding insulin-like growth factor i (igf-1) and type 1 igf receptor (igf1r). Cell75, 59–72 (1993). [PubMed] [Google Scholar]
  • 43.Premsrirut, P. K. et al. A rapid and scalable system for studying gene function in mice using conditional rna interference. Cell145, 145–158 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Inagaki, K. et al. Robust systemic transduction with aav9 vectors in mice: efficient global cardiac gene transfer superior to that of aav8. Mol. Ther.14, 45–53 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pacak, C. A. et al. Recombinant adeno-associated virus serotype 9 leads to preferential cardiac transduction in vivo. Circ. Res.99, e3–e9 (2006). [DOI] [PubMed] [Google Scholar]
  • 46.Zhou, P. & Pu, W. T. Recounting cardiac cellular composition. Circ. Res.118, 368–370 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Wang, H., Leinwand, L. A. & Anseth, K. S. Cardiac valve cells and their microenvironment—insights from in vitro studies. Nat. Rev. Cardiol.11, 715–727 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Frey, N. & Olson, E. N. Cardiac hypertrophy: the good, the bad, and the ugly. Annu. Rev. Physiol.65, 45–79 (2003). [DOI] [PubMed] [Google Scholar]
  • 49.Gurley, L. R., D’Anna, J. A., Barham, S. S., Deaven, L. L. & Tobey, R. A. Histone phosphorylation and chromatin structure during mitosis in chinese hamster cells. Eur. J. Biochem.84, 1–15 (1978). [DOI] [PubMed] [Google Scholar]
  • 50.Wei, Y., Mizzen, C. A., Cook, R. G., Gorovsky, M. A. & Allis, C. D. Phosphorylation of histone h3 at serine 10 is correlated with chromosome condensation during mitosis and meiosis in tetrahymena. Proc. Natl. Acad. Sci.95, 7480–7484 (1998). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Rottbauer, W. et al. Troponin t: a diagnostic marker for myocardial infarction and minor cardiac cell damage. Eur. Hear. J.17, 3–8 (1996). [DOI] [PubMed] [Google Scholar]
  • 52.Auchampach, J. et al. Measuring cardiomyocyte cell-cycle activity and proliferation in the age of heart regeneration. Am. J. Physiol.-Hear. Circ. Physiol.322, H579–H596 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Huang, W. et al. Loss of microrna-128 promotes cardiomyocyte proliferation and heart regeneration. Nat. Commun.9, 1–16 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Yang, Y. et al. MicroRNA-34a plays a key role in cardiac repair and regeneration following myocardial infarction. Circ. Res.117, 450–459 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Nakada, Y. et al. Hypoxia induces heart regeneration in adult mice. Nature541, 222–227 (2017). [DOI] [PubMed] [Google Scholar]
  • 56.White, I. A., Gordon, J., Balkan, W. & Hare, J. M. Sympathetic reinnervation is required for mammalian cardiac regeneration. Circ. Res.117, 990–994 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Notari, M. et al. The local microenvironment limits the regenerative potential of the mouse neonatal heart. Sci. Adv.4, eaao5553 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Soonpaa, M. H., Kim, K. K., Pajak, L., Franklin, M. & Field, L. J. Cardiomyocyte dna synthesis and binucleation during murine development. Am. J. Physiol.-Hear. Circ. Physiol.271, H2183–H2189 (1996). [DOI] [PubMed] [Google Scholar]
  • 59.Li, F., Wang, X., Capasso, J. M. & Gerdes, A. M. Rapid transition of cardiac myocytes from hyperplasia to hypertrophy during postnatal development. J. Mol. Cell. Cardiol.28, 1737–1746 (1996). [DOI] [PubMed] [Google Scholar]
  • 60.Xin, M. et al. Regulation of insulin-like growth factor signaling by yap governs cardiomyocyte proliferation and embryonic heart size. Sci. Signal.4, ra70 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Elmadani, M. et al. Novel screening method identifies pi3kα, mtor, and igf1r as key kinases regulating cardiomyocyte survival. J. Am. Heart Assoc.8, H1698–H1751 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Abdellatif, M. et al. Fine-tuning cardiac insulin/insulin-like growth factor 1 receptor signaling to promote health and longevity. Circulation10.1161/CIRCULATIONAHA.122.059863 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Lin, Z. et al. Pi3kcb links hippo-yap and pi3k-akt signaling pathways to promote cardiomyocyte proliferation and survival. Circ. Res.116, 35–45 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Bourron, O. et al. Impact of age-adjusted insulin-like growth factor 1 on major cardiovascular events after acute myocardial infarction: results from the fast-mi registry. J. Clin. Endocrinol. Metab.100, 1879–1886 (2015). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Data are available from the corresponding authors upon reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES