Skip to main content
Cellular and Molecular Neurobiology logoLink to Cellular and Molecular Neurobiology
. 2020 Jul 3;41(7):1483–1496. doi: 10.1007/s10571-020-00911-5

Regulation of PGE2 Pathway During Cerebral Ischemia Reperfusion Injury in Rat

Yunfei Xu 1,2,#, Ying Liu 1,2,✉,#, Kexin Li 1,2, Shuying Miao 4, Caihong Lv 1,2, Chunjiang Wang 1,2, Jie Zhao 3,✉
PMCID: PMC11448554  PMID: 32621176

Abstract

Stroke is an acute central nervous system disease with high morbidity and mortality rate. Cerebral ischemia reperfusion (I/R) injury is easily induced during the development or treatment of stroke and subsequently leads to more serious brain damage. Prostaglandin E2 (PGE2) is one of the most important inflammatory mediators in the brain and contributes to both physiological and pathophysiological functions. It may be upregulated and subsequently plays a key role in cerebral ischemia reperfusion injury. The synthesis and degradation of PGE2 is an extremely complex process, with multiple key stages and molecules. However, there are few comprehensive and systematic studies conducted to investigate the synthesis and degradation of PGE2 during cerebral I/R injury, which is what we want to demonstrate. In this study, qRT-PCR and immunoblotting demonstrated that the key enzymes in PGE2 synthesis, including COX-1, COX-2, mPGES-1 and mPGES-2, were upregulated during cerebral I/R injury, but 15-PGDH, the main PGE2 degradation enzyme, was downregulated. In addition, two of PGE2 receptors, EP3 and EP4, were also increased. Meanwhile, immunohistochemistry demonstrated the localization of these molecules in ischemic areas, including cortex, striatum and hippocampus, and reflected their expression patterns in different regions. Combining the results of PCR, Western blotting and immunohistochemistry, we can determine where the increase or decrease of these molecules occurs. Overall, these results further indicate a possible pathway that mediates enhanced production of PGE2, and thus that may impact production of inflammatory cytokines including IL-1β and TNF-α during cerebral I/R injury.

Keywords: Cerebral ischemia reperfusion injury, Inflammation, Prostaglandin E2, COX, PGES, 15-PGDH, EP

Introduction

Stroke is one of the most common neurological diseases. It is the second leading cause of death and a major cause of disability worldwide (Feigin et al. 2017). In stroke, the incidence of ischemic stroke is higher. At present, the most important treatment for ischemic stroke is thrombolysis to restore the supply of cerebral blood flow as soon as possible (Hankey 2017). However, thrombolysis is likely to cause more serious, possibly irreversible brain damage such as cerebral ischemia reperfusion (I/R) injury (Eltzschig and Eckle 2011). The pathological process of cerebral I/R injury is complex and not fully clear yet.

Prostaglandin E2 (PGE2) is a physiologically active lipid compound synthesized from arachidonic acid, which is widely distributed in various tissues and body fluids. Specifically, it is one of the most abundant prostaglandins in the brain and contributes to physiological and pathophysiological neurological processes. The most important role of PGE2 is as a key inflammation mediator (Basbaum et al. 2009). It could be induced in quantity in a short time during inflammation, and subsequently amplify inflammatory processes through binding to its receptors. In the later phase of cerebral I/R injury, inflammation is a major factor in the progression of neuronal damage (Anrather and Iadecola 2016). Meanwhile, PGE2 in the brain increased after cerebral I/R injury (Ikeda-Matsuo et al. 2006). Its increase may be explained by its synthesis and degradation process.

The biosynthesis and degradation of PGE2 is a complex cascade involving multiple stages and several key enzymes. First, after physiological or pathological stimuli, phospholipase A2 promotes the cleavage of phospholipids into arachidonic acid (AA), which is in turn secreted from cells. Next, through the catalysis by prostaglandin H synthase, also known as cyclooxygenase, including COX-1 and COX-2, AA is manufactured into PGG2 and PGH2 successively. Then the different forms of prostaglandins are produced under the catalysis of different types of prostaglandin synthases (Cha et al. 2006). Specifically, PGH2 is isomerized into PGE2 by the PGE2 synthases, including cPGES, mPGES-1 and mPGES-2. Finally, PGE2 performs different functions by binding to different receptors (EP1, EP2, EP3 and EP4) (Sugimoto and Narumiya 2007; Legler et al. 2010). Furthermore, the degradation of PGE2 is regulated by a key enzyme, 15-PG dehydrogenase (15-PGDH), which could work together with PGE2 synthase to regulate the overall systemic PGE2 levels (Tai et al. 2006, 2002). These molecules play important roles in the synthesis, degradation and function of PGE2.

In the processes of synthesis, degradation and function of PGE2, different molecules own distinct characteristics and functions. Cyclooxygenases (COX-1 and COX-2) catalyze the first stage of the synthesis process. COX-1 is a structural enzyme, which could promote the synthesis of physiological PGs (Radi and Khan 2006). COX-2 is an inducible enzyme, which can be induced by stimulants such as pro-inflammatory factors, endotoxins and oncogenes, leading to the increase in synthesis of PGs (Kang et al. 2007). The next stage is catalyzed by PGE2 synthases including cPGES, mPGES-1 and mPGES-2. cPGES is a structural enzyme, which is mainly involved in the transient response of PGE2. It can work together with COX-1 to maintain the stability of the intracellular environment (Tanioka et al. 2000). mPGES-1 is an inducible enzyme which is involved in delayed PGE2 production. Meanwhile, mPGES-2 is expressed in several tissues with relatively low level. Interestingly, it is highly expressed in brain (Tanikawa et al. 2002). After PGE2 synthesis, its function depends on binding to four receptors. EP2 is rare in the brain, while EP1, EP3, EP4 are relatively abundant in the brain. Notably EP3 is important in mediating inflammatory responses (Kumazawa et al. 1993). Besides, there is another key molecule, 15-PGDH, which is the key enzyme in the degradation phase of PGE2, responsible for the conversion of pro-proliferative PGE2 to its oxidized form.

As far, there are few comprehensive and systematic studies conducted on the above processes after cerebral I/R injury. In our study, we describe the building of a cerebral I/R animal model, from which we extracted the tissue from ischemia regions and detected the expression of all the molecules involved in the process of PGE2 synthesis and degradation. We systematically illustrate the changes in PGE2 production after cerebral I/R injury and predict the inflammatory responses. Thus, we hope to provide novel clinical treatment ideas for cerebral I/R injury.

Materials and Methods

Experimental Animals

150 male SD rats at 8 weeks of age, 250-300 g, were purchased from the Experimental Animal Center of Central South University (Changsha, China), and were all housed in a 25 °C 40–60% humidity-controlled facility on a 12 h light/dark cycle and were given free access to food and water. Then these rats were divided into four groups: 30 rats into the sham group, 30 rats into the 12 h group, 45 rats into the 24 h group and 45 rats into the 48 h group. At the beginning, we set up different sham groups, but we found that there was little difference between the different sham groups. Therefore, in order to save the experimental cost, we set only one sham group in the following experiment. All the animals were assigned randomly to these groups through a lottery drawing box. All assessments were performed by investigators who were blinded to experimental group assignments. All animal experimental protocols were approved by the institutional ethics committee for animal experiments of Central South University.

Establishment of an Animal Model of Middle Cerebral Artery Occlusion Reperfusion

A model of focal middle cerebral artery occlusion/reperfusion (MCAO/R) was used. Rats were anesthetized with a dose of 3.5 ml/kg 10% chloral hydrate. The right common carotid artery, internal carotid artery and external carotid artery were fixed and separated, and then the common carotid artery and external carotid artery were ligated. Next a small incision was made near the bifurcation on the common carotid artery and a special nylon monofilament was inserted. The head of the monofilament head was 0.38 ± 0.02 mm in diameter because its head has been coated with poly-l-lysine (2838A4, Beijing Contech CO. LTD). When the nylon monofilament had entered about 20 mm into the bifurcation and there was obvious resistance during insertion, indicating that the front end of the nylon monofilament was just at the opening of the middle cerebral artery, and could block the blood supply of the middle cerebral artery, the continuous insertion was stopped, the nylon monofilament was fixed and the wound was sutured. At this point, the ischemia operation was completed. After 2 h, the nylon monofilament was pulled out and the reperfusion operation was completed. The rats were divided according to their reperfusion times into the three surgery groups, 12 h, 24 h and 48 h, and brain tissue was removed at the corresponding time points. In addition, for the sham group, it was only necessary to separate the common carotid artery, external carotid artery and internal carotid artery, and then ligate them before finally removing the brain tissue after 14 h.

Measurement of Infarct Volume

Brain tissues were removed and frozen at − 20℃ for 20 min before they were divided into five to six sections 2 mm thick and stained with 2% 2,3,5-triphenyl tetrazolium chloride (TTC, D025, Jiancheng Biotech, China). Infarcted brain tissue appeared white, while normal tissue was stained red. The infarct region and the whole brain region were determined with Image J software, whereby the average area of each section was multiplied by the thickness of 2 mm and the volumes of all sections were then added up. Finally, the results were presented as (infarct volume/whole brain volume) × 100%.

Measurement of Brain Water Content

Dry and wet weight methods were used. The olfactory bulb, cerebellum and low brain stem were removed and weighed immediately after decapitation to give the wet weight. Next the brain tissues were placed in 110℃ over for 24 h, and then quickly weighed to give the dry weight of the brain tissue. The brain water content was calculated using the given formula: (%) = (wet weight — dry weight)/wet weight × 100%.

Measurement of PGE2, IL-1β and TNF-α

The PGE2, IL-1β and TNF-α were detected using a Rat Prostaglandin E2, PG-E2 ELISA Kit (CSB-E07967r, Cusabio Life Science), a Rat Interleukin 1β (IL-1β) ELISA Kit (CSB-E08055r, Cusabio Life Science) and a Rat TNF-α ELISA Kit (CSB-E11987r, Cusabio Life Science), respectively. The middlemost 4 mm of the ipsilateral hemisphere was chosen to be detected (Ashwal et al. 1998). This brain region is the core area of ischemia in the MCAO model, which includes cortex, striatum and hippocampus. 100 mg tissue was rinsed with PBS, homogenized in 1 ml PBS and stored overnight at −20 °C. After that, two freeze–thaw cycles were performed to break the cell membranes and the supernatant was removed after centrifugating for 5 min at 5000 g, 2–8 °C. For PGE2, 50 μl of Standard or Sample was added per well, and 50 μl of HRP-conjugate was added to each well (but not to the Blank well) before 50 μl of antibody was added. The plate was mixed well and then incubated for 1 h at 37 °C. Each well was washed by filling with Wash Buffer (200 μl) three times. Next, 50 μl of Substrate A and 50 μl of Substrate B were added to each well and plates were incubated for 15 min at 37 °C. Finally, 50 μl of Stop Solution was added to each well. For IL-1β and TNF-α, 100 μl of Standard or Sample was added per well and the plate was mixed well and then incubated for 2 h at 37 °C. Remove the liquid of each well and add 100ul of Biotin-antibody, and then incubate for 1 h at 37 °C. Then after washing three times, add 100ul of HRP-avidin to each well and incubate for 1 h at 37 °C. Next wash five times and add 90ul of TMB Substrate and incubate for 15–30 min at 37 °C protected from light. Finally, add 50ul of Stop Solution to each well. OD was read using a microplate reader set to 450 nm and the professional soft “Curve Expert” was used to interpret the data.

Western Blotting

The middlemost 4 mm of the ipsilateral hemisphere was chosen for Western blotting. This brain region is the core area of ischemia in the MCAO model, which includes cortex, striatum and hippocampus. The total protein of brain tissues was extracted using radio immunoprecipitation assay (RIPA) lysis buffer containing a protease inhibitor cocktail (WB‑0071, Beijing Dingguo Changsheng Biotechnology Co. Ltd, Beijing, China). Next, the protein amount of extracted brain tissues was quantified using a bicinchoninic acid kit (A045-1, Beijing Dingguo Changsheng Biotechnology Co. Ltd, Beijing, China). Equal amounts of protein from each sample (80–100 μg per lane) were, respectively, mixed with SDS sample buffer, and then, the mixtures were heated to 95℃ for 10 min to expose epitopes and then subjected to electrophoresis on an SDS‑PAGE gel. Next, the proteins were transferred to a polyvinylidene fluoride membrane (EMD Millipore, Billerica, MA, USA). Following blocking in 5% non-fat dried milk in TBS with Tween 20 (DH358-4, Beijing Dingguo Changsheng Biotechnology Co. Ltd, Beijing, China) for 2 h at room temperature, membranes were, respectively, incubated with primary antibodies against β‑actin (A1978, 1:5,000 dilution, Sigma‑Aldrich; Merck KGaA, Darmstadt, Germany), COX-1 (160,109, 1:100 dilution; Cayman Chemical Company; Ann Arbor, Michigan, USA), COX-2 (160,106, 1:200 dilution; Cayman Chemical Company; Ann Arbor, Michigan, USA), cPGES (160,150, 1:200 dilution; Cayman Chemical Company; Ann Arbor, Michigan, USA), mPGES-1 (160,140, 1:50 dilution; Cayman Chemical Company; Ann Arbor, Michigan, USA), mPGES-2 (160,145, 1:200 dilution; Cayman Chemical Company; Ann Arbor, Michigan, USA), 15-PGDH (160,615, 1:200 dilution; Cayman Chemical Company; Ann Arbor, Michigan, USA) and EP3 (160,760, 1:200 dilution; Cayman Chemical Company; Ann Arbor, Michigan, USA) at 4℃ overnight. After washing three times for ten minutes each time, the membranes were subsequently incubated with the HRP‑conjugated goat anti‑rabbit IgG (BA1054, 1:5,000, Boster Biological Technology, Pleasanton, CA, USA) or goat anti‑mouse IgG antibody (BA1050, 1:5,000, Boster Biological Technology) for 2 h at room temperature. Finally, the bands were determined using the enhanced chemiluminescence method (170‑5061, Bio‑Rad Laboratories, Inc., Hercules, CA, USA). In the end, the levels of proteins were quantitatively analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA) and normalized to the β‑actin band density.

Immunohistochemistry

Immunohistochemistry was performed using Envision (TM) FLEX Mini Kit. All steps were performed according to the manufacturer’s protocol (K8024, Dako; Agilent Technologies, Inc, Santa Clara, CA, USA). In simple terms, slides were deparaffinized and hydrated in xylene and a graded series of alcohol. Heat‑induced antigen retrieval was performed and endogenous peroxidase activity was blocked using a peroxidase‑blocking reagent (K8024‑DM821). Sequentially, the slides were incubated with primary antibodies, HRP‑conjugated secondary antibody (K8024‑DM822), diaminobenzidine and hematoxylin for 30 s at room temperature. All primary antibodies were purchased from Cayman Chemical Company (Ann Arbor, Michigan, USA), including COX-1 (160,109, 1:50 dilution), COX-2 (160,106, 1:50 dilution), cPGES (160,150, 1:20 dilution), mPGES-1 (160,140, 1:50 dilution), mPGES-2 (160,145, 1:20 dilution), 15-PGDH (160,615, 1:50 dilution), EP3 (160,760, 1:20 dilution) and EP4 (160,775, 1:20 dilution). Finally, the slides were analyzed using an optical microscope (Olympus Corporation, Tokyo, Japan). The images of immunostaining were taken from the core region and peri-infarct region. Each group contained three sections at least.

Reverse‑Transcription‑Quantitative Polymerase Chain Reaction (RT‑qPCR) Analysis

The middlemost 4 mm of the ipsilateral hemisphere was chosen for PCR. This brain region is the core area of ischemia in the MCAO model, which includes cortex, striatum and hippocampus. The isolation of total RNA and the production of cDNA were performed as previously described (Liu et al. 2014). qPCR was performed using a 7500 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc, Waltham, MA, USA) with a Two-Step SYBR® Prime Script™ RT‑qPCR kit (Takara Bio, Inc, Otsu, Japan). The amplification was 95 ˚C for 30 s to pre-denaturation, and then performed over 40 cycles with conditions of 95 ˚C for 5 s and 60 ˚C for 34 s. The relative quantitation of mRNA was analyzed using the 2‑ΔΔCq method (Livak and Schmittgen 2001) and normalized by β‑actin. The primer sequences used were presented as follows (see Table 1). All melt curves have been checked to confirm the specificity of these primers.

Table 1.

The sequences of primers

Primers Species Forward (5′–3′) Reverse (5′–3′)
β-actin Rat TGTCACCAACTGGGACGATA GGGGTGTTGAAGGTCTCAAA
COX-1 Rat GGGTCTGATGCTCTTCTCCA GCTGCAGGAAATAGCCACTC
COX-2 Rat TTCCTTGGGTGCCTTTATGC AGCACTTTCGATGGGAGACA
cPGES Rat GAGAATCCGGCCAATCCTG ATCCTCATCACCACCCATGT
mPGES-1 Rat TGTCATCACAGGCCAAGTCA AACCAAGGAAGAGGAAGGGG
mPGES-2 Rat AATGATCAGGGCAAGGAGGT GGGAGAGATGAGATGCACCA
15-PGDH Rat AATGGAGGTGAAGGTGGCAT CAGTCTCACACCGCTTTTCA
EP3 Rat TGACCATGACAGTGTTCGGA GCACAGACAGCCACACAC
EP4 Rat CGCCTACTTCTACAGCCACT ATGTAAGAGAAGGCGGCGTA

Statistical Analysis

All the experiments were repeated at least three times. The quantitative data confirmed the normality and homoscedasticity previously, and then presented as the mean ± standard deviation and analyzed using analysis of variance (ANOVA) statistical followed by a post hoc t test. Statistical analysis was performed using GraphPad Prism 8 software (GraphPad Software, Inc., La Jolla, CA, USA). Finally, P < 0.05 was considered to indicate a statistically significant difference.

Results

The Brain Infarct Volume, Brain Water Content and PGE2Content after Cerebral I/R Injury

In order to verify the establishment of a successful cerebral ischemia reperfusion animal model, the cerebral infarction volumes and the brain water contents were measured. As shown in Fig. 1a, b, no infarction occurred in the sham group, while infarction clearly occurred at 12 h, 24 h and 48 h after cerebral ischemia reperfusion injury. Meanwhile, the brain water contents of the MCAO/R groups were obviously higher compared with the sham group (Fig. 1c), indicating the presence of brain edema. Together, these results suggest that our MCAO/R model is stable and successful.

Fig. 1.

Fig. 1

Brain infarct volume, brain water content and PGE2 content after cerebral I/R injury. a Representative images of triphenyl tetrazolium chloride staining (TTC) for the brain tissues of sham group and three surgery groups are presented. b Quantitated data from infarct volume of sham group and surgery groups. c Cerebral tissue water content after cerebral ischemia reperfusion injury compared with sham group. d The content of PGE2 in the brain tissue at various points after ischemia was measured by using an enzyme immunoassay kit. n = 6 animals per group. *P < 0.05 VS. sham group

After ensuring that a reliable animal model was established, we first detected the PGE2 content in ischemia brain tissue region. To do this, we extracted the brain tissue in the ischemia area, and then detect the PGE2 content (Fig. 1d). We found that there was no significant change in the content of PGE2 after the initial 12 h when compared to the sham group, but this was followed by a significant increase at 24 h, which was then restored to a level like the sham group at 48 h. In other words, the increase of PGE2 levels is a process with a relatively short duration and a relatively fast reaction time. However, it is not clear how PGE2 content increases after cerebral ischemia reperfusion injury, and this is what this paper will focus on.

COX-1 and COX-2 Increase After Cerebral Ischemia Reperfusion Injury

COX-1 and COX-2 are key enzymes in the initial stage of prostaglandin synthesis. COX-1 is constitutively expressed in brain tissue and plays a major role in the synthesis of prostaglandin under normal conditions. Meanwhile, COX-2 is rare in normal brain tissues but plays a key role after various stimuli. In order to detect the expressions of COX-1 and COX-2 after cerebral ischemia reperfusion injury, we used RT-PCR and Western blotting to detect the mRNA level and protein level, respectively. In addition, immunohistochemistry was used to detect their localization in the ischemia regions.

As shown in Fig. 2a, the mRNA level of COX-1 increased slightly after cerebral ischemia reperfusion injury. Meanwhile, no significant changes were detected in its protein levels (Fig. 2b). These results confirmed the constitutive expression of COX-1, with no obvious changes occurring after external stimulation.

Fig. 2.

Fig. 2

Brain COX-1 and COX-2 increase after cerebral I/R injury. a Ischemia brain tissue COX-1 mRNA expression was detected at various time points by reverse transcription-quantitative polymerase chain reaction analysis. b COX-1 protein expression was detected in the brain tissues at various time points by Western blotting. c Ischemia brain tissue COX-2 mRNA expression was detected at various time points by reverse transcription-quantitative polymerase chain reaction analysis. d COX-2 protein expression was detected in the brain tissues at various time points by Western blotting. e Densitometric analysis of COX-2 expression. f The localization of COX-1 protein in the ischemia regions of rat was measured by immunostaining at various time points (magnification, × 200 and × 400). Protein was detected in some cells (arrow). g The localization of COX-2 protein in the ischemia regions of rat was measured by immunostaining at various time points (magnification, × 200 and × 400). Protein was detected in some cells (arrow). n = 3 animals per group. Data are presented as the mean ± standard deviation. *P < 0.05 VS. sham group

COX-2 is another cyclooxygenase. However, its alterations are quite different from those of COX-1 after cerebral I/R injury. Its mRNA level increased continuously at 12 h, 24 h and 48 h after cerebral ischemia reperfusion as shown in Fig. 2c. At the same time, its protein level was also significantly increased (Fig. 2d, e).

In the MCAO/R animal models, the ischemia regions mainly included striatum, hippocampus and cortex. Thus, the localization of COX-1 and COX-2 in each group was determined by immunohistochemical staining at these regions. According to the images in Fig. 2f, COX-1 was mainly located in cortex and hippocampus; in comparison, only a small amount of COX-1 was detected in striatum. Next, we further detected the localization of COX-2 (Fig. 2g). In the sham group, the images showed no positive staining in ischemia regions. However, after cerebral ischemia reperfusion injury, there occurred significant expression of COX-2 in cortex and hippocampus, while no expression of COX-2 was observed in the striatum. From these immunohistochemical images, we were able to determine a significant increase in COX-2 expression after cerebral I/R injury.

Expression and Localization of PGE2Synthetases in the Ischemia Regions after Cerebral Ischemia Reperfusion Injury

PGE2 synthetases include cPGES, mPGES-1 and mPGES-2. cPGES mainly acts together with COX-1 participating in the biosynthesis of PGE2 in normal physiological states, while mPGES-1 mainly acts together with COX-2 to participate in the delayed generation of PGE2. According to our results, the expression patterns of these three molecules are distinct after cerebral ischemia reperfusion injury.

Firstly, cPGES is a constitutive protein. Interestingly its mRNA level slightly decreased following cerebral ischemia reperfusion injury; meanwhile its protein level was further demonstrated to decrease, too (Fig. 3a, b). We hypothesized maybe the high level of the inducible proteins could inhibit the expression of cPGES. Immunohistochemical images showed that cPGES was almost non-existent in the striatum and hippocampus, just expressed in cortex (Fig. 3g).

Fig. 3.

Fig. 3

Expression and localization of PGE2 synthetases in the ischemia regions after cerebral I/R injury. a Ischemia brain tissue cPGES mRNA expression was detected at various time points by reverse transcription-quantitative polymerase chain reaction analysis. b cPGES protein expression was detected in the brain tissues at various time points by Western blotting and the densitometric analysis of cPGES expression. c Ischemia brain tissue mPGES-1 mRNA expression was detected at various time points by reverse transcription-quantitative polymerase chain reaction analysis. d mPGES-1 protein expression was detected in the brain tissues at various time points by Western blotting. e mPGES-2 protein expression was detected in the brain tissues at various time points by Western blotting. f Densitometric analysis of mPGES-2 expression. g The localization of cPGES protein in the ischemia regions of rat was measured by immunostaining at various time points (magnification, × 200 and × 400). Protein was detected in some cells (arrow). h The localization of mPGES-1 protein was measured by immunostaining at various time points (magnification, × 200 and × 400). Protein was detected in some cells (arrow). i The localization of mPGES-2 protein in the ischemia regions of rat was measured by immunostaining at various time points (magnification, × 200 and × 400). Protein was detected in some cells (arrow). n = 3 animals per group. Data are presented as the mean ± standard deviation. *P < 0.05 VS. sham group

Further, we looked at mPGES-1, which is an inducible enzyme. It fluctuated greatly after cerebral ischemia reperfusion injury. The mRNA level of mPGES-1 increased strongly at 12 h, recovered to near the level of sham group at 24 h, and showed a slight downregulation at 48 h (Fig. 3c). This dramatic trend may be one of the characteristics of mPGES-1 as an inducible enzyme. Due to the low expression of mPGES-1 in brain tissue, we can only detect light bands in the Western blotting experiment, but we can estimate that the protein level of mPGES-1 may be increased at 12 h and 24 h qualitatively through the Western blotting image (Fig. 3d). Additionally, we used immunohistochemistry to detect the localization and expression of mPGES-1 in cerebral ischemia regions. In the sham group, mPGES-1 was not expressed. After cerebral ischemia reperfusion injury, mPGES-1 was clearly expressed in striatum, hippocampus and cortex. This demonstrated the upregulation of mPGES-1 in cerebral I/R injury (Fig. 3h).

As for mPGES-2, Western blotting showed that its protein level increased after cerebral ischemia reperfusion injury, and it reached the peak at 24 h (Fig. 3e, f). Immunohistochemistry showed that it located in cortex and striatum, rather than the hippocampus (Fig. 3i).

Although there was a slight decrease in cPGES expression, the upregulation of both mPGES-1 and mPGES-2 was evident. So, a combination of the three enzymes is likely to lead to an increase in PGE2 synthesis.

15-PGDH Decreased after Cerebral Ischemia Reperfusion Injury

After several key enzymes involved in PGE2 synthesis were detected which are most upregulated in our model, we next measured 15-PGDH, the degradation enzyme of PGE2, in order to reveal the PGE2 pathway more comprehensively after cerebral ischemia reperfusion injury. Firstly, the mRNA level of 15-PGDH was significantly decreased at 12 h after cerebral I/R injury, and remained at a low level at 24 h and 48 h (Fig. 4a). The results of the Western blotting were consistent with the trends displayed in PCR, showing that the protein level of 15-PGDH decreased after injury (Fig. 4b, c). In addition, the protein level of 15-PGDH decreased continuously, which was slightly different from the trends shown by the mRNA analysis. We further used immunohistochemistry to determine the location of 15-PGDH. As shown in Fig. 4d, 15-PGDH was expressed in striatum and cortex, except hippocampus. It is most abundant in cortex. There is also a small amount in striatum.

Fig. 4.

Fig. 4

15-PGDH decreased after cerebral I/R injury. a Ischemia brain tissue 15-PGDH mRNA expression was detected at various time points by reverse transcription-quantitative polymerase chain reaction analysis. b 15-PGDH protein expression was detected in the brain tissues at various time points by Western blotting. c Densitometric analysis of 15-PGDH expression. d The localization of 15-PGDH protein in the ischemia regions of rat was measured by immunostaining at various time points (magnification, × 200 and × 400). Protein was detected in some cells (arrow). n = 3 animals per group. Data are presented as the mean ± standard deviation. *P < 0.05 VS. sham group

These results demonstrated that 15-PGDH was downregulated after cerebral ischemia reperfusion injury, indicating that the degradation of PGE2 was reduced.

Changes of EP3 and EP4 after Cerebral Ischemia Reperfusion Injury

PGE2 functions only when it binds to appropriate receptors. There are four receptors, EP1, EP2, EP3 and EP4. EP2 expressed only in small amounts in brain tissue. Unfortunately, we failed to detect EP1. So, we focused on the expression and localization of EP3 and EP4 after cerebral ischemia reperfusion injury.

Firstly, we focused on EP3. As shown in Fig. 5a, its mRNA level was upregulated at 24 h after cerebral ischemia reperfusion injury, while this upregulation was not sustained. At 48 h, its mRNA level restored to the level of sham group. Meanwhile, Western blotting showed that EP3 protein level increased after injury (Fig. 5b, c). Next, we found the mRNA level of EP4 increased at 24 h after the injury, and then recovered to the level the of sham group at 48 h.

Fig. 5.

Fig. 5

Changes of EP3 and EP4 after cerebral I/R injury. a Ischemia brain tissue EP3 mRNA expression was detected at various time points by reverse transcription-quantitative polymerase chain reaction analysis. b EP3 protein expression was detected in the brain tissues at various time points by Western blotting. c Densitometric analysis of EP3 expression. d Ischemia brain tissue EP4 mRNA expression was detected at various time points by reverse transcription-quantitative polymerase chain reaction analysis. e The localization of EP3 protein in the ischemia regions of rat was measured by immunostaining at various time points (magnification, × 200 and × 400). Protein was detected in some cells (arrow). f The localization of EP4 protein in the ischemia regions of rat was measured by immunostaining at various time points (magnification, × 200 and × 400). Protein was detected in some cells (arrow). n = 3 animals per group. Data are presented as the mean ± standard deviation. *P < 0.05 VS. sham group

Meanwhile, immunohistochemical images revealed similarities in the localization of EP3 and EP4 in the ischemia brain regions (Fig. 5e, f). EP3 and EP4 are barely expressed in the striatum and hippocampus, whereas the main expression regions are confined to the cortex.

Inflammatory Cytokines Increased Significantly after Cerebral Ischemia Reperfusion Injury

As an extremely important inflammatory mediator, PGE2 plays a key regulatory role in a variety of inflammatory cytokines. Meanwhile inflammation plays an indispensable role in the process of cerebral ischemia reperfusion injury. In our above results, it has been demonstrated that the concentration of PGE2 increased after cerebral ischemia reperfusion injury, and thus the inflammatory cytokines regulated by PGE2 may also be affected. Therefore, we next examined the classical inflammatory cytokines IL-1β and TNF-α after cerebral ischemia reperfusion injury. ELISA results demonstrated that IL-1β and TNF-α increased at 24 h after cerebral ischemia reperfusion injury (Fig. 6), suggesting that inflammation of ischemic brain tissue is aggravated after injury.

Fig. 6.

Fig. 6

Detection of cytokines after cerebral I/R injury by ELISA. We determined the pro-inflammatory cytokines IL-1β and TNF-α after cerebral I/R injury by ELISA. a IL-1β increases after cerebral I/R injury. b TNF-α increases after cerebral ischemia reperfusion injury. n = 6 animals per group. Data are presented as the mean ± standard deviation. *P < 0.05 VS. sham group

Discussion

Our experiment has shown that PGE2 in the brain increased significantly after cerebral I/R injury, which was consistent with previous studies (McCullough et al. 2004). While PGE2 is an important inflammatory mediator, its increase will impact the release of inflammatory cytokines, including IL-1β and TNF-α. Studies have demonstrated that PGE2 can reduce the production of IL-1β and TNF-α, which may mitigate inflammation after cerebral I/R injury (Caggiano and Kraig 1999; Minghetti et al. 1997). Therefore, we predict that the increase of PGE2 after cerebral I/R injury may partly reduce inflammation by reducing the production of IL-1β and TNF-α, thereby protecting brain damage. Unfortunately, we did not confirm it by experimental data, but by the research of other scholars, which is one of the limitations of our article. In the future, we will conduct more experiments to verify it.

However, the complete process that leads to upregulation of PGE2 has not been systemically studied. The novel insight from this study is that the increase in PGE2 was caused by upregulation of key enzymes in the process of PGE2 synthesis in combination with downregulation of the PGE2 degradation enzyme. At the same time, the receptors EP3 and EP4 were also increased. The increase of PGE2 and its receptors plays a key role in cerebral I/R injury, especially in mediating inflammatory responses. This is an experiment to detect the PGE2 synthesis and degradation comprehensively and systematically after cerebral I/R injury. Unfortunately, our study did not address the role of this increase in PGE2 in cerebral I/R injury, so further experiments are required for this. With the help of our study, we may provide a new basis for the prevention and treatment of cerebral I/R injury in clinical practice.

After cerebral I/R injury, brain tissue can be affected by a variety of insults, in which inflammatory response plays a very important role. Cerebral ischemia can lead to disruption in the dynamic balance between pro-inflammatory and anti-inflammatory mediators in the brain. Within hours of ischemia insult, infiltrating leukocytes, as well as resident brain cells including neurons and glia, may release pro-inflammatory mediators such as cytokines and chemokines that contribute to tissue damage (Amantea et al. 2009; Allen and Bayraktutan 2009; Justin et al. 2014; Chen et al. 2014). PGE2 is an important inflammatory mediator that is upregulated rapidly after stimulation (Shimizu et al. 2014). Numerous studies have found that PGE2 increased rapidly after cerebral I/R injury, and its increase plays a key role in the injury (Ikeda-Matsuo et al. 2006; Kempski et al. 1987; Iadecola et al. 2001). Our results not only confirm this, but also show how PGE2 increased. We focus on the entire process, which has not been systematically studied previously.

After cerebral I/R injury, the increase of PGE2 is mainly achieved by three stages.

The first stage is the increase of cyclooxygenase. In general, after cerebral I/R injury, the cyclooxygenases increase, but their extents are clearly quite different, maybe because of their respective roles and functions. COX-1 is a constitutive enzyme in brain tissue, whose main function is to maintain the normal levels of PGs in a physiological state. Slight changes in COX-1 are seen after stimulation by various stressors (Kapitanovic Vidak et al. 2017). Our results demonstrated that there is a slight upregulation of COX-1 after injury. As a result, this increase in COX-1 presence may be involved in the release of inflammatory factors after cerebral I/R injury (Calvello et al. 2012). Importantly, COX-2 increases significantly after injury, maybe because of its role of an inducible enzyme in the brain. We believe that the increase of COX-2 could lead to an increase in PGE2 after injury. Therefore, we suggest that COX-2 probably plays the most important role after I/R injury in the brain, and the sharp increase of COX-2 may function to regulate neurotoxicity and protect neurons after cerebral I/R injury (Choi et al. 2009). In addition, the localization of the two COX enzymes is different in ischemia regions. COX-1 expresses in striatum, hippocampus and cortex all the time, while COX-2 just expresses in hippocampus and cortex after cerebral I/R injury. The increase of COX-1 and COX-2 will promote the rise of PGE2 in the brain. The rised PGE2 will subsequently enhance its function, especially the inflammatory response we are concerned about.

The next stage is the catalytic stage of PGE2 synthases. The three synthases show different trends after cerebral I/R injury. cPGES, a constitutive enzyme, was slightly downregulated after the injury. Remarkably, it is the only decreased PGE2 synthase. We suspect the reason may be that the expression of other synthetases increases and in turn inhibits cPGES production. mPGES-1 is a typical inducible enzyme, and it changes quietly different from cPGES. It fluctuates wildly, increasing strongly in the early stages of cerebral I/R injury and then gradually returning to normal or even lower than baseline eventually. This is precisely because of this strong increase of mPGES-1. We speculate that mPGES-1 will have a large influence on the content of PGE2 after cerebral I/R injury. As for mPGES-2, its function is still unclear. Our results show that its variation range is between that of mPGES-1 and cPGES. It means that it increased after the injury, but this increase is relatively gentle compared to the increase of mPGES-1. So, it is likely that it exists in a role complimentary to the other two enzymes and will also play an important part in the synthesis of PGE2.

If only the key enzymes in the synthesis phase of PGE2 were investigated in this study, the complete process of PGE2 could not be fully explained. So, we subsequently endeavored to detect 15-PGDH, the PGE2 degradation enzyme. It decreases after cerebral I/R injury, and the direct result is that the degradation of PGE2 will be reduced. 15-PGDH is expressed in striatum and cortex. It is abundant in cortex of the sham group, but decreases after ischemia reperfusion injury. We suspect that this is the reason for the decrease of 15-PGDH.

Combining the results of the previous parts of our study, the key enzymes in the synthesis phase of PGE2 increase in general, while 15-PGDH, the PGE2 degradation enzyme, reduces obviously. Thus, there are sufficient evidences to predict that PGE2 will increase after injury induction. The ELISA results confirm this and we predict the increase of PGE2 will definitely play an important role in cerebral ischemia reperfusion injury. PGE2 is an important mediator of inflammation. Meanwhile, the receptors EP3 and EP4 also increase. So, there is more evidence that the role of PGE2 is strengthened after injury. The most important role of PGE2 is to mediate inflammatory response. Besides, it is also involved in fever, pain, female reproduction as well as several other processes. The increase of EP3 will lead to a series of effects. It is demonstrated to participate in arachidonic acid-induced edema formation (Goulet et al. 2004), and involve in ischemia stroke injury through the enhancement of inflammation and apoptotic reactions in the ischemia cortex (Ikeda-Matsuo et al. 2011). Moreover, EP3 is closely related to the permeability of the blood–brain barrier after brain injury (Dalvi et al. 2015). The absence of EP3 can protect the brain damage after ischemia (Saleem et al. 2009). EP4 also increases, which will further aggravate the effect of EP4 in brain tissue. EP4 activation can attenuate neuroinflammation (Xu et al. 2017), and it is neuroprotective in ischemia stroke by reducing MMP-3/-9 and BBB damage (DeMars et al. 2018). Furthermore, EP4 can mediate an anti-inflammatory effect in the brain by blocking LPS-induced pro-inflammatory gene expression in mice (Shi et al. 2010). The effects mediated by EP4 are largely the reverse of those mediated by EP3, especially in terms of inflammation. After cerebral ischemia reperfusion injury, severe inflammation will occur under the joint action of EP3 and EP4. However, more researches are needed to decipher what the complete outcome will be.

The effects of the above enhancements in inflammation are diverse. For example, according to our results, the alterations in these different molecules are quite different. Through comparison, we draw a conclusion that PGE2 will increase after cerebral ischemia reperfusion injury, and the main cause may be the upregulations of COX-2, mPGES-1, mPGES-2, and the downregulation of 15-PGDH, rather than COX-1 and cPGES. We made a flow chart to visually illustrate the full process after cerebral I/R injury (Fig. 7).

Fig. 7.

Fig. 7

Graphical abstract of PGE2 pathway after cerebral I/R injury

Apart from EP1 and EP2, our study tested all the molecules in the process of PGE2 synthesis and degradation by PCR, Western blotting and immunohistochemistry, investigating from mRNA to the protein level and protein localization of these molecules. We hope to elucidate the PGE2 production after cerebral ischemia reperfusion injury in detail through such a systematic and comprehensive study, and to provide more evidences for later study. But at the same time, we realize that our study only involves in the expression and localization of these molecules. We have not yet explored the reasons for the changes and the full consequences. Therefore, we plan to select one or two molecules from our results for further study, hoping to make more discoveries.

Author contributions

YL and JZ designed and directed the project. YX and KL performed the experiments. YX, YL, KL, SM, CL and CW analyzed the data. All authors discussed the results and contributed to the final manuscript. Yunfei Xu wrote the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 81571880, 81373147, 30901555, 30972870, 81360080, 81671895, 81471897 and 81671895) and Natural Science Foundation of Hunan Province (No. 2016JJ2157). All the funding bodies funded in the study design, collection, analysis, interpretation of data and writing the manuscript.

Compliance with Ethical Standards

Conflict of interest

The authors declare that they have no competing interests.

Ethical approval

All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. All procedures performed in studies involving animals were in accordance with the ethical standards of the institution or practice at which the studies were conducted by Experimental Animal Center of Central South University (Changsha, China), No: 2018sydw0222.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yunfei Xu and Ying Liu have contributed equally to this work.

Contributor Information

Ying Liu, Email: liu1977ying@126.com.

Jie Zhao, Email: steelzj@126.com.

References

  1. Allen CL, Bayraktutan U (2009) Oxidative stress and its role in the pathogenesis of ischaemic stroke. Int J Stroke 4(6):461–470. 10.1111/j.1747-4949.2009.00387.x [DOI] [PubMed] [Google Scholar]
  2. Amantea D, Nappi G, Bernardi G, Bagetta G, Corasaniti MT (2009) Post-ischemic brain damage: pathophysiology and role of inflammatory mediators. Febs j 276(1):13–26. 10.1111/j.1742-4658.2008.06766.x [DOI] [PubMed] [Google Scholar]
  3. Anrather J, Iadecola C (2016) Inflammation and Stroke: An Overview. Neurotherapeutics 13(4):661–670. 10.1007/s13311-016-0483-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ashwal S, Tone B, Tian HR, Cole DJ, Pearce WJ (1998) Core and penumbral nitric oxide synthase activity during cerebral ischemia and reperfusion. Stroke 29 (5):1037–1046; discussion 1047 [PubMed]
  5. Basbaum AI, Bautista DM, Scherrer G, Julius D (2009) Cellular and molecular mechanisms of pain. Cell 139(2):267–284. 10.1016/j.cell.2009.09.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Caggiano AO, Kraig RP (1999) Prostaglandin E receptor subtypes in cultured rat microglia and their role in reducing lipopolysaccharide-induced interleukin-1beta production. J Neurochem 72(2):565–575. 10.1046/j.1471-4159.1999.0720565.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Calvello R, Panaro MA, Carbone ML, Cianciulli A, Perrone MG, Vitale P, Malerba P, Scilimati A (2012) Novel selective COX-1 inhibitors suppress neuroinflammatory mediators in LPS-stimulated N13 microglial cells. Pharmacol Res 65(1):137–148. 10.1016/j.phrs.2011.09.009 [DOI] [PubMed] [Google Scholar]
  8. Cha YI, Solnica-Krezel L, DuBois RN (2006) Fishing for prostanoids: deciphering the developmental functions of cyclooxygenase-derived prostaglandins. Dev Biol 289(2):263–272. 10.1016/j.ydbio.2005.10.013 [DOI] [PubMed] [Google Scholar]
  9. Chen LF, Tian YF, Lin CH, Huang LY, Niu KC, Lin MT (2014) Repetitive hyperbaric oxygen therapy provides better effects on brain inflammation and oxidative damage in rats with focal cerebral ischemia. J Formos Med Assoc 113(9):620–628. 10.1016/j.jfma.2014.03.012 [DOI] [PubMed] [Google Scholar]
  10. Choi SH, Aid S, Bosetti F (2009) The distinct roles of cyclooxygenase-1 and -2 in neuroinflammation: implications for translational research. Trends Pharmacol Sci 30(4):174–181. 10.1016/j.tips.2009.01.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dalvi S, Nguyen HH, On N, Mitchell RW, Aukema HM, Miller DW, Hatch GM (2015) Exogenous arachidonic acid mediates permeability of human brain microvessel endothelial cells through prostaglandin E2 activation of EP3 and EP4 receptors. J Neurochem 135(5):867–879. 10.1111/jnc.13117 [DOI] [PubMed] [Google Scholar]
  12. DeMars KM, McCrea AO, Siwarski DM, Sanz BD, Yang C, Candelario-Jalil E (2018) Protective Effects of L-902,688, a Prostanoid EP4 Receptor Agonist, against Acute Blood-Brain Barrier Damage in Experimental Ischemic Stroke. Front Neurosci 12:89. 10.3389/fnins.2018.00089 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Eltzschig HK, Eckle T (2011) Ischemia and reperfusion–from mechanism to translation. Nat Med 17(11):1391–1401. 10.1038/nm.2507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Feigin VL, Abajobir AA, Abate KH, Abd-Allah F, Abdulle AM, Abera SF, Abyu GY, Ahmed MB, Aichour AN, Aichour I, Aichour MTE, Akinyemi RO, Alabed S, Al-Raddadi R, Alvis-Guzman N, Amare AT, Ansari H, Anwari P, Ärnlöv J, Asayesh H, Asgedom SW, Atey TM, Avila-Burgos L, Frinel E, Avokpaho GA, Azarpazhooh MR, Barac A, Barboza M, Barker-Collo SL, Bärnighausen T, Bedi N, Beghi E, Bennett DA, Bensenor IM, Berhane A, Betsu BD, Bhaumik S, Birlik SM, Biryukov S, Boneya DJ, Bulto LNB, Carabin H, Casey D, Castañeda-Orjuela CA, Catalá-López F, Chen H, Chitheer AA, Chowdhury R, Christensen H, Dandona L, Dandona R, de Veber GA, Dharmaratne SD, Do HP, Dokova K, Dorsey ER, Ellenbogen RG, Eskandarieh S, Farvid MS, Fereshtehnejad S-M, Fischer F, Foreman KJ, Geleijnse JM, Gillum RF, Giussani G, Goldberg EM, Gona PN, Goulart AC, Gugnani HC, Gupta R, Hachinski V, Gupta R, Hamadeh RR, Hambisa M, Hankey GJ, Hareri HA, Havmoeller R, Hay SI, Heydarpour P, Hotez PJ, Jakovljevic MB, Javanbakht M, Jeemon P, Jonas JB, Kalkonde Y, Kandel A, Karch A, Kasaeian A, Kastor A, Keiyoro PN, Khader YS, Khalil IA, Khan EA, Khang Y-H, Tawfih A, Khoja A, Khubchandani J, Kulkarni C, Kim D, Kim YJ, Kivimaki M, Kokubo Y, Kosen S, Kravchenko M, Krishnamurthi RV, Defo BK, Kumar GA, Kumar R, Kyu HH, Larsson A, Lavados PM, Li Y, Liang X, Liben ML, Lo WD, Logroscino G, Lotufo PA, Loy CT, Mackay MT, El Razek HMA, El Razek MMA, Majeed A, Malekzadeh R, Manhertz T, Mantovani LG, Massano J, Mazidi M, McAlinden C, Mehata S, Mehndiratta MM, Memish ZA, Mendoza W, Mengistie MA, Mensah GA, Meretoja A, Mezgebe HB, Miller TR, Mishra SR, Ibrahim NM, Mohammadi A, Mohammed KE, Mohammed S, Mokdad AH, Moradi-Lakeh M, Velasquez IM, Musa KI, Naghavi M, Ngunjiri JW, Nguyen CT, Nguyen G, Le Nguyen Q, Nguyen TH, Nichols E, Ningrum DNA, Nong VM, Norrving B, Noubiap JJN, Ogbo FA, Owolabi MO, Pandian JD, Parmar PG, Pereira DM, Petzold M, Phillips MR, Piradov MA, Poulton RG, Pourmalek F, Qorbani M, Rafay A, Rahman M, Rahman MH, Rai RK, Rajsic S, Ranta A, Rawaf S, Renzaho AMN, Rezai MS, Roth GA, Roshandel G, Rubagotti E, Sachdev P, Safiri S, Sahathevan R, Sahraian MA, Samy AM, Santalucia P, Santos IS, Sartorius B, Satpathy M, Sawhney M, Saylan MI, Sepanlou SG, Shaikh MA, Shakir R, Shamsizadeh M, Sheth KN, Shigematsu M, Shoman H, Silva DAS, Smith M, Sobngwi E, Sposato LA, Stanaway JD, Stein DJ, Steiner TJ, Stovner LJ, Abdulkader RS, Ei Szoeke C, Tabarés-Seisdedos R, Tanne D, Theadom AM, Thrift AG, Tirschwell DL, Topor-Madry R, Tran BX, Truelsen T, Tuem KB, Ukwaja KN, Uthman OA, Varakin YY, Vasankari T, Venketasubramanian N, Vlassov VV, Wadilo F, Wakayo T, Wallin MT, Weiderpass E, Westerman R, Wijeratne T, Wiysonge CS, Woldu MA, Wolfe CDA, Xavier D, Xu G, Yano Y, Yimam HH, Yonemoto N, Yu C, Zaidi Z, El Sayed ZM, Zunt JR, Murray CJL, Vos T (2017) Global, regional, and national burden of neurological disorders during 1990–2015: a systematic analysis for the Global Burden of Disease Study 2015. The Lancet Neurology 16(11):877–897. 10.1016/s1474-4422(17)30299-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Goulet JL, Pace AJ, Key ML, Byrum RS, Nguyen M, Tilley SL, Morham SG, Langenbach R, Stock JL, McNeish JD, Smithies O, Coffman TM, Koller BH (2004) E-prostanoid-3 receptors mediate the proinflammatory actions of prostaglandin E2 in acute cutaneous inflammation. J Immunol 173(2):1321–1326. 10.4049/jimmunol.173.2.1321 [DOI] [PubMed] [Google Scholar]
  16. Hankey GJ (2017) Stroke. The Lancet 389(10069):641–654. 10.1016/s0140-6736(16)30962-x [DOI] [PubMed] [Google Scholar]
  17. Iadecola C, Niwa K, Nogawa S, Zhao X, Nagayama M, Araki E, Morham S, Ross ME (2001) Reduced susceptibility to ischemic brain injury and N-methyl-D-aspartate-mediated neurotoxicity in cyclooxygenase-2-deficient mice. Proc Natl Acad Sci USA 98(3):1294–1299. 10.1073/pnas.98.3.1294 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ikeda-Matsuo Y, Ota A, Fukada T, Uematsu S, Akira S, Sasaki Y (2006) Microsomal prostaglandin E synthase-1 is a critical factor of stroke-reperfusion injury. Proc Natl Acad Sci USA 103(31):11790–11795. 10.1073/pnas.0604400103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ikeda-Matsuo Y, Tanji H, Narumiya S, Sasaki Y (2011) Inhibition of prostaglandin E2 EP3 receptors improves stroke injury via anti-inflammatory and anti-apoptotic mechanisms. J Neuroimmunol 238(1–2):34–43. 10.1016/j.jneuroim.2011.06.014 [DOI] [PubMed] [Google Scholar]
  20. Justin A, Sathishkumar M, Sudheer A, Shanthakumari S, Ramanathan M (2014) Non-hypotensive dose of telmisartan and nimodipine produced synergistic neuroprotective effect in cerebral ischemic model by attenuating brain cytokine levels. Pharmacol Biochem Behav 122:61–73. 10.1016/j.pbb.2014.03.009 [DOI] [PubMed] [Google Scholar]
  21. Kang YJ, Mbonye UR, DeLong CJ, Wada M, Smith WL (2007) Regulation of intracellular cyclooxygenase levels by gene transcription and protein degradation. Prog Lipid Res 46(2):108–125. 10.1016/j.plipres.2007.01.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kapitanovic Vidak H, Catela Ivkovic T, Vidak Z, Kapitanovic S (2017) COX-1 and COX-2 polymorphisms in susceptibility to cerebral palsy in very preterm infants. Mol Neurobiol 54(2):930–938. 10.1007/s12035-016-9713-9 [DOI] [PubMed] [Google Scholar]
  23. Kempski O, Shohami E, von Lubitz D, Hallenbeck JM, Feuerstein G (1987) Postischemic production of eicosanoids in gerbil brain. Stroke 18(1):111–119 [DOI] [PubMed] [Google Scholar]
  24. Kumazawa T, Mizumura K, Koda H (1993) Involvement of EP3 subtype of prostaglandin E receptors in PGE2-induced enhancement of the bradykinin response of nociceptors. Brain Res 632(1–2):321–324 [DOI] [PubMed] [Google Scholar]
  25. Legler DF, Bruckner M, Uetz-von Allmen E, Krause P (2010) Prostaglandin E2 at new glance: novel insights in functional diversity offer therapeutic chances. Int J Biochem Cell Biol 42(2):198–201. 10.1016/j.biocel.2009.09.015 [DOI] [PubMed] [Google Scholar]
  26. Liu Y, Jia Z, Sun Y, Zhou L, Downton M, Chen R, Zhang A, Yang T (2014) Postnatal regulation of 15-hydroxyprostaglandin dehydrogenase in the rat kidney. Am J Physiol Renal Physiol 307(4):F388–395. 10.1152/ajprenal.00512.2013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  28. McCullough L, Wu L, Haughey N, Liang X, Hand T, Wang Q, Breyer RM, Andreasson K (2004) Neuroprotective function of the PGE2 EP2 receptor in cerebral ischemia. J Neurosci 24(1):257–268. 10.1523/jneurosci.4485-03.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Minghetti L, Nicolini A, Polazzi E, Creminon C, Maclouf J, Levi G (1997) Inducible nitric oxide synthase expression in activated rat microglial cultures is downregulated by exogenous prostaglandin E2 and by cyclooxygenase inhibitors. Glia 19(2):152–160 [PubMed] [Google Scholar]
  30. Radi ZA, Khan NK (2006) Effects of cyclooxygenase inhibition on the gastrointestinal tract. Exp Toxicol Pathol 58(2–3):163–173. 10.1016/j.etp.2006.06.004 [DOI] [PubMed] [Google Scholar]
  31. Saleem S, Kim YT, Maruyama T, Narumiya S, Dore S (2009) Reduced acute brain injury in PGE2 EP3 receptor-deficient mice after cerebral ischemia. J Neuroimmunol 208(1–2):87–93. 10.1016/j.jneuroim.2009.01.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Shi J, Johansson J, Woodling NS, Wang Q, Montine TJ, Andreasson K (2010) The prostaglandin E2 E-prostanoid 4 receptor exerts anti-inflammatory effects in brain innate immunity. J Immunol 184(12):7207–7218. 10.4049/jimmunol.0903487 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Shimizu T, Tanaka K, Nakamura K, Taniuchi K, Yawata T, Higashi Y, Ueba T, Dimitriadis F, Shimizu S, Yokotani K, Saito M (2014) Possible involvement of brain prostaglandin E2 and prostanoid EP3 receptors in prostaglandin E2 glycerol ester-induced activation of central sympathetic outflow in the rat. Neuropharmacology 82:19–27. 10.1016/j.neuropharm.2014.03.005 [DOI] [PubMed] [Google Scholar]
  34. Sugimoto Y, Narumiya S (2007) Prostaglandin E receptors. The Journal of biological chemistry 282(16):11613–11617. 10.1074/jbc.R600038200 [DOI] [PubMed] [Google Scholar]
  35. Tai HH, Cho H, Tong M, Ding Y (2006) NAD+-linked 15-hydroxyprostaglandin dehydrogenase: structure and biological functions. Curr Pharm Des 12(8):955–962 [DOI] [PubMed] [Google Scholar]
  36. Tai HH, Ensor CM, Tong M, Zhou H, Yan F (2002) Prostaglandin catabolizing enzymes. Prostaglandins Other Lipid Mediat 68–69:483–493 [DOI] [PubMed] [Google Scholar]
  37. Tanikawa N, Ohmiya Y, Ohkubo H, Hashimoto K, Kangawa K, Kojima M, Ito S, Watanabe K (2002) Identification and characterization of a novel type of membrane-associated prostaglandin E synthase. Biochem Biophys Res Commun 291(4):884–889. 10.1006/bbrc.2002.6531 [DOI] [PubMed] [Google Scholar]
  38. Tanioka T, Nakatani Y, Semmyo N, Murakami M, Kudo I (2000) Molecular identification of cytosolic prostaglandin E2 synthase that is functionally coupled with cyclooxygenase-1 in immediate prostaglandin E2 biosynthesis. The Journal of biological chemistry 275(42):32775–32782. 10.1074/jbc.M003504200 [DOI] [PubMed] [Google Scholar]
  39. Xu J, Xu Z, Yan A (2017) Prostaglandin E2 EP4 Receptor Activation Attenuates Neuroinflammation and Early Brain Injury Induced by Subarachnoid Hemorrhage in Rats. Neurochem Res 42(4):1267–1278. 10.1007/s11064-016-2168-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Neurobiology are provided here courtesy of Springer

RESOURCES