Involvement of Spinal Neuroplastin 65 in Neuropathic Pain by GABAA Receptor α2 Subunit Regulation

Abstract

BACKGROUND:

Neuropathic pain (NP) is a highly challenging condition with complex pathological mechanisms, and the spinal gamma aminobutyric acid A receptor receptor plays a crucial role in its progression. Recent studies have revealed a potential interaction between neuroplastin 65 (NP65) and gamma aminobutyric acid A receptor α2 subunit (GABAAR-α2) on the cell surface. We hypothesize that NP65 is involved in the pathogenesis of NP by regulating the level of GABAAR-α2.

METHODS:

A chronic constrictive injury (CCI) pain model was established in male Sprague-Dawley rats to verify the change in spinal NP65 expression. Alterations in pain behavior and GABAAR-α2 protein expression were observed after intrathecal injection of NP65 overexpressing adeno-associated virus (AAV) in CCI rats. In vitro investigations on Neuroblastoma 2a cells, the effect of NP65 on GABAAR-α2 expression via the calcineurin-nuclear factor of activated T-cell 4 (CaN-NFATc4) signaling pathway was evaluated by manipulating NP65 expression.

RESULTS:

The expression level of NP65 protein and mRNA in the CCI group were significantly decreased (P < .05; analysis of variance [ANOVA]). After intrathecal injection of NP65, overexpression of AAV and pain behavior in CCI rats were significantly alleviated, and levels of GABAAR-α2 were upregulated. In vitro experiments verified alterations in the expression of GABAAR-α2, CaN, and phosphorylated NFATc4 on the application of NP65 with plasmid or small interfering RNA, respectively. After the application of the specific CaN inhibitor cyclosporine A (CsA), the changes in NP65 expression did not produce subsequent alterations in the expression of GABAAR-α2, CaN, or phosphorylated NFATc4 proteins.

CONCLUSIONS:

NP65 modulates the level of GABAAR-α2 through the CaN-NFATc4 signaling pathway, which may serve as the underlying mechanism of NP.

KEY POINTS.

Question: Whether neuroplastin 65 (NP65) at the level of the spinal cord implicated in neuropathic pain?

Findings: Spinal NP65 regulates the level of gamma aminobutyric acid A receptor α2 subunit (GABAAR-α2) via the calcineurin-nuclear factor of activated T-cell 4 (CaN-NFATc4) signaling pathway, contributing to neuropathic pain in rats.

Meaning: Inhibiting spinal NP65 might be a prospective therapeutic target for chronic constrictive injury (CCI)-induced neuropathic pain.

The mechanism underlying neuropathic pain (NP) is intricate,^1,2 and the modulation of pain signals depends on the equilibrium of excitation-inhibition pathways. Enhanced central excitability and impaired central inhibition play a crucial role in the occurrence and persistence of NP, and this imbalance between excitation and inhibition is a critical mechanism underlying NP.^3,4 Currently, most NP treatments focus on inhibiting enhanced central excitability;^5,6 however, there are several drawbacks that must not be overlooked. Therefore, further exploration of NP pathogenesis is necessary to identify potential therapeutic targets.

Gamma aminobutyric acid A receptor (GABAA) is a crucial inhibitory neurotransmitter in the central nervous system and plays an inhibitory conduction function by binding to GABAA receptors. Studies have shown that the expression of GABAA receptors is downregulated at the spinal level in NP models.^7,8 Intrathecal injections of GABAA receptor antagonists or agonists can directly cause pain threshold changes.^9,10 Previous studies have shown that GABAA receptor α2 subunit (GABAAR-α2) is predominantly found in synapses where they are thought to have a critical role in synaptic signal transmission.^11,12 Latest studies have demonstrated that neuroplastin 65 (NP65) and GABAAR-α2 bind to each other on the cell surface in human embryonic kidney cells and the hippocampus of rats,¹³ and GABAAR-α2 staining can be more dispersed by treating neurons with NP65 short hairpin RNA,¹⁴ but the specific relationship between them is still unclear.

NP65 is a neuron-specific glycoprotein.^15,16 NP65 deletion is closely related to abnormal synaptic plasticity in several neuropsychiatric diseases.^17–21 However, the potential role of NP65 in NP through the regulation of GABAAR-α2 levels has not yet been investigated. Recent studies have found that the calcineurin-nuclear factor of activated T-cell 4 (CaN-NFATc4) signaling pathway plays an important role in regulating the gene expression level of GABAAR-α2.²² We hypothesized that NP65 might regulate GABAAR-α2 levels through the CaN-NFATc4 signaling pathway, influencing pain signal modulation in NP.

The chronic constrictive injury (CCI) animal model can replicate the symptoms of chronic nerve compression resulting from trauma or tumor development, as well as peripheral pain neuropathy. Both mechanical and thermal pain sensitivity can be accurately measured, making the CCI model particularly suitable for observing changes in pain behavior. Neuroblastoma 2a (N2a) cells are mouse neuroblastoma cells derived from pure nerve cells that can be used to study neurons in vitro. In this study, CCI rats and N2a cells were used to explore the potential regulatory role of NP65 on GABAAR-α2 protein through the CaN-NFATc4 signaling pathway.

METHODS

Animals

The experimental animals were specific pathogen-free healthy adult male Sprague-Dawley (SD) rats weighing 200–220 g, provided by Beijing Vital River Laboratory Animal Technology. They were housed in the animal facility at a controlled temperature (23 ± 1) °C. They were allowed to drink and eat freely, with a 12-hour illumination period (the illumination time was 8:00–20:00). All of them adjusted to the environment for 1 week before the experiment. All laboratory operations and animal handling followed the laboratory animal guidelines established by the National Health Agency.

Chronic CCI Model in Rats

SD rats were anaesthetized by intraperitoneal injection of 1% pentobarbital (40 mg/kg) and fixed in the prone position. The CCI model of the sciatic nerve was established by referring to Bennett et al.²³ Control rats did not receive any treatment.

Intrathecal Injection of AAV

The overexpressed adeno-associated virus (AAV) was prepared by AAV-293 cells from Shanghai Genechem Co., Ltd. Genetic information was Nptn NM_019380-3flag-T2A-EGFP from rats, carrier information was hSyn promoter-MCS-SV40 PolyA, and serotype was type 9. The titer of virus titers used in this study was 6.54 × 10¹³ vg/mL. The specific operation methods are described previously.²⁴ The rats were subjected to CCI modeling for subsequent experiments after the virus had reached full expression (4 weeks after virus injection).

Cell Culture, siRNA, and Plasmid Transfection

N2a cells were cultured in high-glucose medium (C3113-0500, Shanghai XP Biomed Ltd.) with 10% fetal bovine serum (C04001-500, Shanghai XP Biomed Ltd.) and 5% penicillin–streptomycin solution (C3421-0100, Shanghai XP Biomed Ltd.). Cell planking (30% cell density) was performed 24 hours before each cell transfection with a 6-well plate. Lipofect (Lipofectamine 3000, L3000015, Thermo Fisher Technology (China) Co., Ltd.) was used for transfection according to the instructions. One milliliter of medium without antibiotics was added to each well with a concentration of 5 µL mL^–1 Lipofectamine and a concentration of 50 nM siRNA (Nptn, target sequence-CTGAGGATTCAGGCGAATA, siG2202170322216340, Guangzhou RiboBio Co., Ltd.) or 2.5 µg mL^–1 plasmid (ID: 46323, Youbio Biological Technology Co., Ltd.). The cells were incubated at 37 °C for 48–72 hours, the culture medium was changed, and protein or RNA was collected according to the cell state. The concentration of N2a cells treated with cyclosporine A (CsA; HY-B0579, MedChemExpress) was 0.1 mM. Each well of the 6-well plate contained 1 ml medium, and 1 μL ethanol solution containing CsA (the final concentration of CsA was 100 nM) was added to the medium. After incubation at 37 °C for 1 hour, cells were collected for follow up experiments.

Behavioral Measurement

The pain behavior of the experimental rats was quantified before, on the 3rd, 7th, 14th, and 21st day after modeling. Paw withdrawal mechanical threshold (PWMT) was determined with an Electronic von Frey Probe 37400-002 (Ugo Basile). Paw withdraw thermal latency (PWTL) was determined with the Model 336 Analgesic Metre (IITC Inc/Life Science Instruments).

Western Blotting

The time points of animal sampling and behavioral testing before intervention were consistent. Animal sampling after the intervention was considered on the 14th day of post-CCI modeling, as the model exhibited its utmost stability during this interval. All protein samples were determined concentrations by the bicinchoninic acid (BCA) method. The samples were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene difluoride (PVDF) membranes. After blocking the PVDF membrane for 2 hours in 5% skim milk, primary antibodies (NP65, 1:1000, R&D, AF5360; Gabaar-α2, 1:500, Abcam, ab193311; CaN, 1:1000, ABclonal, A4346; phosphorylated nuclear factor of activated T cells 4 (p-NFATc4), 1:200, Santa Cruz Biotechnology, sc-135771; GAPDH, 1:1000, ABclonal, AC001) were incubated overnight at 4 °C. After rewarming for 30 minutes, tris-buffered saline and Tween-20 (TBST) was used to rinse the PVDF membrane 3 times for 5 minutes, and secondary antibodies labeled with horseradish peroxidase (goat antimouse immunoglobulin G (IgG) (H+L), 1:1000, A0216, Shanghai Biyuntian Biotechnology Co. Ltd.; goat antirabbit IgG (H+L), 1:1000, A0208, Shanghai Biyuntian Biotechnology Co. Ltd.; donkey antigoat IgG (H+L), 1:1000, A0208, Shanghai Biyuntian Biotechnology Co. Ltd.) were added and incubated at room temperature for 2 hours. After incubation, TBST was used to rinse the PVDF membrane 3 times × 5 minutes. The band exposure was conducted using the enhanced chemiluminescence technique.

RT-PCR

RNA was extracted from cells or tissues on ice, measured by spectrophotometry and diluted to a suitable concentration. The RNA to be tested was combined with 5×HisScript III qRT SuperMix (R132- 01, Vazyme Biotech Co., Ltd.) in a reverse transcription system to generate cDNA. Then the combination of 2×ChamQ Universal SYBR Master Mix (Q711-02, Vazyme Biotech Co., Ltd.), cDNA, ddH2O and primers (Rat-NP65: forward sequence 5′−3′– GGAGAATGGTGTGTTTGAGGAGAT, reverse sequence 5′−3′– CCTGAGGACTGTGGAAACGG; N2a cell-NP65: forward sequence 5′−3′– CCACCAACTCCATTGGCACT, reverse sequence 5′−3′– GGTAGAGTTGGTTTTCATTGGC; N2a cell-GABAAR-α2: forward sequence 5′−3′–GGAGACAGAATCAGAGCCACT, reverse sequence 5′−3′–TACCGTGTATTCACCTGTGCTT) results in the formation of PCR system. Each sample was repeated at least 3 times, and its cycle threshold value was calculated and analyzed by the 2-ΔΔCT method.

Immunofluorescence

The rats were deeply anaesthetized with pentobarbital sodium (40 mg/kg, Intraperitoneal injection), and were successively infused with normal saline (250 mL) and 4% paraformaldehyde solution (150 mL) through the ascending aorta. The spinal lumbar enlargement of rats was placed in 4% paraformaldehyde solution, fixed for 24 hours, transferred to 30% sucrose solution, and dehydrated until the tissue mass sank to the bottom. Cells grown on glass coverslips were fixed in a 4% paraformaldehyde solution for 5 minutes. Frozen sections in 20 µm and cells glass coverslips were washed 3 times in phosphate-buffered saline (PBS), and blocked with 10% donkey serum at room temperature for 60 minutes. Then, the slices were washed again, and primary antibodies (goat, NP65, 1:100, R&D, AF5360; mouse, Gabaar-α2, 1:100, Abcam, ab193311; mouse, NeuN, 1:100, Abcam, ab104224; mouse, Glial fibrillary acidic protein, 1:100, Abcam, ab4648; mouse, Iba-1, 1:100, Abcam, ab283319) were incubated at 4 °C for 24 hours. After rewarming for 30 minutes, the slices were washed 3 times with PBS, and secondary antibodies were added in the dark (donkey antigoat, 1:800, Abcam, ab150132; donkey antimouse, 1:800, Abcam, ab150105) and incubated at room temperature for 1 hour. Finally, the slices were rinsed with 0.01 mol/L PBS for 3 × 5 minutes in the dark, sealed with antiquench agent, and stored away from light in a laser confocal microscope room for filming. The fluorescence intensity was measured by ImageJ (NIH).

Statistical Analysis

Grey values of western blotting and fluorescence intensity analyses were measured by Image J software. SPSS 26.0 software was used for data entry and statistical analysis. The intragroup and intergroup behavioral outcomes were compared using a repeated measures analysis of variance (ANOVA), and the Mauchly method was used to confirm adherence to the assumption of sphericity. When the western blotting results exhibited a normal distribution and homogeneity of variance, an independent sample t-test was used to compare between 2 groups. For comparison between multiple groups, ANOVA was utilized, followed by post hoc multiple comparisons using the Bonferroni method. When the western blotting results exhibited a consistent normal distribution but an inconsistent variance, Welch’s ANOVA was used for multi-group comparison, and the Games-Howell test was utilized for post hoc multi-group comparison. As the reverse transcription-polymerase chain reaction and fluorescence quantitative data did not follow a normal distribution and homogeneity of variance, we conducted a nonparametric test (Mann-Whitney U test). A value of P < .05 was considered statistically significant.

RESULTS

Spinal NP65 is Downregulated in Neuropathic Pain Models

We first evaluated the cellular localization of NP65. The experimental procedure is illustrated in Figure 1A. Double immunofluorescence staining showed that NP65 was mainly colocalized in the 1/2 lamina of the spinal dorsal horn with NeuN (neuron marker) but not with glial fibrillary acidic protein (astrocyte marker) or Iba-1 (microglia marker; Figure 1B–1D).

Figure 1.

NP65 localization of lumbosacral enlargement of spinal cord in rat. A, The experimental procedure. B, Colocalization of NP65 (red) and neuron marker Neurn (green) at the spinal lumbocele in rats. C, Colocalization of NP65 (red) and astrocyte marker GFAP (green) in the spinal lumbar enlargement of rats. D, Colocalization of NP65 (red) with microglia marker Iba-1 (green) at the spinal lumbar enlargement in rats. Zoom showed the zoom of the representative area. Scale bar = 50 µm (A low mag), scale bar = 20 µm (A zoom). GFAP indicates Glial fibrillary acidic protein; NP65, Neuroplastin 65.

Repeated measures ANOVA confirmed a statistically significant difference in PWMT and PWTL between CCI and control over time (group * time in ANOVA, P = .022 for PWMT and P = .021 for PMTL, Figure 2A, 2B). Post hoc statistical comparisons at individual timepoints are shown in Figure 2.

Figure 2.

Spinal NP65 is downregulated in neuropathic pain. A, Mechanical pain sensitivity changes at different time points after CCI modeling, each values represent mean ± STD of each group (compared to the control group, ^*P < .05, ^**P < .01; compared to the base value of the same group, ^△P < .05, ^△△P < .01, n = 6). B, Thermal pain sensitivity changes at different time points after CCI modeling, each values represent mean ± STD of each group (compared to the control group, ^*P < .05, ^**P < .01; compared to the base value of the same group, ^△P < .05, ^△△P < .01, n = 6). C, Western blot showed the changes of NP65 protein expression in spinal lumbar enlargement of CCI rats at different time points after modeling. Summary of the amount of NP65 relative to β-actin (compared to the control group, ^*P < .05, ^**P < .01, n = 6). D, Mean ± STD (fold change) of mRNA expression of NP65 in the lumbosacral enlargement of CCI rat spinal cord (compared to the control group, ^*P < .05, ^**P < .01, n = 6). CCI indicates chronic constriction injury; NP65, neuroplastin 65; PWMT, paw withdrawal mechanical threshold; PWTL, paw withdraw thermal latency.

To evaluate the time course of changes in the expression levels of NP65 protein and mRNA after CCI, the spinal lumbar enlargement of rats at each time point was analyzed by western blot and quantitative Real-time PCR (qPCR). Compared with that in the control group, the protein expression level of NP65 in the CCI group was significantly decreased on the7th (P = .033), 14th (P = .002), and 21st (P = .002) days after surgery (Figure 2C). The qPCR results showed that the expression trend of NP65 mRNA in CCI rats was consistent with NP65 protein levels, which decreased continuously on the 3rd (P = .025), 7th (P = .004), 14th (P = .025), and 21st (P = .004) days after surgery (Figure 2D).

NP65 Overexpression Can Significantly Alleviate Hyperalgesia in Neuropathic Pain Models

To investigate the effect of NP65 on pain behavior in CCI rats, NP65 overexpression AAV was injected intrathecally 28 days before CCI surgery. After NP65 was fully overexpressed, CCI modeling was performed to detect the change in NP65 expression in each group on the 14th day after surgery (Figure 3A). Immunofluorescence results showed that the expression of NP65 in the spinal cord of the CCI+Normalsaline (NS) group was significantly decreased compared with that of the C+NS group (P = .004). Compared with that in the CCI+NS group, the expression of NP65 in the spinal cord of the CCI+AAV group was significantly increased (P = .004). No significant difference was found among the other groups (Figure 3B). The results of western blotting and immunofluorescence were consistent. Compared with the C+NS group, the expression of NP65 protein in the spinal cord of rats in the C+AAV group was significantly increased (P < .001), while that in the CCI+NS group was decreased (P = .015). Compared with that in the CCI + NS group, NP65 protein expression in the C + NS group (P = .015), C + AAV group (P < .001) and CCI + AAV group (P < .001) was significantly increased (Figure 3C).

Figure 3.

NP65 overexpression can significantly alleviate hyperalgesia in chronic pain models. A, Animal testing schedule and grouping condition. C + NS: control rat + negative control virus group, C + AAV: control rat + NP65 overexpressed virus group, CCI + NS: CCI rat + negative control virus group, CCI + AAV: CCI rat + NP65 overexpressed virus group. B, NP65 immunofluorescence staining and fluorescence intensity quantitative analysis in spinal lumbar enlargement of rats in each group. Scale bar=50μm. ^*P < .05, ^**P < .01, n = 6. C, Western blot showed the changes in NP65 expression of each group on the 14th day after modeling. Summary of the amount of NP65 relative to GAPDH, ^*P < .05, ^**P < .01, n = 6. D, Mechanical pain sensitivity of rats in 4 groups at different time points. Each values represent mean ± STD of each group (compared to the control rat + negative control virus group, ^*P < .05, ^**P < .01, n = 6; compared to the base value of the same group, ^△P < .05, ^△△P < .01, n = 6). E, Thermal pain sensitivity of rats in 4 groups at different time points. Each values represent mean ± STD of each group (compared to the control group, ^*P < .05, ^**P < .01; compared to the base value of the same group, ^△P < .05, ^△△P < .01, n = 6). AAV indicates adeno-associated virus; CCI, Chronic constriction injury; NP65, neuroplastin 65; NP, Normalsaline; PWMT, paw withdrawal mechanical threshold; PWTL, paw withdraw thermal latency.

Simultaneously, we noted alterations in behavior within each group. There were no significant differences over time or between groups for C + AAV, C + NS or CCI + AAV (P > .05, ANOVA). However, CCI + NS showed a statistically significant time-dependent decline (group × time in ANOVA, P = .031 for PWMT and P = .012 for PMTL, Figure 3D, 3E).

NP65 Overexpression Can Upregulate GABAAR-α2 In Vivo and In Vitro

To determine if alterations in spinal NP65 trigger modifications in GABAAR-α2, we assessed the protein expression levels of both NP65 and GABAAR-α2. In comparison to the C+NS group, a reduction in the expression of GABAAR-α2 was observed in the CCI+NS group (P = .039). There was no significant difference between the other 2 groups (P = .217, P = .749; Figure 4A).

Figure 4.

NP65 overexpression can upregulate GABAAR-α2 in in vivo and in vitro. A, Western blot showed the changes in GABAAR-α2 expression of each group on the 14th day after modeling. Summary of the amount of GABAAR-α2 relative to GAPDH, ^*P < .05, ^**P < .01, n = 6. B, Western blot showed that NP65 and GABAAR-α2 expression levels were changed after N2a cells transfected with NP65 overexpressed plasmid. Summary of the amount of NP65 and GABAAR-α2 relative to GAPDH, ^*P < .05, ^**P < .01, n = 3. C, Mean ± STD (fold change) of mRNA expression of NP65 and GABAAR-α2 in N2a cell, ^*P < .05, ^**P < .01, n = 3. D, Plasmid structure diagram. E, Immunofluorescence colocalization of NP65 (red) and GABAAR-α2 (green) on the membrane of N2a cells. Scale bar = 50 μm. F, The experimental procedure. GABAAR-α2 indicates gamma aminobutyric acid A receptor alpha 2 subunit; N2a, Neuroblastoma 2a; NP65, neuroplastin 65.

In vivo results showed that the alteration of NP65 expression induced the corresponding change in GABAAR-α2, we further verified the results of in vitro experiments. After constructing an NP65 overexpression plasmid to transfect N2a cells, western blot results showed that compared with the control group (F-C), the expression of NP65 in the overexpression group (F-NP65) was significantly upregulated (P = .005). The expression of GABAAR-α2 was significantly increased (P = .027; Figure 4B). qPCR results showed that the mRNA expression levels of NP65 (P = .007) and GABAAR-α2 (P = .049) in the F-NP65 group were significantly increased compared with those in the F-C group (Figure 4C). Figure 4D shows the specific structure of the plasmid. Double immunofluorescence staining showed that the colocalization of NP65 and GABAAR-α2 on the membrane of N2a cells was increased in the F-NP65 group compared with the F-C group (Figure 4E). The experimental procedure is illustrated in Figure 4F.

NP65 Knockdown Can Downregulate GABAAR-α2 In Vitro

Subsequently, in in vitro experiments, small interfering RNA knockdown of NP65 expression was used to simulate the pain model and further verify the regulatory effect of NP65 on GABAAR-α2 under pain conditions. The expression of NP65 in N2a cells was reduced by siRNA knockdown, and the expression of NP65 and GABAAR-α2 was detected by western blotting. Compared with the control group (si-C), the protein expression levels of NP65 (P = .041) and GABAAR-α2 (P = .043) were significantly downregulated in the knockdown group (si-NP65) (Figure 5A). Consistent with the western blot results, qPCR results showed that NP65 mRNA (P = .033) and GABAAR-α2 mRNA (P = .038) in the si-NP65 group were decreased significantly (Figure 5B). Double immunofluorescence staining showed that the colocalization of NP65 and GABAAR-α2 on the membrane of N2a cells was reduced in the si-NP65 group compared with the si-C group (Figure 5C). The experimental procedure is illustrated in Figure 5D.

Figure 5.

NP65 knockdown can downregulate GABAAR-α2 in vitro. A, Western blot showed that NP65 and GABAAR-α2 expression levels were changed after transfection of si-RNA in N2a cells. Summary of the amount of NP65 and GABAAR-α2 relative to GAPDH, ^*P < .05, ^**P < .01, n = 3. B, Mean ± STD (fold change) of mRNA expression of NP65 and GABAAR-α2 in N2a cell, ^*P < .05, ^**P < .01, n = 3. C, Immunofluorescence colocalization of NP65 (red) and GABAAR-α2 (green) on the cell membrane in N2a cells. Scale bar = 50 μm. D, The experimental procedure. GABAAR-α2 indicates gamma aminobutyric acid A receptor alpha 2 subunit; N2a, Neuroblastoma 2a; NP65, neuroplastin 65; si-RNA, Small interfering RNA.

NP65 is Involved in the CaN-NFATc4 Signaling Pathway to Regulate the Expression of GABAAR-α2

We detected the expression levels of NP65, CaN and p-NFATC4 proteins in vitro experiments. Compared with the si-C group, the expression of NP65 in the si-NP65 group was significantly downregulated (P = .006), the expression of CaN protein was significantly increased (P < .001), and the expression level of p-NFATC4 was significantly downregulated (P = .001; Figure 6A). After constructing an NP65 overexpression plasmid to transfect N2a cells, western blot analysis showed that the expression of NP65 in the F-NP65 group was significantly increased (P = .001), the expression of CaN was significantly decreased (P = .007) and the expression of p-NFATC4 was significantly upregulated (P = .007; Figure 6B). After treating N2a cells with CsA, a specific inhibitor of CaN, there were no significant differences in the expression of CaN (P = .146), GABAAR-α2 (P = .303) and p-NFATC4 (P = .299) in the si-NP65 groups compared with the si-C groups, and similarly, there were no significant differences in the expression of CaN (P = .546), GABAAR-α2 (P = .407) and p-NFATC4 (P = .910) in the F-NP65 groups compared with the F-C groups (Figure 6C). The experimental procedure is illustrated in Figure 6D.

Figure 6.

NP65 is involved in the CaN-NFATc4 signaling pathway to regulate the expression of GABAAR-α2. A, The expression levels of NP65, CaN and p-NFATC4 proteins changed after transfection with si-RNA in N2a cells. Summary of the amount of NP65, CaN, p-NFATC4 relative to GAPDH, ^*P < .05, ^**P < .01, n = 3. B, Western blot showed that NP65, CaN and p-NFATC4 expression levels were changed after N2a cells transfected with NP65 overexpressed plasmid. Summary of the amount of NP65, CaN, p-NFATC4 relative to GAPDH, ^*P < .05, ^**P < .01, n = 3. C, The expression levels of NP65, CaN, GABAAR-α2 and p-NFATC4 proteins in si-RNA knockdown group and plasmid overexpressed group were changed after treatment with CaN specific inhibitor CsA. Summary of the amount of NP65, CaN, GABAAR-α2, p-NFATC4 relative to GAPDH, ^*P < .05, ^**P < .01, n = 3. D, The experimental procedure. CaN indicates calcineurin; CsA, cyclosporine A; GABAAR-α2, gamma aminobutyric acid A receptor alpha 2 subunit; N2a, Neuroblastoma 2a; NFATc4, nuclear factor of activated T-cell 4; NP65, neuroplastin 65; si-RNA, Small interfering RNA.

DISCUSSION

NP65 forms a complex and interwoven binding network by binding with different chaperone proteins and is a key regulatory target for important neurophysiological mechanisms such as synaptic formation, synaptic plasticity, and intracellular Ca²⁺ signal regulation.^25,26 Nerve conduction is the basis of pain occurrence and maintenance, however, the correlation between NP65 and pain remains unknown. In this study, we demonstrated that NP65 is involved in the development of NP. The expression of spinal NP65 gradually decreases in NP, and the upregulation of spinal NP65 expression levels can alleviate hyperalgesia in NP rats. Consistent with the experimental results of Rodrigo et al,¹³ our experiment also confirmed that knocking down NP65 can reduce the expression level of GABAAR-α2. In our experiment, plasmid and siRNA were used to intervene in the expression level of NP65, which more comprehensively confirmed that NP65 can regulate GABAAR-α2 proteostasis both in vivo and in vitro. In addition, our further exploration suggests that NP65 regulates GABAAR-α2 through the CaN-NFATc4 signaling pathway.

Among the many factors affecting the expression of GABAAR-α2, the CaN-NFATc4 signaling pathway is particularly important and is involved in the pathological process of Alzheimer’s disease, traumatic encephalopathy, fear and anxiety, and other diseases by regulating the expression of GABAAR-α2.^27,28 CaN in this pathway is a Ca²⁺ ion/calmodulin-related protein phosphatase in the central nervous system that is sensitive to Ca²⁺ fluctuations and can be directly activated by elevated Ca²⁺ ions.²⁹ When CaN is activated, the dephosphorylation level of NFATc4 increases, and NFATc4 translocates from the nucleus to the cytoplasm, which leads to a reduction in the phosphorylation of NFATc4 in the nucleus and low transcriptional activity, thus resulting in the decreased expression of GABAAR-α2.^28,30 Previous studies investigated whether NP65 is the basic auxiliary subunit of Ca²⁺ ATPase (PMCA) through proteomic analysis. The deletion of NP65 cannot affect the transcription of the PMCA gene but can reduce the expression level of the PMCA protein, which results in a reduction in intracellular Ca²⁺ outflow and an increase in intracellular Ca²⁺ levels.³¹ These results suggested that NP65 regulates GABAAR-α2 level through the CaN-NFATc4 signaling pathway related to Ca²⁺ ions. Therefore, we speculated that when peripheral injurious stimulation was enhanced, the pain signal was transmitted into the spinal dorsal horn. At this time, the decreased expression of NP65 and the increased intracellular Ca²⁺ concentration of neurons resulted in CaN-NFATc4 signaling pathway activation, which led to the decreased expression of GABAAR-α2. Consequently, the transmission of gamma-aminobutyric acid was decreased, and the inhibitory conduction of the central nervous system was weakened, which led to more severe hyperalgesia. In the fifth part of the experiment, we conducted a concrete verification. After we knocked down NP65 expression levels in N2a cells using small interfering RNA, enhanced intracellular Ca²⁺ levels triggered direct activation of CaN. Western blotting results showed that CaN protein expression was upregulated, which led to a decrease in the level of phosphorylated NFATc4 protein, and then regulated the decrease in the level of GABAAR-α2. On overexpression of NP65 protein in N2a cells, western blotting results revealed that the expression of CaN was downregulated, while the phosphorylation of NFATc4 and GABAAR-α2 were upregulated. While after the application of the specific CaN inhibitor cyclosporine, the changes in NP65 expression did not produce subsequent alterations in the expression of GABAAR-α2, CaN, or phosphorylated NFATc4 proteins. These results suggest that in the presence of NP, NP65 functions as a regulator within the CaN-NFATc4 signaling pathway, directly triggering the activation of CaN by elevating intracellular Ca²⁺ ion concentration, subsequently augmenting NFATc4 dephosphorylation, reducing NFATc4 phosphorylation. These alterations result in a decreased expression of the downstream GABAAR-α2, and a subsequent excitation/inhibition (E/I) imbalance of neuronal cells. Consequently, the underlying NP condition persists and escalates.

This study has several limitations. First, due to the potential impact of estrogen levels on pain, experiments were performed in male mice, so differences in outcomes between sexes will require further study. Furthermore, our study confirmed the downstream mechanism of NP65 involved in NP, while the upstream mechanism of NP65 involved in NP needs further investigation.

In conclusion, our study aimed to investigate whether the levels of mRNA and protein of NP65 in the spinal cord of rats with NP were reduced. Furthermore, we aimed to determine if the intrathecal injection of NP65-overexpressing AAV could alleviate hyperpathia. Our findings revealed that NP65 regulates the level of GABAAR-α2 via the CaN-NFATc4 signaling pathway, which may be the underlying mechanism of NP. This study enhances our understanding of the etiology of NP, providing new avenues for the clinical prevention and treatment of this condition.

CONCLUSIONS

NP65 modulates the level of GABAAR-α2 through the CaN-NFATc4 signaling pathway, which may serve as the underlying mechanism of NP.

DISCLOSURES

Name: Li Xu, MD, PhD.

Contribution: This author helped design and conduct the study, collect and analyze the data, and write the manuscript.

Name: Yu Wang, MD, PhD.

Contribution: This author helped design and conduct the study, collect and analyze the data, and write the manuscript.

Name: Yang Jiao, MD, PhD.

Contribution: This author helped conduct the study, collect and analyze the data.

Name: Yulin Huang, MD, PhD.

Contribution: This author helped collect and analyze the data.

Name: Rui Xu, MD.

Contribution: This author helped collect and analyze the data.

Name: Xiaoping Gu, MD, PhD.

Contribution: This author helped review and edit.

Name: Wei Zhang, MD, PhD.

Contribution: This author helped conceive and design the study, review and edit.

Name: Zhengliang, Ma, MD, PhD.

Contribution: This author helped conceive and design the study, review and edit.

This manuscript was handled by: Jianren Mao, MD, PhD.