Slc25a3-dependent copper transport controls flickering-induced Opa1 processing for mitochondrial safeguard

Summary

Following the Goldilocks principle, mitochondria size must be ‘just right’. Mitochondria balance division and fusion to avoid becoming too big or too small. Defects in this balance produce dysfunctional mitochondria in human diseases. Mitochondrial safeguard (MitoSafe) is a defense mechanism that protects mitochondria against extreme enlarging by suppressing fusion in mammalian cells. In MitoSafe, hyperfused mitochondria elicit flickering – short pulses of mitochondrial depolarization. Flickering activates an inner membrane protease, Oma1, which in turn proteolytically inactivates a mitochondrial fusion protein, Opa1. The mechanisms underlying flickering are unknown. Using a live-imaging screen, we identified Slc25a3 (a mitochondrial carrier transporting phosphate and copper) as necessary for flickering and Opa1 cleavage. Remarkably, copper, but not phosphate, is critical for flickering. Furthermore, we found that two copper-containing mitochondrial enzymes, superoxide dismutase 1 and cytochrome c oxidase, regulate flickering. Our data identify an unforeseen mechanism linking copper, redox homeostasis, and membrane flickering in mitochondrial defense against deleterious fusion.

Graphical Abstract

eTOC

Murata et al. report that mitochondrial copper, transported by Slc25a3, regulates the balance between mitochondrial fusion and division by suppressing fusion when mitochondria become hyper-fused. This function of copper is mediated by two copper-containing enzymes: superoxide dismutase 1 and cytochrome c oxidase.

Introduction

Mitochondria grow by importing proteins and lipids and control their morphology by dividing and fusing their membranes ^1,2. A balance between division and fusion determines the mitochondrial size, number, and connectivity in cells ^3–6. Excess fusion results in the elongation and enlargement of mitochondria, which become defective in intracellular transport or mitophagy, while excess division produces extremely small mitochondria, many of which lack mtDNA. Structural abnormalities are associated with mitochondrial energy deficiency, aberrant distribution, and impaired autophagic turnover in many human diseases, including brain development defects, muscle atrophy, cardiovascular diseases, cancers, and metabolic syndrome ^7–11. Therefore, like in the story of Goldilocks and the Three Bears, mitochondria need to be ‘just right’, not too small and not too big.

Evolutionarily conserved dynamin-related GTPases mediate mitochondrial division and fusion. Mitochondria are severed by dynamin-related protein 1 (Drp1), while mitochondria are fused by mitofusin 1 and 2 (Mfn1 and 2) at the outer membrane and optic atrophy 1 (Opa1) at the inner membrane ^1,2,12–18. The activities of these GTPases must be coordinated to prevent unbalanced mitochondrial division and fusion. We recently identified a defense mechanism, termed mitochondrial safeguard (MitoSafe). MitoSafe regulates mitochondrial fusion when mitochondria are hyper-fused either due to the genetic loss of Drp1 or its receptor, or due to metabolic stress caused by depleting methionine and choline in mice ^19–22. MitoSafe prevents deleterious, extreme fusion that impairs mitochondrial respiratory function, at both the outer membrane and inner membranes ¹⁹. At the outer membrane, a ubiquitin E3 ligase (Parkin) and a mitochondrial kinase that phosphorylates parkin and ubiquitin (PINK1) promote proteasomal degradation of Mfn1 and Mfn2 ^20,21. At the inner membrane, a metalloprotease (Oma1), cleaves Opa1 and suppresses inner membrane fusion ¹⁹.

In MitoSafe, Oma1 is activated by repeated, transient decreases of the inner membrane potential, termed flickering, without losing the overall membrane potential (Fig. 1A) ¹⁹. Flickering has been reported in several cell types, including smooth muscle cells ²³, cardiomyocytes ²⁴, and a neuroblastoma cell line ²⁵; however, its function remained largely unknown. The flickering occurs, independently of mitochondrial respiration, calcium signaling, or a mitochondrial permeability transition pore ^19,26,27. Remarkably, in hyper-fused mitochondria, the frequency of flickering is greatly accelerated ^19,26,27. Thus, MitoSafe represents the critical biological process that could be considered a function of flickering ¹⁹. However, it is unknown how elongated mitochondria induce flickering.

Figure 1. A knockdown screen identifies that Slc25a3 is critical for flickering and Opa1 cleavage in Drp1-KO cells.

(A) Drp1-KO MEFs expressing matrix-targeted Su9-GFP were viewed by laser scanning confocal microscopy for 30 min with 10-s intervals in the presence of TMRE. The arrows indicate mitochondria that showed flickering. Three frames from the time-lapse analysis are shown. Scale bar, 10 μm. (B) A list of genes tested. (C) 30 genes were individually knocked down in Drp1-KO cells using esiRNA and analyzed for flickering by TMRE staining and live-cell imaging. Knockdown of four genes highlighted in yellow in (B) decreased the frequency of flickering. (D) Drp1-KO MEFs were transduced by lentiviruses carrying shRNAs for each of the four candidates for 1-2 weeks. Cells were stained with TMRE and viewed by laser scanning confocal microscopy for 30 min with 10-s intervals. The percentage of cells that showed flickering are presented (average ± SD, n = 3). (E) Slc25a3 was knocked out using CRISPR in Drp1-KO MEFs. Flickering frequency is quantified (average ± SD, n = 3). (F) The mitochondrial membrane potential was measured in Drp1-KO and Drp1Slc25a3-KO MEFs using MitoLite and flow cytometry. As a negative control, Drp1-KO MEFs were treated with 10 μM FCCP. Significance was calculated using ANOVA with post-hoc Tukey in (D) and Student’s t-test in (E): **p<0.01. See also Figures S1 and S2.

Results

A live-cell imaging-based RNA interference screen identifies Slc25a3 as critical for flickering in Drp1-KO cells

To uncover the mechanism that promotes flickering upon mitochondrial hyperfusion in Drp1-KO cells, we selected mitochondrial proteins based on the mitochondrial proteome (MitoCarta3.0) and further narrowed our choice to known or potential carrier proteins that may transport small molecules or ions ²⁸. We also included some membrane proteins with unknown functions ²⁸. We individually knocked down 30 selected genes in Drp1-KO mouse embryonic fibroblasts (MEFs) or Drp1-KO HEK293T cells in the following two screens (Fig. 1B). In the first screening, we transfected Drp1-KO cells with a mixture of endoribonuclease-prepared siRNAs (esiRNAs), which is designed to target a single gene. This approach ensures specific and effective gene knockdown ²⁹. Five days post-transfection, the cells were stained with the membrane potential-dependent dye, tetramethylrhodamine ethyl ester (TMRE), and subjected to live-cell imaging for 30 minutes. The membrane potential was not globally decreased by the knockdown of the 30 genes (Fig. S1). We scored cells that exhibited flickering during the 30-minute observation period. Typically, approximately 60-70% of Drp1-KO cells exhibited flickering (Fig. 1A and C). This knockdown experiment was conducted twice, with a threshold set at an approximate 50% reduction in flickering frequency compared to Drp1-KO cells treated with scramble esiRNAs. Four genes (Ccdc51, Mpv17, Slc25a3, and Slc25a40) met this criterion in both trials (Fig. 1C). In the second screen, we knocked down each candidate gene in Drp1-KO MEFs using shRNAs and monitored flickering in three separate experiments (Fig. 1D). The knockdown of Slc25a3 was found to significantly decrease the frequency of flickering in Drp1-KO MEFs (Fig. 1D).

Slc25a3 is a member of the mitochondrial solute carrier family and located in the inner membrane. In humans, mutations in Slc25a3 causes fatal mitochondrial defects with lactic acidosis, hypertrophic cardiomyopathy, and neonatal hypotonia ^30,31. Slc25a3 was initially identified as a phosphate carrier, and recent studies have shown that Slc25a3 also transports copper ^32,33. To further confirm the role of Slc25a3 in flickering, we knocked out Slc25a3 in Drp1-KO MEFs using CRISPR gene editing (Fig. S2). Consistent with the knockdown data, knockout of Slc25a3 significantly reduced the flickering frequency in Drp1-KO MFEs (Fig. 1E). This is not due to a drop in the membrane potential since Drp1Slc25a3-KO cells maintain a membrane potential similar to Drp1-KO MEFs (Fig. 1F).

Slc25a3 is important for enhanced OPA1 cleavage in Drp1-KO cells

We have previously shown that flickering promotes the proteolytic processing of Opa1 by the metalloprotease Oma1¹⁹. The Opa1 long isoforms, L1 and L2, are cleaved to form the short forms, S3 and S5, respectively ^2,19,34–36. This Oma1-mediated Opa1 cleavage is enhanced in Drp1-KO cells ¹⁹ (Fig. 2A and B). To determine whether the loss of Slc25a3 affects Opa1 processing, we analyzed Opa1 in WT, Drp1-KO, Slc25a3-KO, and Drp1Slc25a3-KO MEFs using Western blotting. We found that levels of L1 and L2 were significantly increased in Drp1Slc25a3-KO MEFs compared to Drp1-KO MEFs (Fig. 2A and B). In contrast to Opa1, decreased levels of Mfn1 and Mfn2 in Drp1-KO MEFs were not restored in Drp1Slc25a3-KO MEFs (Fig. 2A and B). These data suggest that Slc25a3 is vital for enhanced processing of Opa1 long isoforms in Drp1-KO MEFs. Supporting this notion, shRNA-mediated knockdown of Slc25a3 in Drp1-KO MEFs also increased the levels of L1 and L2 (Fig. S3). As a control, we knocked out the metalloprotease Oma1, which cleaves L1 and L2, in Drp1-KO MEFs. Results show that the loss of Oma1 also increases the levels of these long isoforms in Drp1Oma1-KO MEFs (Fig. S4). In addition, we found that the levels of two Drp1 receptors, Mff and Fis1, are not affected in the absence of Drp1 or Slc25a3 (Fig. 2A and B). Another Drp1 receptor, Mid49, exhibited increased levels in Drp1-KO MEFs, and these elevated levels were maintained in Drp1Slc25a3-KO MEFs (Fig. 1A and B).

Figure 2. OPA1 cleavage.

(A) Western blotting of WT, Drp1-KO, Slc25a3-KO, and Drp1Slc25a3-KO MEFs with the indicated antibodies. (B) Quantification of band intensity (average ± SD, n = 3). (C) Drp1-KO and Drp1Slc25a3-KO MEFs were transduced with lentiviruses carrying Opa1 L2- HA. The expression of L2-HA was induced for 4 h (0.1 μg/ml doxycycline). Western blotting was performed with the indicated antibodies. (D) Quantification of band intensity (average ± SD, n = 3). Significance was calculated using ANOVA with post-hoc Tukey in (B) and Student’s t-test in (D): *p<0.05, **p<0.01, ***p<0.001. See also Figures S3, S4, and S5.

If the cleavage of L1 and L2 by Oma1 is decreased, it is anticipated that levels of their cleaved products, S3 and S5, respectively, may be reduced. However, we did not observe such decreases in Drp1Slc25a3-KO MEFs (Fig. 2A and B) or Drp1-KO MEFs depleted for Slc25a3 (Fig. S3). It is possible that the loss or depletion of Slc25a3 may affect the stability of S3 and S5, making the data interpretation challenging. To unambiguously test the role of Slc25a3 in Opa1 processing, we expressed Opa1-L2-HA from an inducible Tet-On promoter in Drp1-KO and Drp1Slc25a3-KO MEFs, as we did previously ¹⁹. An induced expression of Opa1-L2-HA for a short time allowed us to directly assess the Oma1-mediated proteolytic cleavage of Opa1-L2 to Opa1-S5 ¹⁹. We found that the loss of Slc25a3 significantly decreased the conversion of Opa1 L2-HA to S5-HA (Fig. 2C and D). These data suggest that Slc25a3 is crucial for the cleavage of Opa1 in Drp1-KO cells.

Furthermore, to ask if the transcription of Opa1-L1 and-L2 is altered in Drp1-KO and Drp1Slc25a3-KO MEFs, we examined their mRNA levels. In contrast to their decreased protein levels, the mRNA levels of both L1 and L2 were increased in Drp1-KO cells (Fig. S5). The increased mRNA levels might represent a compensatory response to their reduced protein abundance. Notably, in Drp1Slc25a3-KO cells, while L2 transcript levels remain elevated, L1 transcript levels have restored (Fig. S5).

The simultaneous loss of Slc25a3 and Drp1 produces megamitochondria and clusters mitochondrial DNA

Flickering-induced Opa1 processing safeguards mitochondria from excess fusion ¹⁹. To test whether decreased flickering inhibits this defense mechanism in Drp1Slc25a3-KO cells, we examined mitochondrial morphology using laser confocal immunofluorescence microscopy with antibodies to a matrix protein (pyruvate dehydrogenase, PDH) and an outer membrane protein (Tom20) ¹⁹. As reported ^19,37, mitochondria became elongated and created spherical structures in Drp1-KO MEFs (Fig. 3A–C). In Slc25a3-KO MEFs, mitochondrial morphology appeared normal (Fig. 3A–C). Strikingly, in Drp1Slc25a3-KO MEFs, both the frequency and size of spherical mitochondria were dramatically increased compared to Drp1-KO MEFs (Fig. 3A–C). Although mitochondrial morphology seems unaffected in Slc25a3-KO MEFs when imaged by light microscopy, electron microscopy showed a remarkable change in the ultrastructure of mitochondria (Fig. 3D). Inner membrane cristae were greatly lost, and only short, infrequent cristae structures were found in Slc25a3-KO MEFs (Fig. 3D). In Drp1-KO MEFs, elongated mitochondria maintain normal cristae structures (Fig. 3D). These structural defects in the single KO MEFs were combined in the double-KO MEFs. We found elongated and enlarged mitochondria without the majority of cristae in Drp1Slc25a3-KO MEFs (Fig. 3D).

Figure 3. Mitochondrial morphology and cristae structure.

(A) WT, Drp1-KO, Slc25a3-KO, and Drp1Slc25a3-KO MEFs were subjected to laser confocal immunofluorescence microscopy with antibodies to PDH and Tom20. The boxed regions are magnified. Scale bar, 10 μm. (B) Quantification of mitochondrial morphology (average ± SD, n = 3 experiments). In each experiment, 10 cells were analyzed. (C) The size of spherical mitochondria (average ± SD, n = 7 for WT, 79 for Drp1-KO, 3 for Slc25a3-KO, and 211 for Drp1Slc25a3-KO). (D) Mitochondria in the same set of MEFs were analyzed by transmission electron microscopy. Scale bar, 1 μm. Significance was calculated using ANOVA with post-hoc Tukey in (C): ***p<0.001. See also Figure S6.

To determine how these defects in mitochondrial morphology affect the distribution of mitochondrial DNA (mtDNA) ^38–40, we visualized mtDNA in WT, Drp1-KO, Slc25a3-KO, and Drp1Slc25a3-KO MEFs using a DNA-binding fluorescent dye (SYBR Green I) and MitoTracker ⁴¹. Live-cell imaging showed that mtDNA signals are present along mitochondrial tubules in WT and Slc25a3-KO MEFs (Fig. 4A and B). In Drp1-KO MEFs, mtDNA signals were found in spherical parts of mitochondria in addition to tubules. Strikingly, in Drp1Slc25a3-KO MEFs, mtDNA signals were almost completely lost in the tubular parts of mitochondria (Fig. 4A, Box 1), and the majority of mtDNA was accumulated in enlarged spherical parts of mitochondria (Fig. 4A, Box 2). In these spherical mitochondria, the area of mtDNA signal was increased (Fig. 4A, Box 2, and 4B). To further analyze mtDNA, we immunostained Drp1Slc25a3-KO MEFs using antibodies to DNA and Hsp60 (a matrix protein). Laser confocal microscopy showed that mtDNA molecules are clustered in spherical mitochondria (Fig. 4C). Therefore, these data suggest that Drp1 and Slc25a3 synergistically maintain mtDNA’s distribution. As a control, we knocked out the Opa1-cleaving protease Oma1 in Drp1-KO MEFs and analyzed mitochondrial morphology and mtDNA distribution. Similar to Drp1Slc25a3-KO MEFs, Drp1Oma1-KO MEFs showed enlarged mitochondria with clustered mDNA (Fig. S6).

Figure 4. mtDNA distribution.

(A) MEFs were stained with SYBR Green I and MitoTracker and viewed using live-cell imaging. Scale bar, 10 μm. (B) The size of mtDNA signal (average ± SD, n = 30). (C) Drp1Slc25a3-KO MEFs were analyzed by laser confocal immunofluorescence microscopy with antibodies to DNA and Hsp60. (D-J) WT, Drp1-KO, and Drp1Slc25a3-KO MEFs were transfected with a plasmid carrying mUNG (Y147A). (D) Seven days after transfection, cells were subjected to laser confocal immunofluorescence microscopy. Scale bar, 10 μm. (E, G, I) The percentage of cells with spherical mitochondria (average ± SD, n = 30). (F, H, J) The size of spherical mitochondria (average ± SD, n = ~20 [F], ~30 [H], and ~130 [J]). (K) Flickering frequency is quantified in the indicated cells (average ± SD, n = 3). Significance was calculated using ANOVA with post-hoc Tukey in (B and K) and Student’s t-test in (F, H, J): *p<0.05, ***p<0.001.

To ask if the accumulation of mtDNA is involved in forming enlarged mitochondrial spheres in Drp1Slc25a3-KO MEFs, we transfected WT, Drp1-KO, and Drp1Slc25a3-KO cells with a plasmid carrying a matrix-targeted uracil-N-glycosylase mutant, mUNG1(Y147A) (Fig. 4D) ⁴². WT uracil-N-glycosylase functions in DNA repair and removes misincorporated uracil from DNA. The mutation in the active site (Y147A) changes its specificity and enables this enzyme to remove normally incorporated thymine ⁴². The resulting single-strand gaps in mtDNA cause the depletion of mtDNA via degradation ⁴². Transfected cells with matrix-targeted mUNG1(Y147A) were cultured in the presence of uridine and pyruvate to support cell proliferation without mtDNA ⁴². Seven days after the transfection, cells were immunostained with antibodies to DNA and Hsp60. As expected, mUNG1(Y147A) greatly eliminated mtDNA in WT, Drp1-KO, and Drp1Slc25a3-KO MEFs (Fig. 4D). We found that the depletion of mtDNA significantly decreased the percentage of cells that contain spherical mitochondria and the size of spherical mitochondria in both Drp1-KO and Drp1Slc25a3-KO MEFs (Fig. 4E–J). In addition, we analyzed flickering in Drp1-KO and Drp1Slc25a3-KO cells carrying mUNG1 (Y147A) and found that flickering frequency was not affected by the removal of mtDNA (Fig. 4K). These data suggest that the clustering of mtDNA contributes to increases in mitochondrial size, but not flickering, in Drp1-KO and Drp1Slc25a3-KO cells, possibly by physically clogging and bulging mitochondrial tubules.

Impacts of the loss of Drp1 and Slc25a3 on oxidative phosphorylation and glycolysis

To test the effects of the loss of Slc25a3 on energy metabolism, we first measured mitochondrial oxygen consumption rates (OCRs) in WT, Drp1-KO, Slc25a3-KO, and Drp1Slc25a3-KO MEFs. We found that individual loss of Drp1 or Slc25a3 decreased OCRs, and their simultaneous loss further decreased OCRs at the basal and maximal levels (Fig. 5A and B). These additive effects suggest separate roles of Drp1 and Slc25a3 for mitochondrial respiration. Second, we analyzed glycolysis by measuring extracellular acidification rates (ECARs). In contrast to OCRs, basal ECARs were increased in Drp1-KO, Slc25a3-KO, and Drp1Slc25a3-KO MEFs (Fig. 5C and D). These changes may be a compensatory response to decreased mitochondrial respiration. Indeed, we found that glycolytic reserve was reduced in Drp1-KO, Slc25a3-KO, and Drp1Slc25a3-KO MEFs without gross changes in glycolytic capacity (Fig. 5D).

Figure 5. The role of copper transport by Slc25a3 for flickering and Opa1 processing.

(A) Mitochondrial respiration was analyzed by measuring OCRs in WT, Drp1-KO, Slc25a3-KO, and Drp1Slc25a3-KO MEFs. (B) The basal and maximal OCRs (average ± SD, n = 3). (C) Glycolysis was examined by measuring ECARs in the same set of MEFs. (D) The basal glycolysis, glycolytic capacity, and glycolytic reserve (average ± SD, n = 3). (E) Drp1-KO MEFs and Drp1Slc25a3-KO MEFs expressing WT and mutant forms of the mouse (m) and human (h) Slc25a3 were analyzed for flickering (average ± SD, n = 3 experiments). In each experiment, about 15 cells were analyzed. (F) Drp1Slc25a3-KO MEFs were incubated with 0.1 μM Cu-ATSM for 3 days and analyzed for flickering (average ± SD, n = 3 experiments). (G) Copper levels in mitochondria isolated from Drp1Slc25a3-KO MEFs treated with Cu-ATSM were measured using atomic absorption spectrometry. (average ± SD, n = 3 experiments). (H) Western blotting of Drp1-KO MEFs and Drp1Slc25a3-KO MEFs expressing the indicated WT and mutant mouse Slc25a3. (I) Quantification of band intensity (average ± SD, n = 3). Significance was calculated using ANOVA with post-hoc Tukey in (B, D, E, and I) and Student’s t-test in (F and G): *p<0.05, **p<0.01, ***p<0.001.

Slc25a3-mediated copper transport is critical for flickering, Opa1 processing, and mitochondrial morphology in Drp1-KO cells

Recent excellent studies have shown that Slc25a3 transports copper in addition to phosphate ^32,33. To ask which ions are important for the role of Slc25a3 in flickering, we introduced mutations to Slc25a3, which block the transport of both copper and phosphate (H75A in mouse Slc25a3) or specifically phosphate (L175A) ³³. We expressed WT Slc25a3 and the mutant versions in Drp1Slc25a3-KO MEFs and measured flickering. We found that Slc25a3 (H75A), which is defective in the transport of both copper and phosphate, failed to rescue decreased flickering in Drp1Slc25a3-KO MEFs (Fig. 5E). In contrast, Slc25a3 (L175A), which is defective in only phosphate transport, significantly increased flickering frequency in Drp1Slc25a3-KO MEFs, similar to WT Slc25a3 (Fig. 5E). To directly test the importance of copper transport for flickering, we treated Drp1Slc25a3-KO MEFs with a membrane-permeable copper-containing compound, diacetylbis(N(4)-methylthiosemicarbazonato)copper(II) (Cu-ATSM) ³³. Noticeably, Cu-ATSM treatment effectively increased the flickering rate in Drp1Slc25a3-KO MEFs (Fig. 5F). We confirmed that Cu-ATSM increases the level of mitochondrial copper in Drp1Slc25a3-KO MEFs using atomic absorption spectrometry of isolated mitochondria (Fig. 5G). Therefore, a decrease in copper transport into mitochondria reduced the flickering rate in Drp1Slc25a3-KO MEFs. Consistent with the impact on flickering, WT and Slc25a3 (L175A), but not Slc25a3 (H75A), rescued Opa1 processing and decreased levels of L1 and L2 in Drp1Slc25a3-KO MEFs (Fig. 5H and I). Unlike Opa1, the decreased levels of Mfn1 and Mfn2 in Drp1Slc25a3-KO MEFs were not restored by either WT Slc25a3 or its mutants (Fig. 5H and I). We confirmed the effects of the Slc25a3 mutants on Opa1 processing by utilizing the Opa1-L2-HA construct (Fig. S7A and B). These data suggest that copper transport by Slc25a3 plays a crucial role in flickering and Opa1 processing in Drp1-KO cells.

To determine whether the copper transport activity of Slc25a3 is required for mitochondrial morphology in the absence of Drp1, we performed laser confocal immunofluorescence microscopy with antibodies to PDH and Tom20 in Drp1Slc25a3-KO MEFs expressing WT or the mutants of Slc25a3. Consistent with the effects on flickering and Opa1 processing, the expression of WT Slc25a3 and Slc25a3 (L175A) reduced the percentage of cells that contain giant spherical mitochondria in Drp1Slc25a3-KO MEFs (Fig. 6A and B) and the size of individual spherical mitochondria (Fig. 6C). Conversely, Slc25a3 (H75A) barely rescued mitochondrial morphology in Drp1Slc25a3-KO MEFs (Fig. 6A–C). These data suggest that the copper transport by Slc25a3 is important for mitochondrial morphology in the absence of Drp1. In addition, we found that the L175A mutant rescues the cristae structure in Slc25a3-KO cells while the H75A mutant does not (Fig. 6D). Furthermore, the L175A mutant fully rescued both basal and maximal OCRs in Slc25a3-KO cells, but the H75A mutant did not rescue basal OCRs and only partially increased maximal OCRs (Fig. 6E–G). These data suggest that copper transport activity by Slc25a3 is crucial for maintaining cristae structure and mitochondrial respiration.

Figure 6. The role of copper transport by Slc25a3 for mitochondrial morphology, cristae structure, and respiration.

(A) Drp1-KO MEFs and Drp1Slc25a3-KO MEFs expressing the mouse (m) and human (h) Slc25a3 were subjected to laser confocal immunofluorescence microscopy with antibodies to PDH and Tom20. The boxed regions are magnified. Scale bar, 10 μm. (B) Quantification of cells with spherical mitochondria (average ± SD, n = 3 experiments). In each experiment, 10 cells were analyzed. (C) The size of spherical mitochondria (average ± SD, n >70). (D) Mitochondria in the indicated MEFs were analyzed by transmission electron microscopy. Scale bar, 500 nm. (E) Mitochondrial respiration was analyzed by measuring OCRs in Slc25a3-KO MEFs expressing the indicated constructs. (F and G) The basal OCRs (F) and maximal OCRs (G) (average ± SD, n = 3). Significance was calculated using ANOVA with post-hoc Tukey in (C, F, and G): *p<0.05, ***p<0.001.

Copper-binding enzymes, superoxide dismutase 1 and cytochrome c oxidase, control flickering in opposite ways

Mitochondria contain two copper-containing enzymes, superoxide dismutase 1 (SOD1) and cytochrome c oxidase ⁴³. To test whether these enzymes play a role in flickering, we first treated Drp1-KO MEFs with a SOD1 inhibitor (LCS-1) and examined flickering. We found that LCS-1 elevated the flickering frequency in Drp1-KO MEFs (Fig. 7A) and, notably, in WT MEFs as well (Fig. 7B). In line with these observations, LCS-1 also decreased the levels of Opa1-L2-HA in Drp1-KO MEFs (Fig. 7C and D) and reduced the formation of enlarged mitochondria (Fig. 7E–G). Conversely, the overexpression of SOD1 resulted in a decrease in flickering frequency (Fig. 7H). These findings indicate that SOD1 acts as a negative regulator of mitochondrial flickering, Opa1 processing, and the formation of spherical mitochondria. Second, we tested the role of cytochrome c oxidase using its inhibitor NaN₃. In contrast to the SOD1 inhibitor LCS-1, NaN₃ treatment reduced flickering frequency in Drp1-KO MEFs (Fig. 7I). Therefore, it appears that copper affects flickering via two enzymes in an antagonistic way. SOD1 suppresses flickering while cytochrome c oxidase promotes it.

Figure 7. The effects of SOD1 and cytochrome c oxidase on flickering, and the impact of disease-associated Slc25a3 mutants on Opa1 processing and copper transport.

(A and B) Drp1-KO MEFs (A) and WT MEFs (B) were treated with 0.1 mM LCS-1 for 1 h and analyzed for flickering (average ± SD, n = 3 experiments). (C) Drp1-KO MEFs carrying Opa1 L2-HA were treated with LCS-1. The expression of L2-HA was induced for 4 h (0.1 μg/ml doxycycline). Western blotting was performed with the indicated antibodies. (D) Quantification of band intensity (average ± SD, n = 3). (E) Drp1-KO MEFs were treated with LCS-1 and then analyzed by laser confocal immunofluorescence microscopy with antibodies to DNA and Hsp60. Scale bar, 10 μm. (F) The percentage of cells with spherical mitochondria (average ± SD, n = 30). (G) The size of spherical mitochondria (average ± SD, n = 66 for DMSO and 98 for LCS-1). (H) Drp1-KO MEFs were transduced with lentiviruses carrying SOD1-FLAG and analyzed for flickering (average ± SD, n = 3 experiments). (I) Drp1-KO MEFs were treated with 1 mM NaN₃ for 1 h and analyzed for flickering (average ± SD, n = 3 experiments). (J) Western blotting of Drp1-KO MEFs and Drp1Slc25a3-KO MEFs expressing the indicated human Slc25a3 constructs. (K) Quantification of band intensity (average ± SD, n = 3). (L) Copper levels in mitochondria isolated from WT MEFs and Drp1Slc25a3-KO MEFs expressing either WT Slc25a3 or the G72E mutant were measured using atomic absorption spectrometry (average ± SD, n = 3 experiments). Significance was calculated using Student’s t-test in (A, B, D, G, H, and I) and ANOVA with post-hoc Tukey in (K and L): *p<0.05, **p<0.01, ***p<0.001. See also Figure S7.

The pathogenic mutation G72E inhibits the copper transport activity of human Slc25a3

Defects in human Slc25a3 lead to fatal mitochondrial defects with symptoms of lactic acidosis, hypertrophic cardiomyopathy, and neonatal hypotonia ^{30,31,44–46}. To test the impact of disease-associated mutations on flickering, we cloned human Slc25a3 and introduced the disease-associated G72E mutation in the first transmembrane α-helix ³¹. WT human Slc25a3 rescued Opa1 cleavage in Drp1Slc25a3-KO MEFs, while Slc25a3 (G72E) failed to do so, although their expression levels were similar (Fig. 7J and K). This result concerning Opa1 processing was confirmed by employing Opa1-L2-HA (Fig. S7C and D). Similarly, the G72E mutation blocked the ability of Slc25a3 to rescue flickering frequency (Fig. 5E) and mitochondrial morphology (Fig. 6A–C) in Drp1Slc25a3-KO MEFs. In addition, we found that the G72E mutant failed to restore cristae morphology and mitochondrial respiration in Slc25a3-KO MEFs (Fig. 6D–G). Finally, atomic absorption spectrometry of isolated mitochondria showed that Slc25a3 (G72E) could not replenish mitochondrial copper levels in Drp1Slc25a3-KO MEFs (Fig. 7L). These findings suggest that the pathogenic G72E mutation impairs the copper transport activity of human Slc25a3, thereby affecting its critical role in maintaining mitochondrial structure and function.

Discussion

The mitochondrial defense mechanism, MitoSafe, regulates a balance between mitochondrial fusion and division when mitochondria are hyper-fused. MitoSafe decreases levels of outer membrane fusion proteins, Mfn1 and Mfn2, by the ubiquitin E3 ligase Parkin and the protein kinase PINK1, and proteolytically inactivates Opa1 by the metalloprotease Oma1, which is activated by the flickering of the mitochondrial membrane potential ^19–21. In the current study, using a live-cell imaging-based gene knockdown screen, we report that the carrier protein Slc25a3 in the mitochondrial inner membrane plays a critical role in flickering in hyper-fused mitochondria. Slc25a3 transports phosphate and copper ions across the inner membrane using the proton gradient ^32,33. We found that the transport of copper, rather than phosphate, by Slc25a3 is critical for flickering in MitoSafe.

Copper is an essential heavy metal but highly toxic in cells ⁴³. The concentration of free copper in cells is extremely low (estimated < 1 attomolar) and tightly regulated ⁴⁷. Excess or reduced levels of copper cause human diseases such as Wilson’s disease (due to copper overload) and Menkes disease (due to copper deficiency), both of which are associated with impaired mitochondrial function ⁴⁸. In mitochondria, copper is required for complex IV (cytochrome c oxidase) and an antioxidant enzyme, superoxide dismutase 1 (SOD1). Cytochrome c oxidase is a multisubunit enzyme that contains copper-binding subunits such as Cox1 and Cox2 for the catalytic activity. SOD1 converts superoxide to hydrogen peroxide in the cytosol and mitochondria, binds to copper, and uses it as a cofactor along with zinc. It has been shown that the loss of Slc25a3 alters levels of copper in the matrix, cytochrome c oxidase function, and SOD1 activities in cells ³². As downstream effectors of copper, we found that cytochrome c oxidase and SOD1 function in flickering. Interestingly, they antagonistically control flickering. While cytochrome c oxidase stimulates flickering, SOD1 suppresses it.

How do cytochrome c oxidase and SOD1 regulate flickering? Cytochrome c oxidase facilitates the generation of membrane potential across the inner membrane as part of the electron transport chain; thus, inhibition of cytochrome c oxidase may decrease the membrane potential, which could influence flickering in Drp1-KO cells. This model aligns with the observation that the complex V inhibitor oligomycin, which induces the hyperpolarization of the inner membrane, stimulates flickering ¹⁹. However, since we observed normal levels of membrane potential in Drp1Slc25a3-KO cells, this possibility is unlikely. Alternatively, since SOD1 counteracts mitochondrial ROS, cytochrome c oxidase and SOD1 might affect ROS levels in Drp1-KO cells in opposite ways. The role of cytochrome c oxidase in ROS production is highly context-dependent, and its inhibition can lead to decreased ROS production ^49–51. In scenarios where the electron transport chain is dysfunctional and hyperactive, an increased flow of electrons can enhance the probability of electron leakage and subsequent ROS formation, particularly at complexes I and III, known sites of superoxide generation ^49–51. Inhibiting cytochrome c oxidase could slow the electron flow, potentially reducing the chance of electron leakage and the formation of ROS. This model is consistent with our observations that Drp1-KO MEFs maintain relatively normal levels of basal OCRs but exhibit decreased respiratory capacity, suggesting that the mitochondria are dysfunctional and excessively utilize spare respiratory capacity. Moreover, Drp1-KO cells display elevated levels of oxidative damage ⁵². Therefore, it is conceivable that SOD1 and cytochrome c oxidase impact ROS in this specific mitochondrial condition in Drp1-KO cells. This model predicts that a yet-to-be-identified mitochondrial flickering pore is likely regulated by ROS. An important future direction is to elucidate its molecular identity.

Deficiency in human Slc25a3 leads to mitochondrial disorders, manifested by cardiomyopathy, hypotonia, and lactic acidosis ^30,31,44,45. Our findings indicate that the pathogenic mutation G72E impairs Slc25a3’s role in mitochondrial copper transport, cristae structure, and mitochondrial respiration. Strikingly, our analysis of the mouse H75A and L175A mutants demonstrates that defects are more profoundly affected by the absence of copper transport than by phosphate transport. These data suggest that diseases associated with Slc25a3 deficiencies may primarily arise from disruptions in copper transport rather than phosphate transport. We propose that targeting mitochondrial copper bioavailability with copper-containing compounds, such as Cu-ATSM, could offer an effective treatment for Slc25a3-related diseases.

Limitation of the study

There are several key questions that remain to be addressed. For example, identifying a specific type of ROS that controls flickering would be important. We are also interested in deciphering the dynamics of copper during mitochondrial fusion, division, and flickering. Furthermore, investigating the role of copper-dependent mitochondrial defense mechanisms in vivo would provide further insight into the physiological regulation of mitochondrial dynamics.

STAR Methods

Resource Availability

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Hiromi Sesaki (hsesaki@jhmi.edu).

Materials Availability

All unique reagents generated in this study are available from the lead contact with a completed materials transfer agreement.

Data and Code Availability

• All data reported in this paper will be shared by the lead contact upon request.

• This paper does not report original code.

• Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Experimental Model and Study Participant Details

Cells

MEFs were cultured in Iscove’s modified Dulbecco’s medium containing 10% fetal bovine serum ⁵⁴. HEK293T cells were cultured in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum. Slc25a3-KO, Drp1Slc25a3-KO, Oma1-KO, and Drp1Oma1-KO MEFs and Drp1-KO HEK293T cells were generated using a GeneArt CRISPR Nuclease (OFP Reporter) Vector Kit (A21174; Thermo Fisher Scientific) following the manufacturer’s instructions. The target gRNA sequence was 5′-TTGGTGGGGTCTTAAGTTGT-3′ for Slc25a3-KO MEFs, 5′-GAGTGAATAACCTGGCCAAC-3′ for Oma1-KO MEFs, and 5′-GCCTGTAGGTGATCAACCTA-3′ for Drp1-KO HEK293T cells. Drp1Slc25a3-KO and Drp1Oma1-KO MEFs were generated by introducing the gRNA into Drp1-KO MEFs ¹⁹. Based on OFP fluorescent signal, transfected cells were sorted in 96-well plates as single cells at the Johns Hopkins School of Medicine Flow Cytometry Core ⁵⁶. The loss of Slc25a3, Oma1, and Drp1 was confirmed by Western blotting.

Method Details

Flickering assay

To observe flickering in MEFs, cells were plated at a density of 20,000 or 40,000 cells/well in 8-well chambered coverglasses and cultured for 24 h ¹⁹. Cells were then stained with 5 nM TMRE in Iscove’s modified Dulbecco’s medium containing 10% FBS at 37°C with 5% CO₂ for 15 min and examined using a Zeiss LSM800 GaAsP confocal microscope with a 40× objective lens at 37°C with 5% CO₂. To minimize potential phototoxicity, images were obtained at 10-s intervals for 30 min at a single focal plane ¹⁹. In the esiRNA-based screen, cells were plated at a density of 15,000 cells/well for Drp1-KO MEFs and 2000 cells/well for Drp1-KO HEK293T cells in 8-well chambered coverglasses and cultured for 24 h. Cells were transfected with esiRNAs (Eupheria Biotech) at 100 ng/well using Lipofectamine RNAiMAX (Invitrogen). After 3 days, the culture medium was replaced with fresh medium and cells were transfected with esiRNAs again. Cells were cultured for an additional 2 days. Cells were stained with 5 nM TMRE and were viewed as described above. To quantify flickering, we counted cells that showed flickering at least once during the observation period of 30 min. We repeated the experiments three times, except for the esiRNA screen, in which we repeated the experiment twice. In each experiment, we analyzed more than 30 cells.

Plasmids

To generate shRNA plasmids, the following target sequences were cloned into pLKO.1. Scramble: CCTAAGGTTAAGTCGCCCTCGctcgagCGAGGGCGACTTAACCTTAGG, Ccdc51: GAAGAGAAGAGGCTCCGAATActcgagTATTCGGAGCCTCTTCTCTTC and GTGAACAGGCTTCTAGCTATTctcgagAATAGCTAGAAGCCTGTTCAC, Mpv17: CCCACGAATAGACACGCATTTctcgagAAATGCGTGTCTATTCGTGGG and GCTGGATCACTGATGGGCGTActcgagTACGCCCATCAGTGATCCAGC, Slc25a3: GCAACATACTTGGTGAGGAAActcgagTTTCCTCACCAAGTATGTTGC and CGACTCTGTGAAGGTCTACTTctcgagAAGTAGACCTTCACAGAGTCG, Slc25a40: CATCCACCTCTAGATCATAATctcgagATTATGATCTAGAGGTGGATG.

The tetracycline-inducible lentiviral vector pInducer20 carrying HA-tagged Opa1 (L2-HA) was previously generated ¹⁹. To induce the expression of L2-HA, MEFs were incubated with 0.1 μg/ml doxycycline for 4 h ¹⁹. Mouse Slc25a3 was PCR-amplified from total cDNAs of WT MEFs using the following primers, 5’-TAGGGATCCGCCACCATGTTCTCGTCCGTAGCGCACC-3’ and 5’-TAGGCGGCCGCCTACTCAGTTAACCCAAGCTTCTTCTTCAGAG-3’, and cloned into the BamHI and Not I sites of the pHR-Sin plasmid. Codon-optimized human Slc25a3 was PCR-amplified from the pDONR221_SLC25A3 plasmid (132040, Addgene) using primers 5’-AGACTGAGTCGCCCGGGGGGGATCCGCCACCATGTTCAGCTCCGTGGCACAC-3’ and 5’-CAGGTCGACTCTAGAGTCGCGGCCGCCTACTGTGTCAGGCCCAGCTTC-3’, and cloned into the pHR-Sin plasmid digested with BamHI and Not I using Gibson Assembly (E2611, New England Biolabs). The mutant Slc25a3 plasmids were generated by replacing the nucleotides (223C>G and 224A>C for mouse H75A, 523C>G and 524T>C for mouse L175A, and 215G>A and 216C>G for human G72E) in the wildtype Slc25a3 plasmids. Mutations are underlined in the sequences below. First, two partial fragments of Slc25a3 were PCR-amplified from the wildtype Slc25a3 plasmids using the following primers. H75A: 5’-TAGGGATCCGCCACCATGTTCTCGTCCGTAGCGCACC-3’ and 5’-CAACAGCAGTGGCTGTCAGCCCAC-3’. and 5’-GTGGGCTGACAGCCACTGCTGTTG-3’ and 5’-TAGGCGGCCGCCTACTCAGTTAACCCAAGCTTCTTCTTCAGAG-3’. L175A: 5’-TAGGGATCCGCCACCATGTTCTCGTCCGTAGCGCACC-3’ and 5’-CATAGGAGCCGCGGCAATGTCAG-3’, and 5’-CTGACATTGCCGCGGCTCCTATG-3’ and 5’-TAGGCGGCCGCCTACTCAGTTAACCCAAGCTTCTTCTTCAGAG-3’. G72E: 5’-AGACTGAGTCGCCCGGGGGGGATCCGCCACCATGTTCAGCTCCGTGGCACAC-3’ and 5’-TGATCTCGCCCAGGCCGCACAG-3’, and 5’-GGCCTGGGCGAGATCATCTCCTG-3’ and 5’-CAGGTCGACTCTAGAGTCGCGGCCGCCTACTGTGTCAGGCCCAGCTTC-3’. Second, full-length Slc25a3 mutants were PCR-amplified from the two products of the first PCR using the following primers. H75A and L175A: 5’-TAGGGATCCGCCACCATGTTCTCGTCCGTAGCGCACC-3’ and 5’-TAGGCGGCCGCCTACTCAGTTAACCCAAGCTTCTTCTTCAGAG-3’, and G72E: 5’-AGACTGAGTCGCCCGGGGGGGATCCGCCACCATGTTCAGCTCCGTGGCACAC-3’ and 5’-CAGGTCGACTCTAGAGTCGCGGCCGCCTACTGTGTCAGGCCCAGCTTC-3’. The PCR products were cloned into the BamHI and Not I sites of the pHR-Sin plasmid.

Lentivirus

HEK293T cells were seeded at 1.5 × 10⁶ cells in a 10-cm dish and cultured for 24 h. To produce lentiviruses, 3 μg of the pHR-Sin plasmid carrying Slc25a3, the pInducer20 plasmid carrying L2-HA, or pLKO. 1 carrying shRNAs was co-transfected into HEK293T cells along with 3 μg of pHR-CMV8.2ΔR (for pHR-Sin and pLKO.1) or pHR-CMV8.9ΔR (for pInducer20), and 0.3 μg of pCMV-VSVG using Lipofectamine 2000 (Invitrogen) ^19,41. After 20–22 h, the culture medium was replaced with fresh medium. After an additional 24 h, the culture medium containing the released viruses was collected. Lentiviruses carrying L2-HA were concentrated using Lenti-X Concentrator (Clontech). For lentiviral transduction, MEFs were seeded at 8 × 10⁴ cells/well in a 6-well plate and cultured for 24 h. Cells were then incubated with lentivirus in the cell culture medium containing 10% FBS and 8 μg/ml polybrene for 24 h.

Western blotting

Cells were harvested and lysed in RIPA buffer (9806S, Cell Signaling Technology) supplemented with cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail (11836170001, Roche) on ice ¹⁹. The lysates were centrifuged at 16,000 g for 10 min at 4°C, and the supernatants were collected. Proteins were separated by SDS-PAGE and transferred onto Immobilon-FL Transfer Membrane (Millipore). The membranes were blocked in PBS-T (PBS containing 0.05% Tween 20) containing 3% BSA at room temperature for 1 h and then incubated with primary antibodies in PBS-T containing 3% BSA at 4°C overnight. The antibodies used were Opa1 (1:1,000 dilution, 612607; BD Biosciences), Drp1 (1:2,000 dilution, 611113; BD Biosciences), Slc25a3 (1:1,000 dilution, H00005250-B02P; Novus Biologicals) (Fig. 2A, 2C, 5H, S3A, and S7A), Slc25a3 (1:1,000 dilution, 10420-1-AP; Proteintech) (Fig. 7K and S7C), mitofusin 1 (1:1,000 dilution, ab126575; Abcam), mitofusin 2 (1:1,000 dilution, ab57602; Abcam), α-tubulin (1:1,000 dilution, 2125; Cell Signaling Technology), HA (1:2,000 dilution, NB600-362; Novus Biologicals), Mff (a kind gift from Dr. Alexander M. van der Bliek, UCLA)⁵³, Fis1 (1:1,000, 10956-1-AP, Proteintech), MiD49 (1:1,000, 16413-1-AP, Proteintech), and Oma1 (1:1,000, sc-515788, Santa Cruz Biotechnology). The membranes were washed three times in PBS-T, followed by incubation with appropriate secondary antibodies at room temperature for 1 h. After washing the membranes three times in PBS-T, fluorescence signals were detected using a Typhoon laser-scanner platform (Amersham). To quantify band intensity, we magnified Western blot images using the NIH FIJI program and selected individual bands using a box tool. We also selected a background area in the vicinity of the bands using a box tool of the same dimensions. Band intensity was determined after subtracting the background intensity. We also developed a method to analyze individual isoforms using a line scan tool in FIJI when they are closely located ⁵⁷.

Measurements of the mitochondrial membrane potential

The mitochondrial membrane potential was measured using Cell Meter NIR Mitochondrial Membrane Potential Assay Kit (AAT Bioquest) following the manufacturer’s instructions ¹⁹. MEFs were first incubated with MitoLite NIR at 37°C and 5% CO₂ for 30 min. MEFs were resuspended in 1 ml of the supplied assay buffer and filtered through a 70 μm cell strainer (22363548, Fisher Scientific). The fluorescence intensity was measured using a FACSCalibur (BD Biosciences).

qPCR

Cells were plated on 12-well plates. Total RNA was purified from the cells using the RNeasy Mini Kit (74106, Qiagen) and reverse-transcribed using the ReadyScript cDNA Synthesis Mix (RDRT, Sigma-Aldrich). PCR was performed using the QuantStudio 3 Real-Time PCR System (Applied Biosystems) with the PowerUp SYBR Green Master Mix (A25741, Thermo Fisher Scientific). GAPDH was used as the reference gene. The following primers were used: 5’-TTCTTCACTGCAGGTTCACCTG-3’ and 5’-AGAGAATGAGCTCACCAAGCAG-3’ for Opa1-L1, 5’-TTCTTCACTGCAGGTTCACCTG-3’ and 5’-TTCTTTGTCTGACACCTTCCTGTAA-3’ for Opa1-L2, and 5’-AAGGTCATCCCAGAGCTGAA-3’ and 5’-CTGCTTCACCACCTTCTTGA-3’ for GAPDH.

Immunofluorescence microscopy

MEFs were fixed in pre-warmed (37°C) PBS containing 4% paraformaldehyde for 20 min, washed three times in PBS, permeabilized with PBS containing 0.1% Triton X-100 for 8 min, washed again three times in PBS, and blocked in PBS containing 0.5% BSA at room temperature for 1 h ^19,58. Cells were then incubated with anti-PDH antibody (1:300 in PBS containing 0.5% BSA, ab110333; Abcam), anti-Tom20 antibody (1:300, sc-11415; Santa Cruz Biotechnology), anti-DNA antibody (1:200, 690014S; PROGEN) and anti-Hsp60 antibody (1:400, 12165; Cell Signaling Technology) at 4°C overnight. Cells were washed three times in PBS and incubated with appropriate secondary antibodies at room temperature for 1 h, including Alexa 488-conjugated anti-mouse IgG (1:400 in PBS, A21202, Thermo Fisher Scientific), Alexa 568-conjugated anti-rabbit IgG (1:400, A10042, Thermo Fisher Scientific), Alexa 568-conjugated anti-mouse IgM (1:400, A21043, Thermo Fisher Scientific) and Alexa 647-conjugated anti-rabbit IgG (1:400, A31573, Thermo Fisher Scientific). Cells were washed three times in PBS. The samples were observed using an LSM800 GaAsP laser scanning confocal microscope ^41,59. The size of enlarged spherical mitochondria was quantified using the NIH FIJI program (Fig. 3C, 4F, 4H, 4J, 6C, and S6C). To select such mitochondria, images displaying PDH or Hsp60 were first binarized. Then, the circularity parameter was set between 0.5 and 1.0, and a size cutoff threshold of greater than 2 μm² was applied to ensure the selection of appropriately shaped mitochondria. The area of the selected mitochondria was then determined.

Electron microscopy

MEFs were fixed by 2% glutaraldehyde, 3 mM CaCl₂ and 0.1 M cacodylate buffer, pH 7.4, for 1 h. After washes, samples were post-fixed in 1% OsO₄, 1%. potassium hexacyanoferrate, and 0.1 M cacodylate, pH 7.4, for 1 h on ice. After washes in water, samples were incubated in 2% uranyl acetate for 30 min on ice. After dehydration using 50, 70, 90, and 100% ethanol, samples were embedded in EPON resin. Ultrathin sections were obtained using a Reichert-Jung ultracut E, stained with 2% uranyl acetate and lead citrate, and viewed using a transmission electron microscope (H-7600; Hitachi) equipped with a dual CCD camera (Advanced Microscopy Techniques).

Live-cell imaging for mitochondrial DNA

MEFs were plated at 10,000 cells/well in 8-well chambered coverglasses and cultured for 24 h. Cells were incubated with 200 nM MitoTracker Red CMXRos (M7512, Thermo Fisher Scientific) and SYBR Green I Nucleic Acid Gel Stain (1:100,000 dilution, S7563, Thermo Fisher Scientific) in Iscove’s modified Dulbecco’s medium containing 10% FBS at 37°C with 5% CO₂ for 15 min. The samples were observed using an LSM800 GaAsP laser scanning confocal microscope at 37°C with 5% CO₂.

Mitochondrial respiration

Mitochondrial OCRs were measured using an XF96 Extracellular Flux Analyzer (Seahorse Bioscience) ^19,41. MEFs were seeded at 5,000 cells/well in an XF 96-well culture microplate and cultured for 24 h. MEFs were washed twice in XF base medium supplemented with 25 mM glucose, 4 mM L-glutamine, and 1 mM sodium pyruvate, and then cells were incubated at 37°C in a CO₂-free incubator for 1 h. OCR measurement was performed according to the manufacturer’s instructions. Baseline OCR was recorded three times, and then, 1.6 μg/ml oligomycin, 1 μM FCCP, and 0.5 μM rotenone/antimycin A were sequentially injected into each well.

Glycolysis

Glycolysis was measured by analyzing the extracellular acidification rate (ECAR) using an XF96 Extracellular Flux Analyzer (Seahorse Bioscience). Cells were seeded at 5000 cells/well in an XF 96-well culture microplate and cultured for 24 h. Cells were washed twice in XF base medium supplemented with 4 mM L-glutamine, then incubated at 37°C in a CO₂-free incubator for 1 h. ECAR measurement was performed according to the manufacturer’s instructions. Non-glycolytic acidification was recorded three times, and then 10 mM glucose, 1.6 μg/ml oligomycin, and 50 mM 2-deoxyglucose were sequentially injected into each well.

Copper measurements

MEFs were cultured in ten 10-cm dishes. The plates were washed with ice-cold PBS and then placed on ice. The cells were suspended in 1 ml/dish of homogenization buffer [10 mM HEPES-KOH buffer (pH 7.4) containing 0.22 M mannitol, 0.07 M sucrose, and protease inhibitors (11836170001, Roche)] and collected using a cell scraper. The cells were then washed twice for 5 minutes each at 4°C. To isolate the mitochondria, cells were homogenized with 10 strokes using a syringe fitted with a 27-gauge needle in the same buffer. The postnuclear supernatant was obtained by centrifugation at 800 g for 10 minutes at 4 °C, followed by an additional 5 minutes. The supernatant was further separated into a mitochondria-enriched pellet by centrifugation at 8,000 g for 10 minutes at 4°C. The pellet was washed in the homogenization buffer and centrifuged again at 8,000 g for 10 minutes at 4°C. The mitochondria-enriched pellet was resuspended in 50 μl of 20 mM HEPES buffer, pH 7.4, containing 1 mM EDTA, 1 mM EGTA, 8.5% sucrose, 0.1% NP-40, 0.2% Triton X-100, 1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF), and protease inhibitors (11836170001, Roche) and stored at −80°C. 30 μl of the mitochondria lysates were mixed with 55 μl of HNO₃ (Trace metal free, A509P212, Fisher Chemical) in metal-free 1.5 ml tubes (616201, Greiner Bio-One) and incubated at 70°C for 4 hours. Samples were mixed with 115 μl of UltraPure Distilled water (10977, Invitrogen) and stored at 4°C. Copper amounts in 20 μl of samples were determined using atomic absorption spectrometry (PinAAcle 900T, Perkin Elmer) with copper standards (5 ppb – 50 ppb, SC194-500, Fisher Scientific) and normalized relative to protein concentration using the Syngistix AA software version 3.1 for measurement and analysis.

Quantification and statistical analysis

All statistical analyses were performed using Prism (GraphPad). All of the statistical details are described in each figure legend.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse monoclonal anti-Opa1	BD Biosciences	Cat# 612607; RRID: AB_399889
Mouse monoclonal anti-Drp1	BD Biosciences	Cat# 611113; RRID: AB_398424
Mouse polyclonal anti-Slc25a3	Novus Biologicals	Cat# H00005250-B02P; RRID: AB_2270489
Rabbit polyclonal anti-Slc25a3	Proteintech	Cat# 10420-1-AP; RRID: AB_2877735
Mouse monoclonal anti-mitofusin 1	Abcam	Cat# ab126575; RRID: AB_11141234
Mouse monoclonal anti-mitofusin 2+ mitofusin 1	Abcam	Cat# ab57602; RRID: AB_2142624
Rabbit monoclonal anti-α-Tubulin	Cell Signaling Technology	Cat# 2125; RRID: AB_2619646
Goat polyclonal anti-HA	Novus Biologicals	Cat# NB600-362; RRID: AB_10124937
Rabbit polyclonal anti-Mff	Gandre-Babbe and van der Bliek53	N/A
Rabbit polyclonal anti-Fis1	Proteintech	Cat# 10956-1-AP; RRID: AB_2102532
Rabbit polyclonal anti-Mid49	Proteintech	Cat# 16413-1-AP; RRID: AB_2714217
Mouse monoclonal anti-Oma1	Santa Cruz Biotechnology	Cat# sc-515788; RRID: AB_2905488
Mouse monoclonal anti-PDH	Abcam	Cat# ab110333; RRID: AB_10862029
Rabbit polyclonal anti-Tom20	Santa Cruz Biotechnology	Cat# sc-11415; RRID: AB_2207533
Mouse monoclonal anti-DNA	PROGEN	Cat# 690014S; RRID: AB_2750935
Rabbit monoclonal anti-Hsp60	Cell Signaling Technology	Cat# 12165; RRID: AB_2636980
Alexa 488-conjugated anti-mouse IgG	Thermo Fisher Scientific	Cat# A21202; RRID: AB_141607
Alexa 488-conjugated anti-rabbit IgG	Thermo Fisher Scientific	Cat# A21206; RRID: AB_2535792
Alexa 488-conjugated anti-goat IgG	Thermo Fisher Scientific	Cat# A21467; RRID: AB_2535870
Alexa 568-conjugated anti-rabbit IgG	Thermo Fisher Scientific	Cat# A10042; RRID: AB_2534017
Alexa 568-conjugated anti-mouse IgM	Thermo Fisher Scientific	Cat# A21043; RRID: AB_2535712
Alexa 647-conjugated anti-rabbit IgG	Thermo Fisher Scientific	Cat# A31573; RRID: AB_2536183
Chemicals, peptides, and recombinant proteins
Iscove’s modified Dulbecco’s medium (IMDM)	Gibco	Cat# 12440-053
Dulbecco’s Modified Eagle’s Medium (DMEM) – high glucose	Sigma-Aldrich	Cat# D5796
Fetal Bovine Serum (FBS)	Corning	Cat# 35-010-CV
Tetramethylrhodamine, ethyl ester (TMRE)	Thermo Fisher Scientific	Cat# T669
Lipofectamine 2000 Transfection Reagent	Thermo Fisher Scientific	Cat# 11668019
Lipofectamine RNAiMAX Transfection Reagent	Thermo Fisher Scientific	Cat# 13778150
Phusion High-Fidelity DNA Polymerase	NEB	Cat# M0530
Quick Ligation Kit	NEB	Cat# M2200
Gibson Assembly Master Mix	NEB	Cat# E2611
Lenti-X Concentrator	Takara Bio	Cat# 631231
Polybrene Infection/Transfection Reagent	MilliporeSigma	Cat# TR-1003-G
RIPA Buffer (10X)	Cell Signaling Technology	Cat# 9806S
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail	Roche	Cat# 11836170001
4–20% Criterion TGX Precast Gels	Bio-Rad Laboratories	Cat# 5671095
7.5% Criterion TGX Precast Gels	Bio-Rad Laboratories	Cat# 5671025
Sodium cacodylate, trihydrate	Electron Microscopy Sciences	Cat# 12300
25% glutaraldehyde	Electron Microscopy Sciences	Cat# 16220
4% Osmium Tetroxide (OsO4)	Electron Microscopy Sciences	Cat# 19190
Potassium hexacyanoferrate(II), trihydrate	Sigma-Aldrich	Cat# P3289
Uranyl acetate	Ted Pella, Inc.	Cat# 19481
EMBED 812 RESIN	Electron Microscopy Sciences	Cat# 14900
DDSA	Electron Microscopy Sciences	Cat# 13710
NMA	Electron Microscopy Sciences	Cat# 19000
DMP-30	Electron Microscopy Sciences	Cat# 13600
MitoTracker Red CMXRos	Thermo Fisher Scientific	Cat# M7512
SYBR Green I Nucleic Acid Gel Stain	Thermo Fisher Scientific	Cat# S7563
Seahorse XF Base Medium Minimal DMEM	Agilent	Cat# 102353-100
L-Glutamine (200 mM)	Gibco	Cat# 25030081
Sodium pyruvate (100 mM)	Sigma-Aldrich	Cat# S8636
D-Glucose	Sigma-Aldrich	Cat# G7021
Oligomycin	Sigma-Aldrich	Cat# O4876
FCCP	Sigma-Aldrich	Cat# C2920
Antimycin A	Sigma-Aldrich	Cat# A8674
Rotenone	Sigma-Aldrich	Cat# R8875
2-Deoxy-D-glucose	MilliporeSigma	Cat# 25972-1GM
Cu-ATSM	Sigma-Aldrich	Cat# SML0769
LCS-1 (SOD1 inhibitor)	Sigma-Aldrich	Cat# 567417
Sodium azide (NaN3)	Sigma-Aldrich	Cat# S2002
DPBS	Corning	Cat# 21-031-CV
HEPES	Thermo Fisher Scientific	Cat# BP310-100
D-Mannitol	Sigma-Aldrich	Cat# M4125
Sucrose	Thermo Fisher Scientific	Cat# S5-3
EDTA	Thermo Fisher Scientific	Cat# BP120-500
EGTA	AMRESCO	Cat# 0732-100G
NP-40	Sigma-Aldrich	Cat# I8896
Triton X-100	Sigma-Aldrich	Cat# T9284
4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF)	Sigma-Aldrich	Cat# 5.08436.0001
Nitric Acid (Trace Metal Grade)	Fisher Chemical	Cat# A509P212
UltraPure Distilled water	Invitrogen	Cat# 10977015
Critical commercial assays
GeneArt CRISPR Nuclease Vector with OFP Reporter Kit	Thermo Fisher Scientific	Cat# A21174
Cell Meter NIR Mitochondrial Membrane Potential Assay Kit	AAT Bioquest	Cat# 22802
RNeasy Mini Kit	Qiagen	Cat# 74106
ReadyScript® cDNA Synthesis Mix	Sigma-Aldrich	Cat# RDRT
PowerUp SYBR Green Master Mix	Thermo Fisher Scientific	Cat# A25741
Seahorse XFe96/XF Pro FluxPak	Agilent	Cat# 103792-100
Experimental models: Cell lines
Mouse embryonic fibroblasts (MEFs)	Wakabayashi et al.54	N/A
Drp1-KO MEFs	Wakabayashi et al.54	N/A
Slc25a3-KO MEFs	This paper	N/A
Drp1Slc25a3-KO MEFs	This paper	N/A
Oma1-KO MEFs	This paper	N/A
Drp1Oma1-KO MEFs	This paper	N/A
HEK293T cells	ATCC	CRL-3216
Drp1-KO HEK293T cells	This paper	N/A
Oligonucleotides
esiRNA: control	Eupheria Biotech	Cat# EHURLUC-2.50UG
esiRNA: Tmem205	Eupheria Biotech	Cat# EMU0105111UG
esiRNA: Tmem14c	Eupheria Biotech	Cat# EMU0178111UG
esiRNA: Tmem65	Eupheria Biotech	Cat# EMU1989411UG
esiRNA: Slc25a3	Eupheria Biotech	Cat# EMU0279111UG
esiRNA: Slc25a25	Eupheria Biotech	Cat# EMU0492911UG
esiRNA: Slc25a24	Eupheria Biotech	Cat# EMU0620011UG
esiRNA: Slc25a23	Eupheria Biotech	Cat# EMU0811411UG
esiRNA: Slc25a41	Eupheria Biotech	Cat# EMU0747211UG
esiRNA: Slc25a14	Eupheria Biotech	Cat# EMU0148611UG
esiRNA: Romo1	Eupheria Biotech	Cat# EMU0941811UG
esiRNA: Slc8b1	Eupheria Biotech	Cat# EMU0563811UG
esiRNA: Mpv17	Eupheria Biotech	Cat# EMU0414011UG
esiRNA: Ccdc51	Eupheria Biotech	Cat# EMU0644611UG
esiRNA: Sfxn2	Eupheria Biotech	Cat# EMU0852311UG
esiRNA: Sfxn4	Eupheria Biotech	Cat# EMU0708411UG
esiRNA: Slc25a39	Eupheria Biotech	Cat# EMU0863411UG
esiRNA: Slc25a27	Eupheria Biotech	Cat# EMU0151411UG
esiRNA: Slc25a40	Eupheria Biotech	Cat# EMU0715211UG
esiRNA: Ucp2	Eupheria Biotech	Cat# EMU0245211UG
esiRNA: Slc25a43	Eupheria Biotech	Cat# EMU0742911UG
esiRNA: Slc25a47	Eupheria Biotech	Cat# EMU0050811UG
esiRNA: Mtch1	Eupheria Biotech	Cat# EMU0129211UG
esiRNA: Mtch2	Eupheria Biotech	Cat# EMU0506811UG
esiRNA: Mrs2	Eupheria Biotech	Cat# EMU1814811UG
esiRNA: PXMP2	Eupheria Biotech	Cat# EHU0368411UG
esiRNA: SLC25A30	Eupheria Biotech	Cat# EHU0889811UG
esiRNA: SLC25A35	Eupheria Biotech	Cat# EHU0158111UG
esiRNA: UCP1	Eupheria Biotech	Cat# EHU0510211UG
esiRNA: UCP3	Eupheria Biotech	Cat# EHU0730811UG
esiRNA: SLC25A34	Eupheria Biotech	Cat# EHU1545611UG
shRNA targeting sequence: scramble: CCTAAGGTTAAGTCGCCCTCG	Addgene	1864
shRNA targeting sequence: Ccdc51 #1: GAAGAGAAGAGGCTCCGAATA	Sigma-Aldrich	TRCN0000251923
shRNA targeting sequence: Ccdc51 #2: GTGAACAGGCTTCTAGCTATT	Sigma-Aldrich	TRCN0000248576
shRNA targeting sequence: Mpv17 #1: CCCACGAATAGACACGCATTT	Sigma-Aldrich	TRCN0000120697
shRNA targeting sequence: Mpv17 #2: GCTGGATCACTGATGGGCGTA	Sigma-Aldrich	TRCN0000120699
shRNA targeting sequence: Slc25a3 #1: GCAACATACTTGGTGAGGAAA	Sigma-Aldrich	TRCN0000070020
shRNA targeting sequence: Slc25a3 #2: CGACTCTGTGAAGGTCTACTT	Sigma-Aldrich	TRCN0000070021
shRNA targeting sequence: Slc25a40: CATCCACCTCTAGATCATAAT	Sigma-Aldrich	TRCN0000432566
CRISPR KO targeting sequence: human Drp1: GCCTGTAGGTGATCAACCTA	This paper	N/A
CRISPR KO targeting sequence: mouse Slc25a3: TTGGTGGGGTCTTAAGTTGT	This paper	N/A
CRISPR KO targeting sequence: mouse Oma1: GAGTGAATAACCTGGCCAAC	This paper	N/A
qPCR primers for Opa1-L1, Opa1-L2 and GAPDH	This paper	N/A
Recombinant DNA
pHR-CMV8.2ΔR	Addgene	8455
pHR-CMV8.9ΔR	Murata et al.19	N/A
pCMV-VSVG	Addgene	8454
pHR-Sin Su9-GFP	Murata et al.19	N/A
pLKO.1 scrambled shRNA	This paper	N/A
pLKO.1 Ccdc51 shRNA #1	This paper	N/A
pLKO.1 Ccdc51 shRNA #2	This paper	N/A
pLKO.1 Mpv17 shRNA #1	This paper	N/A
pLKO.1 Mpv17 shRNA #2	This paper	N/A
pLKO.1 Slc25a3 shRNA #1	This paper	N/A
pLKO.1 Slc25a3 shRNA #2	This paper	N/A
pLKO.1 Slc25a40 shRNA	This paper	N/A
pInducer20 human Opa1(L2)-HA	Murata et al.19	N/A
mUNG1(Y147A)	Addgene	70110
pHR-Sin mUNG1(Y147A)	This paper	N/A
Human Slc25a3	Addgene	132040
pHR-Sin mouse Slc25a3(WT)	This paper	N/A
pHR-Sin mouse Slc25a3(H75A)	This paper	N/A
pHR-Sin mouse Slc25a3(L175A)	This paper	N/A
pHR-Sin human Slc25a3(WT)	This paper	N/A
pHR-Sin human Slc25a3(G72E)	This paper	N/A
Human SOD1	Wang et al.55	N/A
pHR-Sin human SOD1	This paper	N/A
Software and algorithms
MitoCarta3.0	Rath et al.28	www.broadinstitute.org/mitocarta
FIJI	NIH	https://imagej.net/software/fiji/downloads
Prism	GraphPad	https://www.graphpad.com/features
Design & Analysis Software	Thermo Fisher Scientific	https://www.thermofisher.com/us/en/home/technical-resources/software-downloads/quantstudio-3-5-real-time-pcr-systems.html
Syngistix for AA Software	PerkinElmer	https://www.perkinelmer.com/product/syngistix-for-aa-standard-sw-assembly-n1010302

Highlights.

• Flickering prevents harmful extreme mitochondrial fusion by inducing Opa1 cleavage.

• Mitochondrial copper, transported by Slc25a3, regulates flickering.

• Copper-containing SOD1 suppresses flickering.

• Copper-containing cytochrome c oxidase promotes flickering.