Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Aug 23;103(12):104255. doi: 10.1016/j.psj.2024.104255

Optimal glycine allowance levels in low-protein diets and the dynamic requirement model for broilers

Yongfa Liu 1, Yizhu Zhao 1, Jiran Ma 1, Siyan Guo 1, Xuyang Gao 1, Bin Wang 1, Lu Gong 1, Zengpeng Lv 1, Yuming Guo 1,1
PMCID: PMC11467656  PMID: 39332340

Abstract

This study aimed to investigate the effects of different glycine levels in low-protein diets on the growth, nitrogen deposition, and expression of intestinal amino acid and glucose transporters in broilers from 29 to 42 d of age, in order to determine the optimal glycine supplementation level. A total of 240 male broilers at 29 days old were randomly assigned to 5 groups: the control group with a crude protein level of 20%, and experimental groups with low-protein diets (LP130) containing 18% crude protein, supplemented with glycine to achieve standardized ileal digestible (SID) glycine + serine to lysine ratios of 134% (LP134), 140% (LP140), and 145% (LP145). The results showed that the LP134 group had similar growth performance and slaughter performance compared to the control group (P > 0.05), whereas other low-protein diet groups had significantly lower growth performance (P < 0.05). Regression analysis determined that the optimal ratio for SID glycine + serine to lysine was 137%. A dynamic model for glycine + serine requirements was established through binary regression analysis: y = 599.051 × BW^0.75 + 8.381 × ADG (R2 = 0.998, P < 0.001). Feeding LP134, LP140, and LP145 diets significantly improved nitrogen deposition rates in broilers (P < 0.05). Low-protein diets significantly upregulated mRNA levels of b0,+AT, EAAT3, and SGLT1 genes in the duodenum (P < 0.05). In conclusion, appropriate glycine supplementation in low-protein diets can enhance growth performance, and nitrogen deposition efficiency, and regulate the expression of intestinal amino acid and glucose transporters. The optimal ratio of SID glycine + serine to lysine in low-protein diets for broilers aged 29 to 42 d is 137%.

Key words: broiler, glycine, low-protein diet, intestinal amino acid transporter, dynamic requirement model

INTRODUCTION

The production performance of broilers may decline when dietary crude protein (CP) levels are reduced. This decline can be attributed to either an insufficient supply of metabolic precursors necessary for the synthesis of nonessential amino acids like glycine or inadequate endogenous metabolic conversion (Siegert et al., 2016). Dean et al. (2006) identified the optimal level of total glycine + serine as 2.32%, while Ospina-Rojas et al. (2013) reported a lower optimal level of 1.54%. This variation in the optimal glycine supplementation levels across different studies highlights the need for further research (Dean et al., 2006; Powell et al., 2011; Siegert et al., 2015; Hilliar et al., 2019; Deng et al., 2023). Serine can be converted to glycine through a reversible reaction catalyzed by serine hydroxymethyltransferase, and it is generally accepted that the interconversion of glycine and serine is not limited by metabolism (Hilliar et al., 2019; van Milgen, 2021). Consequently, these amino acids are often considered together when formulating poultry feed.

In animal nutrition requirement research, data modeling from dose-response trials is used to systematically analyze and quantify the relationship between dietary nutrient levels and growth performance. Quadratic curve fitting, for instance, can be employed to estimate the nutrient levels that maximize production metrics (Lamberson and Firman, 2002). Nutritional requirement models are particularly valuable as they describe how nutrient intake responds to both maintenance and growth needs. These models can help determine the most cost-effective nutrient intake under different economic and biological conditions and can specify the maintenance and growth requirements for broilers at specific stages (Pesti et al., 1980). However, there is still a lack of comprehensive studies on glycine requirements in broilers.

The small intestine is the primary site for nutrient absorption, and intestinal nutrient transporters play a crucial role in the movement of nutrients from the intestinal lumen into the portal circulation for utilization by the body. Excitatory amino acid transporter 3 (EAAT3) is a sodium-dependent high-affinity amino acid transporter that mediates the uptake of L-glutamate, L-aspartate, and D-aspartate, maintaining energy homeostasis in intestinal cells (Bjørn-Yoshimoto and Underhill, 2016). Sodium-glucose co-transporter 1 (SGLT1) is the primary transporter for glucose absorption in the animal intestine, facilitating cellular glucose uptake for energy production and storage (Lehmann and Hornby, 2016; Song et al., 2016). Increasing evidence suggests that nonessential amino acids, such as glutamine, glycine, and arginine, are involved in regulating various signaling pathways, including protein turnover and nutrient metabolism (Koopman et al., 2017; Cruzat et al., 2018; Szlas et al., 2022). However, whether glycine regulates the expression of intestinal transporters remains unclear.

The purpose of this study is to evaluate the effects of varying glycine levels in low-protein diets on broiler growth performance, nitrogen deposition, and amino acid transporter expression. Based on these results, we aim to determine the optimal glycine supplementation level in low-protein diets for broilers and develop a dynamic nutritional requirement model. These findings will enable producers to more accurately tailor glycine nutrition for broilers according to specific production goals, thereby supporting the achievement of precision poultry nutrition.

MATERIALS AND METHODS

Animal Ethics Statement

The experimental protocol was approved by the Animal Ethics Committee of China Agricultural University (AW01112202-1-2) and complied with the guidelines for animal care and use for scientific and experimental purposes.

Animal Management and Experimental Design

A total of 300 male Arbor Acres (AA) broiler chicks were purchased from a commercial supplier. Upon arrival, the chicks were randomly assigned to 25 cages (100 cm long × 70 cm wide × 40 cm high) with 12 birds per cage. Management practices were based on the Aviagen Broiler Management Handbook (2018), with ad libitum access to feed and water and routine immunization procedures. Before the experiment began, all broilers were fed a commercial starter diet from 0 to 14 d of age and a commercial grower diet from 15 to 28 d of age. At 29 d of age, 240 healthy AA broilers with similar body weights were selected and randomly divided into 5 treatment groups, each with 6 replicates of 8 birds. The control group (CN) had a CP level of 20%, while the experimental groups included a low-protein diet group with 18% CP (LP130) and low-protein diets supplemented with glycine to achieve standardized ileal digestible (SID) glycine + serine to lysine ratios of 134% (LP134), 140% (LP140), and 145% (LP145), respectively. The levels of glycine + serine were combined with previous studies (Rostagno et al., 2017; Star et al., 2021; Mansilla et al., 2023).The composition and nutrient levels of the diets are presented in Table 1.

Table 1.

Ingredient and nutrient composition of finisher diets fed toAA male broilers from 29 to 42 d of age.

Items CN LP
Ingredient (g kg−1)
Corn, 7.8% crude protein 619 672
Soybean meal, 44.2% crude protein 223 183
Corn protein, 41.8% crude protein 80.0 60.0
Dicalcium phosphate 12.2 12.6
Soybean oil 42.8 41.3
Limestone 11.9 12.0
Sodium chloride 2.70 2.30
Choline chloride 2.00 2.18
mineral premix1 2.00 2.00
D, L-methionine 0.65 1.02
70% L-Lysine, HCl 2.18 3.44
vitamin premix2 0.20 0.20
cystine 0.74
L-Phenylalanine 1.03
L-threonine 0.60
L-arginine 0.85
L-Isoleucine 0.39
L-tryptophan 0.16
L-valine 0.38
Glycine 0.38
Phytase 0.20 0.20
Potassium carbonate 1.05
Baking soda 1.50 2.11
Calculated chemical composition3
Dry matter (%) 88.29 88.09
Apparent metabolizable energy (Mcal/kg) 3.20 3.20
Crude protein (g kg−1) 200 180
Calcium (g kg−1) 7.59 7.60
Total phosphorus 5.72 5.61
Available phosphorus (g kg−1) 2.81 2.81
SID Lysine (g kg-1) 9.01 9.01
SID Methionine (g kg-1) 3.90 3.88
SID Phenyltyrosine (g kg-1) 13.68 12.95
SID Threonine (g kg-1) 6.12 5.94
SID Arginine (g kg-1) 10.15 9.63
SID Histidine (g kg-1) 4.65 4.12
SID Isoleucine (g kg-1) 7.03 6.48
SID Leucine (g kg-1) 19.70 17.10
SID Tryptophan (g kg-1) 1.59 1.54
SID Valine (g kg-1) 7.95 7.30
SID Glycine + Serine (g kg-1) 13.57 12.08
SID Glycine (g kg-1) 5.48 5.17
SID Serine (g kg-1) 8.09 6.91
Analyzed chemical composition
Crude protein (g kg−1) 205 183
Calcium (g kg−1) 10.2 10.9
Total phosphorus 6.53 6.58
Total Lysine (g kg-1) 9.90 9.80
Total Methionine (g kg-1) 4.20 4.20
Total Threonine (g kg-1) 6.80 6.80
Total Arginine (g kg-1) 8.50 8.20
Total Tryptophan (g kg-1) 1.60 1.50
Total Isoleucine (g kg-1) 7.00 6.70
Total Leucine (g kg-1) 19.7 18.0
Total Histidine (g kg-1) 4.50 4.50
Total Valine (g kg-1) 8.40 8.00
Total Glycine (g kg-1) 6.70 6.40
Total Serine (g kg-1) 9.00 8.40
Total Glycine + Serine (g kg-1) 15.70 14.80

Abbreviations: CN, control; LP, low protein.

1

Provided per kilogram of diet: Fe, 80 mg; Zn, 110 mg; Mn, 120 mg; Cu, 16 mg; I, 1.5 mg; Co, 0.5 mg; and Se, 0.3 mg.

2

Provided per kilogram of diet: vitamin A, 10,000 IU; vitamin D3, 2,400 IU; vitamin E, 20 IU; vitamin K3, 2.0 mg; vitamin B1, 1.6 mg; vitamin B2, 6.4 mg; vitamin B6, 2.4 mg; vitamin B12, 0.02 mg; nicotinic acid, 30 mg; pantothenic acid, 9.2 mg; folic acid, 1.0 mg; biotin, 0.1 mg.

3

Crude protein, total phosphorus and Ca were analyzed values; others were calculated values.

Sample Collection and Chemical Analysis

At 29 d of age, 12 broilers with fasting weights near the average were randomly selected, euthanized with CO2, and defeathered. At 42 d of age, 6 broilers per treatment group, also with fasting weights near the average, were similarly processed. The feathers were dried in an oven at 65°C, ground, and stored at −20°C for subsequent analysis. The entire featherless intact carcass with visceral organs and intestines (excluding intestinal contents) was homogenized using a meat grinder. The homogenate was then freeze-dried in a vacuum freeze dryer for 72 h to constant weight. Subsequently, the dried samples were pulverized and stored at −20°C for further analysis.

At 42 d of age, 1 broiler per replicate, close to the average body weight, was euthanized by jugular vein exsanguination, and 5 ml of blood was collected. The blood samples were centrifuged at 3,000 r/min for 10 min at 4°C to separate the serum, which was stored at −80°C for later analysis. The breast muscle, thigh muscle, and abdominal fat were weighed. The mid-sections of the duodenum, jejunum, and ileum were quickly frozen in liquid nitrogen and stored at −80°C for subsequent analysis.

Nitrogen was analyzed according to AOAC (2006) method (method 990.03), and CP derived by multiplying nitrogen content by 6.25. Calcium and total phosphorus (method 968.08D, AOAC (2016)). Amino acid analysis followed the standard procedure (method 994.12).

Serum and Liver Biochemical Indices

Serum uric acid, urea nitrogen, and total protein levels, as well as liver total protein levels, were measured using enzyme-linked immunosorbent assay (ELISA) kits purchased from Shanghai Enzyme-linked Biotechnology Co., Ltd.

Quantitative RT-PCR

Total RNA was extracted from tissues using TRIzol reagent (Takara, China), followed by precipitation, washing, and lysis. RNA purity was checked, and cDNA was synthesized using a reverse transcription kit (Takara, China). cDNA samples were amplified using Fast SYBR Green Master Mix (Takara, China). Target gene mRNA levels were normalized to the housekeeping gene β-actin. Specific primers and their sequences are shown in Table 2. The specific protocols of RNA extraction and quantitative RT-PCR (qRT-PCR) can be found in Liu et al. (2024). Quantification of mRNA expression was performed using the comparative cycle threshold (CT) method (2−ΔΔCT) according to (Livak and Schmittgen, 2001).

Table 2.

Primers sequences used for gene expression analysis.

Gene Primer sequence1 (5′ → 3′)
b0,+AT F: CAGTAGTGAATTCTCTGAGTGTGAAGCT
R: GCAATGATTGCCACAACTACCA
EAAT3 F: TGCTGCTTTGGATTCCAGTGT
R: AGCAATGACTGTAGTGCAGAAGTAATATATG
SGLT1 F: CCCTTCCAACTGTCCGTTCA
R: CCAGCACAAGCGATAAAGATGTA
β-actin F: ATTTGTGCGCTCCGTCACCT
R: ACCTTGTTCACGCAGTGGGG
1

F, Forward primer; R, Reverse primer.

Calculations and Statistical Analysis

Proteindepositionefficiency=((BWfinal×CPofbodyfinal)−(BWinitial×CPofbodyinitial))/(FI×CPofdiet)×100%

Statistical analysis was conducted using SPSS 26.0 software, and results were plotted with Excel. All data were subjected to tests for normality and homogeneity of variance. If assumptions were met, 1-way ANOVA followed by Tukey's Honestly Significant Difference (HSD) test was used for comparisons. If assumptions were not met, nonparametric tests (Kruskal-Wallis test followed by Dunn's posthoc test) were applied. P < 0.05 was considered significant, P < 0.01 was highly significant. Pearson correlation analysis was performed using SPSS 26.0 to examine the relationships between broiler growth performance, protein deposition efficiency, and serum parameters.

Curve regression analysis was performed using SPSS to fit the regression models. A quadratic regression analysis was conducted with the ratio of SID glycine + serine to lysine in the diet as the independent variable, and either body weight at 42 d of age or weight gain from 28 to 42 d as the dependent variable. The vertex coordinates were calculated to determine the optimal ratio of SID glycine + serine to lysine in low-protein diets. Additionally, a multiple linear regression analysis was performed with the 0.75 power of the average body weight and the average weight gain from 28 to 42 d as the independent variables, and the intake of SID glycine + serine as the dependent variable in the low-protein diet groups

RESULTS

Effects of Glycine Supplementation on Growth Performance and Slaughter Performance

As shown in Table 3, compared with the CN and LP134 groups, the LP130, LP140, and LP145 groups significantly decreased the average weight gain, average feed intake, and 42-d body weight of broilers from 29 to 42 d of age (P < 0.05), and significantly increased the feed conversion ratio from 29 to 42 d of age (P < 0.05). However, there were no significant differences in the average weight gain, average feed intake, and 42-d body weight between the LP134 and CN groups (P > 0.05).

Table 3.

Body weight, ADG, FI, and FCR of broiler aged 29 to 42 d fed experimental diets.

Item CN LP130 LP134 LP140 LP145 SEM P-Value
ANOVA Linear Quadratic
BW (g) 2801a 2682b 2766a 2693b 2682b 12.59 0.002 0.363 0.043
BWG (g) 1199a 1073b 1160a 1084b 1076b 12.50 0.001 0.377 0.027
FI (g) 2069a 1952b 2024a 1962b 1917b 16.85 0.045 0.248 0.120
FCR (%) 1.73b 1.82a 1.74b 1.81a 1.80a 0.009 0.001 0.614 0.153

Abbreviations: BW, body weight; BWG, body weight gain; FI, feed intake; FCR, feed conversion ratio.

a,b

Means within the same column with different superscripts differ significantly (P < 0.05).

Abbreviations: CN represents the control group fed a standard diet with 20% crude protein; LP130, LP134, LP140, and LP145 represent the low-protein diet groups (with 18% crude protein) supplemented with different doses of glycine, resulting in the ratio of standard ileal digestible glycine + serine to lysine being 130%, 134%, 140%, and 145%, respectively; BW, body weight; BWG, body weight gain; FI, feed intake; FCR, feed conversion ratio; SEM, standard error of mean.

Table 4 shows that different levels of glycine supplementation in low-protein diets did not significantly affect the slaughter performance (semi-eviscerated yield, eviscerated yield, breast muscle yield, thigh yield, and thigh muscle yield) of broilers at 42 d of age compared with the CN group (P > 0.05). However, the abdominal fat percentage in the LP130 group was significantly higher than in the other diet groups (P < 0.01), with no significant differences in abdominal fat percentage between the other low-protein diet groups and the CN group (P > 0.05).

Table 4.

Slaughter performance of broiler chickens on d 42 after being fed the experimental diets.

Item CN LP130 LP134 LP140 LP145 SEM P-value
ANOVA Linear Quadratic
Dressed yield (%) 94.2 94.3 94.1 93.8 93.3 0.169 0.244 0.012 0.606
Half-eviscerated yield (%) 89.0 89.2 89.1 88.6 88 0.185 0.284 0.020 0.547
All-eviscerated yield (%) 77.4 77 77.4 76.3 76.2 0.224 0.284 0.125 0.654
Abdominal fat yield (%) 1.82b 2.54a 2.07b 2.12b 1.88b 0.070 0.003 <0.001 0.284
Breast muscle yield (%) 14.2 14.3 13.8 14.2 14.5 0.143 0.649 0.575 0.258
Thigh yield (%) 12.8 12.3 12.2 12 12.4 0.122 0.394 0.925 0.334
Thigh muscle yield (%) 9.71 9.58 9.64 9.4 9.49 0.110 0.924 0.650 0.953

a,bMeans within the same column with different superscripts differ significantly (P < 0.05).

Abbreviations: CN represents the control group fed a standard diet with 20% crude protein; LP130, LP134, LP140, and LP145 represent the low-protein diet groups (with 18% crude protein) supplemented with different doses of glycine, resulting in the ratio of standard ileal digestible glycine + serine to lysine being 130%, 134%, 140%, and 145%, respectively.

Regression Analysis of Glycine Supplementation and Growth Performance, and Dynamic Requirement Model

As shown in Table 5, the regression equation for 42-d body weight in relation to glycine supplementation was y = -1.136x² + 310.54x - 18484, with an R² of 0.5466, and the vertex coordinates were (137, 2739). The regression equation for weight gain from 29 to 42 d of age in relation to glycine supplementation was y = −1.1281x² + 308.53x −19967, with an R² of 0.5137, and the vertex coordinates were (137, 1128). Subsequently, a binary regression analysis was performed using the average metabolic weight (BW^0.75, kg^0.75) and average daily gain (ADG, g) of broilers from 29 to 42 d of age as independent variables, and the intake of SID glycine+serine (mg) as the dependent variable. The model for glycine + serine intake was y = 599.051 × BW^0.75 + 8.381 × ADG (R² = 0.998, P < 0.001).

Table 5.

Regression model of glycine supplementation and broiler growth performance.

Dependent variables Regression equation1 R2 Vertex coordinates (X, Y)
BW at 42 d (g) Y = −1.136 X2 + 310.54 X - 18484 0.5466 X = 137 Y = 2,739
BWG from 28∼42 d(g) Y = −1.1281 X 2 + 308.53 X - 19967 0.5137 X = 137 Y = 1,128
Gly+Ser intake (mg) Y = 599.051 × BW0.75+8.381 × ADG 0.998 —
1

Y is the dependent viable and X represents the ratio of standard ileal digestible glycine + serine to lysine in the diet; R2 = determination coefficient; BW0.75 represents metabolic weight (kg0.75); BW, body weight; BWG, body weight gain.

Effects of Glycine Supplementation on Nitrogen metabolism, Liver and Seru Parameters

Compared with the CN and LP130 groups, the LP134, LP140, and LP145 groups significantly increased the protein deposition efficiency of broilers (P < 0.05, Table 6).

Table 6.

Effects of experimental diets on protein deposition, liver and serum parameters at 29 to 42 d of age.

Item CN LP130 LP134 LP140 LP145 SEM P-value
ANOVA Linear Quadratic
Protein Deposition Efficiency (%) 47.69b 49.49b 55.98a 55.28a 55.10a 0.68 <0.001 <0.001 <0.001
Serum UN (mmol/L) 2.28a 2.13ab 1.39c 1.86b 1.97ab 0.07 <0.001 0.987 <0.001
Serum UA (μmol/L) 513a 392b 387b 459a 527a 13.24 0.001 <0.001 <0.001
Liver TP (g/L) 10.55b 11.92b 12.73a 12.28a 12.77a 0.21 <0.001 0.083 0.988
a,b

Means within the same column with different superscripts differ significantly (P < 0.05).

Abbreviations: CN represents the control group fed a standard diet with 20% crude protein; LP130, LP134, LP140, and LP145 represent the low-protein diet groups (with 18% crude protein) supplemented with different doses of glycine, resulting in the ratio of standard ileal digestible glycine + serine to lysine being 130%, 134%, 140%, and 145%, respectively; UN, Urea nitrogen; UA, Uric acid; TP, Total protein.

Further measurement of serum and liver biochemical indices revealed that different levels of glycine supplementation in low-protein diets significantly increased liver total protein levels (P < 0.05, Table 6). Additionally, serum urea nitrogen levels in the LP134 group were significantly lower than in the other diet groups (P < 0.05, Table 6). Compared with the CN group, serum uric acid levels in the LP130, LP134, and LP140 groups were significantly reduced (P < 0.05, Table 6). Serum uric acid levels in the LP130 and LP134 groups were significantly lower than in the LP140 group (P < 0.05), while there was no significant difference between the LP145 group and the CN group (P < 0.05).

Effects of Glycine Supplementation on Intestinal Amino Acid and Glucose Transporters

Results indicated that different levels of glycine supplementation in low-protein diets significantly increased the mRNA expression levels of the amino acid transporter b0,+AT in the duodenum (P < 0.05) and significantly decreased its expression in the jejunum of the LP130, LP134, and LP140 groups (P < 0.05), with no significant effect in the ileum (P > 0.05) compared to the CN group. Moreover, the mRNA expression level of b0,+AT in the duodenum of the LP134 group was significantly higher than that of the LP145 group (P < 0.05,Table 7).

Table 7.

Effects of experimental diets on intestinal b0,+AT, EAAT3 and SGLT1 mRNA levels in 29 to 42 day old broilers.

Gene Intestinal CN LP130 LP134 LP140 LP145 SEM P-value
ANOVA Linear Quadratic
b0,+AT Duodenum 1.00b 3.23a 3.16a 2.83a 2.64a 0.220 0.003 0.275 0.904
Jejunum 1.00a 0.48b 0.27b 0.49b 0.85ab 0.079 0.018 0.040 0.050
Ileum 1.00 1.00 0.83 0.92 1.14 0.077 0.789 0.532 0.296
EAAT3 Duodenum 1.00b 2.74a 3.04a 2.85a 2.54ab 0.189 0.001 0.611 0.381
Jejunum 1.00 1.20 1.35 1.22 1.28 0.078 0.715 0.901 0.837
Ileum 1.00a 0.60b 0.81ab 0.53b 0.53b 0.061 0.049 0.279 0.265
SGLT1 Duodenum 1.00b 5.76ab 8.99a 7.26a 4.19ab 0.682 0.006 0.424 0.090
Jejunum 1.00b 2.60ab 4.61a 3.00ab 2.49ab 0.332 0.008 0.630 0.089
Ileum 1.00c 6.18a 1.70bc 5.47a 3.97ab 0.500 <0.001 0.423 0.054
a,b

Means within the same column with different superscripts differ significantly (P < 0.05).

Abbreviations: CN represents the control group fed a standard diet with 20% crude protein; LP130, LP134, LP140, and LP145 represent the low-protein diet groups (with 18% crude protein) supplemented with different doses of glycine, resulting in the ratio of standard ileal digestible glycine + serine to lysine being 130%, 134%, 140%, and 145%, respectively.

Compared to the CN group, low-protein diets significantly increased the mRNA expression level of the amino acid transporter EAAT3 in the duodenum of the LP130, LP134, and LP140 groups (P < 0.05), with no significant effect in the jejunum (P > 0.05). The mRNA expression levels of EAAT3 in the ileum were significantly reduced in the LP130, LP140, and LP145 groups compared to the CN and LP134 groups (P < 0.05) (Table 7).

Low-protein diets significantly increased the mRNA expression levels of the glucose transporter SGLT1 in the duodenum and jejunum of the LP134, and LP140 groups (P < 0.05), and the mRNA expression level of SGLT1 in the jejunum of the LP134 group was significantly higher than CN groups (P < 0.05). The mRNA expression level of SGLT1 in the ileum was significantly increased in the LP130, LP140, and LP145 groups compared to the CN and LP134 groups (P < 0.05).

DISCUSSION

Inadequate glycine in low-protein diets for broilers is a limiting factor in further reducing feed CP (Awad et al., 2017; Kriseldi et al., 2017; Star et al., 2021; Aguihe et al., 2022; Mansilla et al., 2023). Based on growth performance results and quadratic regression analysis, we determined that the optimal supplementation level of glycine in low-protein diets for broilers under the conditions of this study is a SID Gly + Ser to Lys ratio of 134% to 137%. This is consistent with the findings of Ospina-Rojas et al. (2013), who reported a digestibility Gly + Ser to Lys ratio of 137%, and Aguihe et al. (2024), who found a Glyequi level of 1.26%. However, it is higher than digestibility Gly + Ser 1.14% reported by Harn et al. (2018), and it is lower than the apparent fecal digestibility Gly + Ser to Lys ratio of 156% reported by Star et al. (2021) and the total Gly + Ser ratio of 2.44% observed by Dean et al. (2006). It is well known that amino acids in animals can be interconverted (Velisek et al., 2006; Hou et al., 2015). Threonine can be degraded to produce glycine through threonine dehydrogenase (House et al., 2001). Ospina-Rojas et al. (2013) also indicated that higher dietary threonine levels reduce broilers' glycine requirements. Additionally, the growth-promoting effects of cysteine and glycine are closely related (Stipanuk et al., 2011). Thus, differences in the supply of other amino acids in the diet may be responsible for differences in the appropriate glycine supply.

Poultry amino acid requirements should not only be expressed as percentages or ratios to energy but should be calculated as optimal amino acid intake and energy concentration, then predict the expected food intake to determine appropriate nutrient concentrations in the diet (Martin et al., 1994; Sakomura et al., 2015). From our model analysis, we derived the relationship between glycine+serine intake and broiler body weight and daily gain. Based on the regression model: Y = 599.051 × BW^0.75 + 8.381 × ADG, the intake of glycine + serine for broilers can be estimated at different daily gains. When the daily gain is zero, the maintenance requirement for glycine + serine during the 29 to 42-d period is calculated as 599.051 × BW^0.75 (mg). To our knowledge, this is the first study to report a model correlating broiler body weight and daily gain with glycine intake. Further experiments are planned to validate the reliability of this model.

Correlation analysis was performed to identify sensitive indicators associated with broiler growth performance and protein deposition efficiency (Table 8). The results revealed a positive correlation between liver total protein levels and protein deposition efficiency (P < 0.05). As the liver plays a critical role in protein synthesis, the inclusion of appropriate types and ratios of amino acids in the diet can enhance hepatic protein synthesis, potentially resulting in increased total liver protein levels. Our results indicate that serum urea nitrogen levels are higher when dietary glycine levels are too low or too high, and lower at optimal glycine levels. Serum urea nitrogen concentration accurately reflects protein metabolism and amino acid balance in animals (Camp et al., 2022). When amino acids are balanced, serum urea nitrogen concentration decreases. Serum uric acid levels have long been considered an indicator of amino acid balance, with glycine being essential for uric acid synthesis in poultry. Hence, when glycine supplementation is high, the amount of glycine used for uric acid synthesis increases, leading to higher serum uric acid levels. Combining serum urea nitrogen and uric acid levels, we found that the LP134 group likely represents the optimal glycine supplementation level. In diets with imbalanced amino acids, excess amino acids are deaminated to produce 1-carbon units, increasing the ratio of 1-carbon units to glycine. To maintain balance, the body increases uric acid excretion or glycine intake, raising the proportion of uric acid nitrogen in excreted nitrogen (van Milgen, 2021). Therefore, the proportion of uric acid nitrogen in excreted nitrogen can partially reflect dietary amino acid balance. Unfortunately, this experiment did not collect feces to measure uric acid and nitrogen content.

Table 8.

Pearson correlations between growth performance, nitrogen deposition efficiency, and liver and serum parameters.

D42BW BWG FI FCR SUN SUA LTP PDE
D42BW 1.000
BWG 1.000† 1.000
FI 0.972† 0.967† 1.000
FCR −0.973† −0.974† −0.896* 1.000
SUN −0.408 −0.394 −0.348 0.525 1.000
SUA 0.078 0.102 −0.042 −0.106 0.429 1.000
LTP −0.593 −0.598 −0.676 0.420 −0.452 −0.303 1.000
PDE −0.347 −0.353 −0.439 0.181 −0.638 −0.126 0.898* 1.000

Abbreviations: BW, Body weight; BWG, Body weight gain; FI, Feed intake; FCR, Feed conversion ratio; SUN, Serum urea nitrogen; SUA, Serum uric acid; LTP, Liver total protein; PDE, Protein deposition efficiency.

The values in the table represent correlation coefficients.

⁎

Indicates a significant correlation at the 0.05 level (2-tailed).

†

Indicates a significant correlation at the 0.01 level (2-tailed).

Our study found that in the duodenum of broilers fed low-protein diets, the relative expression levels of b0,+AT, EAAT3, and SGLT1 were significantly increased. This indicates that appropriate doses of glycine can promote the earlier absorption of neutral amino acids and glucose in the anterior part of the small intestine. b0,+AT and EAAT3 are key amino acid transporters in the intestine, responsible for mediating the uptake of cystine, cationic amino acids, and acidic amino acids. The additional supplementation of various crystalline amino acids, including cystine, cationic amino acids, and acidic amino acids in low-protein diets, might be responsible for the observed changes. Dietary sugars and artificial sweeteners have been shown to enhance SGLT1 mRNA levels, protein expression, and glucose absorption capacity in the intestines of mice by stimulating the sweet taste receptor T1R3 (Sclafani, 2007). Glycine, known for its sweet taste, may similarly elevate SGLT1 mRNA expression, thereby increasing intestinal glucose absorption. This mechanism could also explain the observed increase in SGLT1 mRNA levels in the intestines when glycine is supplemented in low-protein diets. Additionally, there is a complex interplay between glucose absorption in the ileum and appetite regulation. Glucose transport to the proximal and distal small intestines results in different physiological outcomes (Gromova et al., 2021). Enhanced glucose absorption in the ileum can increase the secretion of glucagon-like peptide-1 and peptide YY, which suppresses appetite and improves growth performance (Chen et al., 2018). This helps explain the lower feed intake and higher FCR observed in the low-protein diet groups (LP130, LP140, and LP145).

Although the primary focus of the study is to determine the optimal glycine supplementation level in LP diets for broilers and to develop a dynamic requirement model, it is noteworthy that higher levels of Gly + Ser supplementation (LP140 and LP145) appeared to adversely affect production traits. Furthermore, the metabolic mechanisms through which these supplements alter blood and liver parameters and gene expression have not yet been validated. These limitations highlight the need for additional research to confirm the observed effects and elucidate the underlying metabolic processes. We acknowledge the significance of these issues and plan to conduct further investigations to address these gaps and refine our understanding of the optimal glycine supplementation in low-protein diets.

CONCLUSION

During 29 to 42 d of age period, the ratio of standardized ileal digestible glycine + serine to lysine in low-protein diets ranging from 130% to 145% exhibits a quadratic relationship with growth performance and slaughter traits. Regression analysis determined that the optimal ratio is 137%, which optimizes broiler growth and slaughter characteristics. The dynamic model for glycine + serine nutritional requirements is y = 599.051 × BW^0.75 + 8.381 × ADG. Additionally, when this ratio exceeds 134%, nitrogen deposition efficiency significantly improves. Supplementing low-protein diets with appropriate levels of glycine significantly enhances the expression of intestinal transport proteins b0,+AT, EAAT3, and SGLT1. This research provides producers with precise nutritional strategies to enhance poultry performance and efficiency under various production goals.

DISCLOSURES

The authors declared that they have no conflicts of interest to this work. We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted.

ACKNOWLEDGMENTS

This study was funded by the National Key R&D Program of China (2021YFD1300404), and the China Agriculture Research System program (CARS-41).

References

  1. Aguihe P.C., Hirata K.A., Ospina-Rojas C.I., Dos Santos T.C., Pozza P.C., Iyayi E.A., Murakami A.E. Effect of glycine equivalent levels in low protein diet containing different SID threonine concentrations on performance, serum metabolites and muscle creatine of broiler chickens. Ital. J. Anim. Sci. 2022;21:1000–1009. [Google Scholar]
  2. Aguihe P.C., Castelani A.B., Ospina-Rojas C.I., Iyayi E.A., Pozza P.C., Murakami A.E. Interaction effects of glycine equivalent and standardized ileal digestible threonine in low protein diets for broiler grower chickens. Anim. Biosci. 2024;37:1053–1064. doi: 10.5713/ab.23.0307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. AOAC International. 2006. Official methods of analysis. 18th ed Association of Offcial Analytical Chemists, Gaithersburg, MD. Accessed Sep. 2024. https://archive.org/details/officialmethodso0000aoac/mode/2up.
  4. AOAC International. 2016. Official methods of analysis. 20th ed Association of Offcial Analytical Chemists, Washington, DC. Accessed Sep. 2024. https://www.aoacofficialmethod.org/.
  5. Aviagen . Arbor Acres Broiler Management Handbook. Accessed Sep. 2024. 2018. https://eu.aviagen.com/assets/Tech_Center/AA_Broiler/AA-BroilerHandbook2018-EN.pdf [Google Scholar]
  6. Awad E.A., Zulkifli I., Soleimani A.F., Aljuobori A. Effects of feeding male and female broiler chickens on low-protein diets fortified with different dietary glycine levels under the hot and humid tropical climate. Ital. J. Anim. Sci. 2017;16:453–461. [Google Scholar]
  7. Bjørn-Yoshimoto W.E., Underhill S.M. The importance of the excitatory amino acid transporter 3 (EAAT3) Neurochem. Int. 2016;98:4–18. doi: 10.1016/j.neuint.2016.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Camp M.J., Solà-Oriol D., Muns R., Gasa J., Llanes N., Manzanilla E.G. Blood and faecal biomarkers to assess dietary energy, protein and amino acid efficiency of utilization by growing and finishing pigs. Porcine. Health Manag. 2022;8:32. doi: 10.1186/s40813-022-00273-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen C., Yin Y., Tu Q., Yang H. Glucose and amino acid in enterocyte: Absorption, metabolism and maturation. Front. Biosci. (Landmark Ed) 2018;23:1721–1739. doi: 10.2741/4669. [DOI] [PubMed] [Google Scholar]
  10. Cruzat V., Macedo R.M., Noel K.K., Curi R., Newsholme P. Glutamine: Metabolism and immune function, supplementation and clinical translation. Nutrients. 2018;10 doi: 10.3390/nu10111564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dean D.W., Bidner T.D., Southern L.L. Glycine supplementation to low protein, amino acid-supplemented diets supports optimal performance of broiler chicks. Poult. Sci. 2006;85:288–296. doi: 10.1093/ps/85.2.288. [DOI] [PubMed] [Google Scholar]
  12. Deng C., Zheng J., Zhou H., You J. Dietary glycine supplementation prevents heat stress-induced impairment of antioxidant status and intestinal barrier function in broilers. Poultry Sci. 2023;102:102408. doi: 10.1016/j.psj.2022.102408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gromova L.V., Fetissov S.O., Gruzdkov A.A. Mechanisms of glucose absorption in the small intestine in health and metabolic diseases and their role in appetite regulation. Nutrients. 2021;13 doi: 10.3390/nu13072474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Harn J.V., Dijkslag M.A., Krimpen M.V. Wageningen Livestock Research (Wageningen Livestock Research report 1116); Wageningen: 2018. Glycine plus serine requirement of broilers fed low-protein diets : a dose response study; p. 36. [Google Scholar]
  15. Hilliar M., Huyen N., Girish C.K., Barekatain R., Wu S., Swick R.A. Supplementing glycine, serine, and threonine in low protein diets for meat type chickens. Poult. Sci. 2019;98:6857–6865. doi: 10.3382/ps/pez435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hou Y., Yin Y., Wu G. Dietary essentiality of "nutritionally non-essential amino acids" for animals and humans. Exp. Biol. Med. (Maywood) 2015;240:997–1007. doi: 10.1177/1535370215587913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. House J.D., Hall B.N., Brosnan J.T. Threonine metabolism in isolated rat hepatocytes. Am. J. Physiol. Endocrinol. Metab. 2001;281:E1300–E1307. doi: 10.1152/ajpendo.2001.281.6.E1300. [DOI] [PubMed] [Google Scholar]
  18. Koopman R., Caldow M.K., Ham D.J., Lynch G.S. Glycine metabolism in skeletal muscle: implications for metabolic homeostasis. Curr. Opin. Clin. Nutr. Metab. Care. 2017;20:237–242. doi: 10.1097/MCO.0000000000000383. [DOI] [PubMed] [Google Scholar]
  19. Kriseldi R., Tillman P.B., Jiang Z., Dozier W.A. Effects of glycine and glutamine supplementation to reduced crude protein diets on growth performance and carcass characteristics of male broilers during a 41-day production period1. J. Appl. Poult. Res. 2017;26:558–572. [Google Scholar]
  20. Lamberson W.R., Firman J.D. A comparison of quadratic versus segmented regression procedures for estimating nutrient requirements1. Poult. Sci. 2002;81:481–484. doi: 10.1093/ps/81.4.481. [DOI] [PubMed] [Google Scholar]
  21. Lehmann A., Hornby P.J. Intestinal SGLT1 in metabolic health and disease. Am. J. Physiol. Gastrointest. Liver Physiol. 2016;310:G887–G898. doi: 10.1152/ajpgi.00068.2016. [DOI] [PubMed] [Google Scholar]
  22. Liu Y., Li S., Huang Z., Dai H., Shi F., Lv Z. Dietary collagen peptide-chelated trace elements supplementation for breeder hens improves the intestinal health of chick offspring. J. Sci. Food Agric. 2024;104:174–183. doi: 10.1002/jsfa.12938. [DOI] [PubMed] [Google Scholar]
  23. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  24. Mansilla W.D., Saraswathy S., García-Ruiz A.I. Dietary protein reduction with stepwise addition of crystalline amino acids and the effect of considering a minimum glycine-serine content in broiler diets. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Martin P.A., Bradford G.D., Gous R.M. A formal method of determining the dietary amino acid requirements of laying-type pullets during their growing period. Br. Poult. Sci. 1994;35:709–724. doi: 10.1080/00071669408417737. [DOI] [PubMed] [Google Scholar]
  26. Ospina-Rojas I.C., Murakami A.E., Oliveira C.A.L., Guerra A.F.Q.G. Supplemental glycine and threonine effects on performance, intestinal mucosa development, and nutrient utilization of growing broiler chickens. Poult. Sci. 2013;92:2724–2731. doi: 10.3382/ps.2013-03171. [DOI] [PubMed] [Google Scholar]
  27. Pesti G.M., Harper A.E., Sunde M.L. Choline/methionine nutrition of starting broiler chicks. Three models for estimating the choline requirement with economic considerations. Poult. Sci. 1980;59:1073–1081. doi: 10.3382/ps.0591073. [DOI] [PubMed] [Google Scholar]
  28. Powell S., Bidner T.D., Southern L.L. Effects of glycine supplementation at varying levels of methionine and cystine on the growth performance of broilers fed reduced crude protein diets1. Poult. Sci. 2011;90:1023–1027. doi: 10.3382/ps.2010-01247. [DOI] [PubMed] [Google Scholar]
  29. Rostagno, H. S., L. F. T. Albino, M. I. Hannas, J. L. Donzele, N. K. Sakomura, F. G. Perazzo, A. Saraiva, M. L. Teixiera, P. B. Rodrigues, R. F. Oliveira, S. L. T. Barreto, and C. O. Brito. 2017. Composition of Feedstuffs and Nutritional Requirements (Brazilian Tables for Poultry and Pigs): 290. 4nd ed. Vi¸cosa, MG, Brazil.
  30. Sakomura N.K., Silva E.P., Dorigam J.C.P., Gous R.M., St-Pierre N. Modeling amino acid requirements of poultry. J. Appl. Poult. Res. 2015;24:267–282. [Google Scholar]
  31. Sclafani A. Sweet taste signaling in the gut. Proc. Natl. Acad. Sci. U S A. 2007;104:14887–14888. doi: 10.1073/pnas.0707410104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Siegert W., Ahmadi H., Rodehutscord M. Meta-analysis of the influence of dietary glycine and serine, with consideration of methionine and cysteine, on growth and feed conversion of broilers. Poult. Sci. 2015;94:1853–1863. doi: 10.3382/ps/pev129. [DOI] [PubMed] [Google Scholar]
  33. Siegert W., Wild K.J., Schollenberger M., Helmbrecht A., Rodehutscord M. Effect of glycine supplementation in low protein diets with amino acids from soy protein isolate or free amino acids on broiler growth and nitrogen utilisation. Br. Poult. Sci. 2016;57:424–434. doi: 10.1080/00071668.2016.1163523. [DOI] [PubMed] [Google Scholar]
  34. Song P., Onishi A., Koepsell H., Vallon V. Sodium glucose cotransporter SGLT1 as a therapeutic target in diabetes mellitus. Expert. Opin. Ther. Targets. 2016;20:1109–1125. doi: 10.1517/14728222.2016.1168808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Star L., Tesseraud S., van Tol M., Minussi I., Corrent E., Lambert W. Production performance and plasma metabolite concentrations of broiler chickens fed low crude protein diets differing in Thr and Gly. Anim. Nutr. 2021;7:472–480. doi: 10.1016/j.aninu.2020.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Stipanuk M.H., Ueki I. Dealing with methionine/homocysteine sulfur: Cysteine metabolism to taurine and inorganic sulfur. J. Inherit. Metab. Dis. 2011;34:17–32. doi: 10.1007/s10545-009-9006-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Szlas A., Kurek J.M., Krejpcio Z. The potential of L-arginine in prevention and treatment of disturbed carbohydrate and lipid metabolism-a review. Nutrients. 2022;14 doi: 10.3390/nu14050961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. van Milgen J. The role of energy, serine, glycine, and 1-carbon units in the cost of nitrogen excretion in mammals and birds. Animal. 2021;15 doi: 10.1016/j.animal.2021.100213. [DOI] [PubMed] [Google Scholar]
  39. Velisek J., Cejpek K. Biosynthesis of food constituents: Amino acids. 3. Modified proteinogenic amino acids—a review. Czech J. Food Sci. 2006;24:59–61. [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES