Skip to main content
NCBI home page
Cellular and Molecular Neurobiology logoLink to Cellular and Molecular Neurobiology
. 2014 Nov 20;35(4):473–482. doi: 10.1007/s10571-014-0141-y

Role of Hippocampus Mitogen-Activated Protein Kinase Phosphatase-1 mRNA Expression and DNA Methylation in the Depression of the Rats with Chronic Unpredicted Stress

Chang-Hong Wang 1, Xiao-Li Zhang 1, Yan Li 2,✉, Guo-Dong Wang 1, Xin-Kai Wang 3, Jiao Dong 1, Qiu-Fen Ning 1
PMCID: PMC11486271  PMID: 25410305

Abstract

Stressful life events especially the chronic unpredictable stress are the obvious precipitating factors of depression. The biological information transduction in cells plays an important role in the molecular biology mechanism of depression. Mitogen-activated protein kinase phosphatase-1 (MKP-1) regulates the cell physiological activity and involves in the adjustment of neural plasticity, function, and survival. This experiment tried to explore the possible effects of MKP-1 in hippocampus on depression of rats by determining the expression of MKP-1 mRNA and DNA methylation in MKP-1 gene promoter. The animal model was established by chronic unpredictable stress, and evaluated by open-field test and weight changes. All the rats were divided into the sham stimulation, the physiological saline, and the fluoxetine (1.25, 2.50, and 5.00 mg/kg) groups randomly. The expression of MKP-1 mRNA in the hippocampus was measured by RT-PCR and the methylation of MKP-1 promoter DNA was detected by COBRA. The chronic unpredicted stress (1) increased the animal movement scores in open-field test, and fluoxetine could prevent this increasement; (2) increased the body weight, and fluoxetine could not prevent this increasement; and (3) increased MKP-1 mRNA expression in the hippocampus, and fluoxetine could prevent it. However, fluoxetine did not influence the DNA methylation of MKP-1 gene promoter in the hippocampus during the chronic unpredicted stress. MKP-1 in the hippocampus might be involved in the etiology of depression, and DNA methylation of MKP-1 gene promoter in the hippocampus did not related with the depression.

Keywords: Chronic unpredicted stress, Depression, Mitogen-activated protein kinase phosphatase-1, DNA methylation, Fluoxetine, mRNA expression

Introduction

Depression, a common mental disease, is characterized by lack of activity, self-worth, and dejection, sad feelings of gloom and inadequacy. The biological information transduction such as the first messenger extending to the second messenger in cells plays an important role in the depression (Duric et al. 2010).

Mitogen-activated protein kinase phosphatase-1 (MKP-1) widely distributes in different tissues and cells that is compatible with its functions. MKP-1 regulates the physiological activity of cells and involves in the regulation of neural plasticity, function, and survival (Fukunaga and Miyamoto 1998; Grewal et al. 1999). In another two studies have shown that MKP-1 plays a role in the mechanism of cell growth, death, and cancer (Boutros et al. 2008).

Extracellular signal-regulated kinase (ERK) signal transduction pathway is one of the core members of the mitogen-activated protein kinase (MAPK) pathway in mammalian cells. Some studies have shown that the block of ERK signaling pathway in the hippocampus induces the significant depressive behaviors (Qi et al. 2009). The depressive process is involved in the inhibition of ERK signaling induced by MKP-1 induction (Dwivedi et al. 2001; Hsiung et al. 2003; Dwivedi et al. 2006). By conducting a whole-genome expression analysis of postmortem hippocampus tissues from 21 depression individuals and 18 healthy controls, it was found that MKP-1 mRNA expression was higher by over twofold in the depression subjects (Fukunaga and Miyamoto 1998). The MKP-1 as an negative regulator of the ERK phosphorylation plays an important role in depression (Jia et al. 2013).

Acute and chronic stress factors are related to the incidence of depression (Lloyd 1980). Chronic stress causes the damage of structure and function of brain especially hippocampus (Herman and Baylin 2003; Hammen et al. 2010). The results of brain imaging and autopsy studies found the cell structure change in several brain limbic areas in patients with major depressive disorder (MDD), which the most obvious phenomenon was the atrophy of pyramidal cells and the volume decrease in the hippocampus (Sheline et al. 1996, 2003; Stockmeier et al. 2004; Neumeister et al. 2005). Some studies also showed that stress caused the atrophy of the top of dendrites in pyramidal cells and the decrease of neurogenesis in dentate gyrus in adult rats (Watanabe et al. 1992; Magarinos et al. 1999; Schmidt and Duman 2007). Chronic stress including chronic, low-level, long-term stressors, like the human life events, can cause the depression in animal models, and the behavioral changes are similar to patients’ performance with depression (Anisman and Matheson 2005).

The heritability of depression is about 37 %. Some studies have shown that the odds ratio (OR) of the first-degree relatives of depression is 2.84 (Sullivan et al. 2000). Depression has such a high hereditary, but its hereditary does not fit to the Mendelian law. Petronis considered that epigenetic was involved in the pathogenesis of MDD. It provided that the direct evidence to MDD development induced by environmental factors and genome (Mill and Petronis 2007; Krishnan and Nestler 2008; McGowan and Kato 2008). It has been put forth the environment-epigenetic–genetics mode in depression (McGowan and Kato 2008). Although Waddington put forward the epigenetic concept in 1939, which did not involve in the regulation of reversible DNA sequence mutation and heritable gene function (Henikoff and Matzke 1997), it was mainly regulated by DNA methylation, histone modifications, and non-coding RNA (Weaver 2009). DNA methylation mainly occurs in 5 carbon atoms of CpG nucleotide cytosine in mammalian, and CpG combined nucleotides is relatively dense in CpG of the gene promoter region. Methylated DNA changes chromatin structure and raises the transcriptional inhibitor resulting in gene silencing through the combination of methylcytosine binding protein (Nan et al. 1997).

However, it is not clear the effects MKP-1 in the hippocampus on depression. The communication tried to study the effects of MKP-1 on the depression with chronic unpredictable stress by determining the expression of MKP-1 mRNA and DNA methylation in MKP-1 gene promoter in the hippocampus of rat.

Materials and Methods

Animals

Adult male Sprague–Dawley rats weighing 250–300 g were used in all experiments (Experimental Animal Center of Henan, China). Animals were housed in a colony of room under controlled temperature, humidity, and a 12 h light/dark cycle (light on at 7:00 a.m.), with food and water unlimitedly. All animal studies have been approved by the appropriate ethics committee and have therefore been performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments.

Groups

A total of fifty rats were divided into five groups randomly and equally, i.e., the sham stimulation, physiological saline, and 1.25, 2.50, and 5.00 mg/kg fluoxetine groups, respectively.

The animals in the sham stimulation group were not given any chronic unpredicted stress stimulation and administered anything by gastric infusion; the animals in the physiological saline group were given the chronic unpredicted stress stimulation and administered physiological saline (1 ml/day) by gastric infusion; in the 1.25/kg mg fluoxetine, 2.50 mg/kg fluoxetine, or 5.00 mg/kg fluoxetine groups, animals were given the chronic unpredicted stress stimulation and administered 1.25, 2.50, or 5.00 mg/kg fluoxetine/physiological saline (1 ml/day) by gastric infusion.

Chronic Unpredicted Stress Stimulation

For the sham stimulation group, the animals were bred in a single cage and stimulated by different stress every day for 21 days after adapting to the living environment (Li et al. 2014; Yang et al. 2009; Luo et al. 2008). The stress stimulation included electric foot shocks (voltage 60 V, current 1 mA, duration 10 s, and stimulation interval 30 s with a total of 20 times), cold water swim (water temperature 4 °C, water depth 30 mm for 5 min), cage shake (frequency 1 per second for 10 min), tail clamp (at 1/3 tail near the body side with the large oval clamp for l min), heat stress (placed in the narrow mouth bottles at 45 °C for 5 min), light–dark cycle reversal (24 h), water deprivation (24 h), food deprivation (24 h), white noise (1500 Hz, 95 dB for l h), restraint (the head limited at the end of cylinder but not affecting the breathing for 2 h), and wet cage (sawdust cage induced by 250 ml water for 24 h). The animals were accepted one kind of stimulation 1 day. The same stress stimulation was not used continuously. One kind of the stress stimulations was only used 2–3 times maximum during the experiment.

Fluoxetine Intervention

One of the research objectives is to verify whether fluoxetine, a classic antidepressant, influences the movement and weight of rats with depression. The animals in three fluoxetine groups were administrated 1.25, 2.50, or 5.00 mg/kg fluoxetine by the gastric infusion, respectively (Lilly Suzhou Pharmaceutical Co., Ltd.)/1 ml physiological saline every day in the next 21 days (Li et al. 2014; Yang et al. 2009; Luo et al. 2008). The animals in the physiological saline group were administrated only 1 ml physiological saline in 22–42 days by gastric infusion after the stress stimulation. All intervention was done at 8:00 a.m. every day.

Open-Field Test and Weight Change

The model was evaluated by open-field test and weight change. Chronic unpredicted stress could produce different behaviors including reduced activity, lack of interest, will diminish and compliance. Weight loss is also one of the typical symptoms of stress. The open-field test (including the distance of passed and the number of up-right) was used to monitor the motor ability and explorative ability in an unfamiliar environment of rat model of depression. Open field was made by opaque material that was 40 cm height. The big square bottom (75 cm × 75 cm) was divided into 25 equal squares. The rat was placed in the open-field center and allowed to explore the maze for 5 min, after which they were returned to their home cage. The maze was cleaned with 75 % ethanol wipes before commencing testing with the next rat. The total distance was analyzed as measures of motor ability, and the number of up-right was analyzed as measures of explorative ability. The behaviors in the open-field were recorded using a video camera (smart version 2.5). The total distance which rat passed through within 5 min was the horizontal movement score, and the number of up-right was the vertical movement score. The behavioral scores were observed 3 times: before stress stimulation, day 21 and day 42. It should be noticed that the rat weight was measured at the same time.

Brain Tissue Collection

Parts of the animals were decapitated in the day before the stress stimulation, day 21 and day 42. The brain was taken out immediately and put into the liquid nitrogen. Then the hippocampus tissue was separated carefully.

RT-PCR for MKP-1 mRNA

The tissue samples (50–100 mg) were grinded into powder in the liquid nitrogen. After the liquid nitrogen evaporation, these tissues were added 1 ml Trizol reagent and ground continually. After the Trizol reagent transferring to the 1.5-ml centrifuge tube at room temperature for 5 min and centrifuging (12,000×g) at 4 °C for 5 min, the supernatant was transferred to new 1.5-ml centrifuge tube. By adding 200 μl of chloroform, mixing shock, incubating at room temperature for 5 min and centrifuging (12,000×g) at 4 °C for 5 min, the supernatant was transferred to another new 1.5-ml centrifuge tube. After joining an equal volume of isopropanol into the supernatant, incubating at room temperature for 10 min and centrifuging (12,000×g) at 4 °C for 10 min, the supernatant discarded. By adding 1 ml of 75 % ethanol to precipitate cleaning sedimentation and centrifuging (12,000×g) at 4 °C for 5 min, the supernatant was removed and the precipitation was dried. Then the precipitate was dissolved in 30 μl DEPC-treated water. The total RNA was obtained.

Total RNA extracted from rat hippocampus tissue was reverse-transcribed into cDNA in a 25 μl reactions using oligo-dT primers. PCR was performed utilizing a Master cycle set for 35 cycles with the following parameters: 180 s at 95 °C, 20 s at 94 °C, 40 s at 66 °C, and 90 s at 72 °C. Utilizing coding DNA sequence obtained from GenBank (National Center for Biotechnology Information), the forward and reverse primers for rat MKP-1 were designed. Specificity of primer sequences were additionally verified with nucleotide blast software (BLAST Interface, NCBI) as follows:

  1. Forward: 5′-GGGCCCAGTGGAGATCCTGTCC-3′; Reverse: 5′-AGCAGTGATACCCAAGGCGTCG-3′;

  2. Forward: 5′-CCCATCTATGAGGGTTACGC-3′; Reverse: 5′-TTTAATGTCACGCACGATTTC-3′

Combined Bisulfate Restriction Analysis

The tissue samples were grinded into powder in condition of liquid nitrogen and transferred to centrifuge tubes (1.5 ml). After centrifuging (12,000×g) at 4 °C for 1 min, the supernatant was removed, and then 200 μl GA was added carefully and shocked until the precipitation becoming suspension. Added 20 μl 20 mg/ml proteinase K solution, mixing, placing at 56 °C until the organization was fully dissolved and centrifuging (12,000×g) for 15 s. Adding 200 μl GB, mixing thoroughly, placing at 70 °C for 10 min and centrifuging (12,000×g) for 15 s. Adding 200 μl alcohol (100 %), mixing thoroughly, centrifuging (12,000×g) for 30 s.

Added to the solution of an adsorption column CB3 (adsorption column set into the collection tube) and centrifuged (12,000×g) for 30 s, the liquid waste was removed. Added 500 μl protein solution GD adsorption column CB3, and centrifuged (12,000×g) for 30 s, the liquid waste was removed. Added 700 μl rinse PW in the adsorption column CB3 and centrifuged (12,000×g) for 30 s, the liquid waste was removed. Added 500 μl rinse PW in the adsorption column CB3 and centrifuged (12,000×g) for 30 s, the liquid waste was removed. The adsorption column CB3 was set into the collection tube and centrifuged (12,000×g) for 2 min, the liquid waste was removed and the adsorption column CB3 was dried. Added 50–200 μl of fluent the TE to float to the middle of the adsorbed film, placed at room temperature for 5 min, and centrifuged (12,000×g) for 2 min, the solution was collected in the EP tube. The extracted DNA was stored at −20 °C.

Add 800 μl RNase-free water to each aliquot and vortex until the Bisulfate Mix was dissolved completely. Prepare the bisulfate reactions in 200 μl PCR tubes. Add each component in the order list: DNA solution (1 ng–2 μg) 10 μl; RNase-free water 10 μl; bisulfate Mix 85 μl; and DNA protect buffer 35 μl. Mix the bisulfate reactions thoroughly and store at room temperature (15–25 °C). Perform the bisulfate DNA conversion using a thermal cycle as the conditions: 5 min at 95 °C (denaturizing); 25 min at 60 °C (incubation); 5 min at 95 °C (denaturizing); 85 min at 60 °C (incubation); 5 min at 95 °C (denaturizing); 175 min at 60 °C (incubation); and 20 °C (hold). Place the PCR tubes and start the thermal cycling incubation.

After the bisulfate conversion completed, centrifuge the PCR tubes, and then transfer the bisulfate reactions to clean 1.5-ml microcentrifuge tubes. Add 560 μl freshly prepared buffer BL containing 10 μg/ml carriers RNA to each sample. Mix the solution by overtaxing and then centrifuge briefly.

Place the necessary number of EpiTect spin columns and collection tubes in a suitable rack. Transfer the entire mixture from each tube into the corresponding EpiTect spin column. Centrifuge the spin column at maximum speed for 1 min. Discard the flow-through, and place the spin column back into the collection tubes.

Add 500 μl buffer BW to each spin column, and centrifuge at maximum speed for 1 min. Discard the flow-through, and place the spin column back into the collection tubes. Add 500 μl buffer BD to each spin column, and incubate for 15 min at room temperature (15–25 °C). Centrifuge the spin column at maximum speed for 1 min. Discard the flow-through, and place the spin column back into the collection tubes. Add 500 μl buffer BW to each spin column, centrifuge at 15,000×g for 1 min and discard the flow-through, and place the spin column back into the collection tubes repeat. Place the spin columns into new 2.0 ml collection tubes, and centrifuge the spin columns at 15,000×g for 1 min to remove any residual liquid. Place the spin columns with open lids into clean 1.5-ml microcentrifuge tubes and incubate the spin column 5 min at 56 °C. Place the spin columns into clean 1.5-ml microcentrifuge tubes. Dispense 20 μl buffer EB onto the center of each membrane. Elute the purified DNA by centrifugation for 1 min at 15,000×g.

PCR was performed utilizing a Master cycle set for 35 cycles with the following parameters: 180 s at 95 °C, 20 s at 94 °C, 40 s at 55 °C, and 90 s at 72 °C. Utilizing DNA sequence obtained from GenBank (National Center for Biotechnology Information), the forward and reverse primers for rat MKP-1 gene promoter were designed as follows:

Forward: TGGTTATTTTTTATTATTTATTTTTTTT; Reverse: AAACACCTACCCTACTCCCCTAC.

Endonuclease BstUI processed 20 μl reaction including the following components: PCR product 5 μl endonuclease BstUI, 10× NEB 2 μl, added 12.5 μl ddH2O to 20 μl, and incubated at 60 °C for 60 min.

Statistical Analysis

Data were expressed as mean ± standard deviation and performed with the SPSS 21.0 statistical package, with analysis of variance. One-way analysis of variance (ANOVA) was accepted with least-significant difference (LSD) as post hoc to make comparison pairwise. Significance was accepted at P < 0.05.

Results

First, we established rat model of depression depending on references (Li et al. 2014; Yang et al. 2009; Luo et al. 2008). After models of depression completed, we intervened with fluoxetine on the part of rats. In order to determine the role of fluoxetine in MKP-1, we measured the expression of MKP-1, and examined DNA methylation of the promoter of MKP-1 gene in the rat hippocampus after the intervention. The purposes of the experiments were to study the possible mechanism that fluoxetine intervened the depression.

Changes of the Animal Movement in Open-Field Test During the Chronic Unpredicted Stress

Horizontal movement: Before stimulation, the differences of score of the horizontal movement in five groups were not significant statistically. Twenty-one days after stimulation, the scores of the horizontal movement in the sham stimulation were less than those in the other four groups. Twenty-one days after intervention, the scores of the horizontal movement in physiological saline group were less than those in the three fluoxetine groups, although these were more than those in the physiological saline group. In summary, compared with the sham stimulation group, fluoxetine could prevent the increase of the animal horizontal movement scores 21 days after the chronic unpredicted stress stimulation (Table 1). Also, the same results showed in the animal vertical movement scores (Table 2).

Table 1.

Effects of fluoxetine on the horizontal scores of the open-field test during the chronic unpredicted stress

Sham stimulation Physiological saline Fluoxetine
1.25 mg/kg 2.50 mg/kg 5.00 mg/kg
Before stimulation 12.28 ± 2.68 11.80 ± 2.25 11.54 ± 2.46 11.25 ± 2.14 10.82 ± 2.9
21 days after stimulation 12.62 ± 2.10 15.15 ± 1.74 15.76 ± 2.87 14.97 ± 2.91 14.34 ± 3.52
21 days after intervention 12.09 ± 4.37 4.50 ± 2.49+++ 8.76 ± 2.27*,++ 11.05 ± 2.76*** 13.39 ± 2.89***
Open in a new tab

All values are expressed as mean ± standard deviation. The animal number in each group is 10. The first row of mean ± standard deviation represents horizontal scores of rats in each group before stimulation. The second row of mean ± standard deviation represents horizontal scores of rats in each group after 21 days of stimulation. The third row of mean ± standard deviation represents horizontal scores of rats in each group after 21 days of intervention

* P < 0.05 and *** P < 0.001 are for the comparison of the horizontal score from physiological saline group and fluoxetine group

++ P < 0.01 and +++ P < 0.001 are for the comparison of the horizontal score from 21 days after stimulation and 21 days after intervention in the same group

Table 2.

Effects of fluoxetine on the vertical scores of the open-field test during the chronic unpredicted stress

Sham stimulation Physiological saline Fluoxetine
1.25 mg/kg 2.50 mg/kg 5.00 mg/kg
Before stimulation 9.90 ± 3.35 10.70 ± 3.06 10.54 ± 2.46 10.25 ± 2.14 9.90 ± 4.84
21 days after stimulation 9.40 ± 3.20 14.80 ± 4.48 14.65 ± 4.81 14.34 ± 3.91 14.00 ± 4.09
21 days after intervention 9.80 ± 5.51 13.90 ± 3.62 11.06 ± 5.27+ 10.45 ± 4.76+,* 9.80 ± 4.02++,**
Open in a new tab

All values are expressed as mean ± standard deviation. The animal number in each group is 10. The first row of mean ± standard deviation represents vertical scores of rats in each group before stimulation. The second row of mean ± standard deviation represents vertical scores of rats in each group after 21 days of stimulation. The third row of mean ± standard deviation represents vertical scores of rats in each group after 21 days of intervention

* P < 0.05 and ** P < 0.01 are for the comparison of the vertical score from physiological saline group and fluoxetine group

+ P < 0.05 and ++ P < 0.01 are for the comparison of the vertical score from 21 days after stimulation and 21 days after intervention in the same group

The animals in the physiological saline group were given the chronic unpredicted stress stimulation and administered physiological saline (1 ml/day) by gastric infusion in the second 21 days. Gastric infusion was an acute stimulus for a rat in the 21 days, so the animals’ horizontal movement increased in the physiological saline group. There is reason to believe that acute stress increased rat activity, but the activity gradually decreased with the extension of the stress. Excitement and anxiety are transformed to suppression and depression (Beck and Luine 1999).

Changes of the Body Weight During the Chronic Unpredicted Stress

Compared with the sham stimulation group, the body weight of the animals increased 21 days after the chronic unpredicted stress stimulation, and the fluoxetine could not prevent this increase (Table 3). In order to alleviate depression, rats ingested large quantities of food. The fluoxetine had a side effect that caused the rats ate the more food, so that the rat weight did not decrease in 21 days after intervention.

Table 3.

Effects of fluoxetine on the weight during the chronic unpredicted stress

Sham stimulation Physiological saline Fluoxetine
1.25 mg/kg 2.50 mg/kg 5.00 mg/kg
Before stimulation 290.90 ± 11.93 297.00 ± 13.39 298.02 ± 12.49 296.91 ± 12.87 297.80 ± 14.93
21 days after stimulation 371.80 ± 32.13 330.70 ± 19.01 324.65 ± 18.87 326.35 ± 17.92 322.20 ± 21.69
21 days after intervention 426.00 ± 34.19 324.10 ± 19.64 332.15 ± 13.21 340.42 ± 15.77*,+ 351.00 ± 14.87**,++
Open in a new tab

All values are expressed as mean ± standard deviation. The animal number in each group is 10. The first row of mean ± standard deviation represents weight of rats in each group before stimulation. The second row of mean ± standard deviation represents weight of rats in each group after 21 days of stimulation. The third row of mean ± standard deviation represents weight of rats in each group after 21 days of intervention

* P < 0.05 and ** P < 0.01 are for the comparison of the weight from physiological saline group and fluoxetine group

+ P < 0.05 and ++ P < 0.01 are for the comparison of the weight from 21 days after stimulation and 21 days after intervention in the same group

Changes of the MKP-1 mRNA Expression in the Hippocampus During the Chronic Unpredicted Stress

Compared with the sham stimulation group, the MKP-1 mRNA expression in the hippocampus increased 21 days after the chronic unpredicted stress stimulation, and the fluoxetine could prevent this increase (Table 4; Fig. 1). Fluoxetine dosage was accorded to the human, i.e., the calculating formula was as follows: dB = dA × RB/RA × (WA/WB) 1/3 [A is human, B is rat, d is dose of per kilogram of body weight, R is coefficient of body weight (rat 90, human 100), W is body weight (rat 0.25 kg, human 50 kg). By calculation, animals were administered fluoxetine 5 mg/kg (Kodama et al. 2004; Malberg et al. 2000). In pharmacological studies, dose usually was set to geometric sequence, and the intermediate dose was more suitable for research purposes. So we put fluoxetine intervention group divide into three different dose groups again. The group of 1.25 mg treatment significantly evaluated the expression level of MKP-1 after 21-day treatment, it may be related to the animals themselves, the experimental conditions and climate. We should again note that conversion dose only was a reference value and should be explored in the pre-test. However, the actin mRNA expression in hippocampus was not influenced by either chronic unpredicted stress stimulation or the fluoxetine intervention.

Table 4.

Effects of fluoxetine on the MKP-1 mRNA expression in the hippocampus during the chronic unpredicted stress

Sham stimulation Physiological saline Fluoxetine
1.25 mg/kg 2.50 mg/kg 5.00 mg/kg
Before stimulation 1.03 ± 0.19 1.02 ± 0.13 1.04 ± 0.19 1.04 ± 0.17 1.03 ± 0.16
21 days after stimulation 1.04 ± 0.16 1.15 ± 0.12 1.15 ± 0.17 1.16 ± 0.12 1.15 ± 0.13
21 days after intervention 1.02 ± 0.17 1.26 ± 0.10 1.21 ± 0.15 1.09 ± 0.15*,+ 1.03 ± 0.12**,+
Open in a new tab

All values are calculated by MKP-1 mRNA expression/actin mRNA expression in the same group, and expressed as mean ± standard deviation. The animal number in each group is 10. The first row of mean ± standard deviation represents MKP-1 mRNA expression of rats in each group before stimulation. The second row of mean ± standard deviation represents MKP-1 mRNA expression of rats in each group after 21 days of stimulation. The third row of mean ± standard deviation represents MKP-1 mRNA expression of rats in each group after 21 days of intervention

* P < 0.05 and ** P < 0.01 are for the comparison of the MKP-1 mRNA expression from physiological saline group and fluoxetine group

+ P < 0.05 is for the comparison of the MKP-1 mRNA expression from 21 days after stimulation and 21 days after intervention in the same group

Fig. 1.

Fig. 1

Open in a new tab

The MKP-1 mRNA expression in the rat hippocampus 21 days after fluoxetine intervention during the chronic unpredicted stress stimulation. Bands 1, 3, 5, 7, or 9 are for the expression of actin mRNA in the rat hippocampus as the control; bands 2, 4, 6, 8, or 10 are for the expression of MKP-1 mRNA in the rat hippocampus. Band 1 is serving as control for band 2; band 3 is serving as control for band 4; band 5 is serving as control for band; band 7 is serving as control for band 8; band 9 is serving as control for band 10

Changes of DNA Methylation of the Promoter of MKP-1 Gene in the Hippocampus During the Chronic Unpredicted Stress

By observing fragments of enzyme digestion, we determined whether existed DNA methylation in MKP-1 gene promoter, but we did not find any fragments of enzyme digestion. It showed that the fluoxetine intervention did not influence the DNA methylation of MKP-1 gene promoter in the hippocampus. It showed that the fluoxetine intervention did not influence the DNA methylation of MKP-1 gene promoter in the hippocampus during the chronic unpredicted stress (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

The DNA methylation of MKP-1 gene promoter in the hippocampus 21 days after fluoxetine intervention during the chronic unpredicted stress. Bands 1–9 are for the methylated products of different rats MKP-1 gene promoter in each group

Discussion

The etiology and pathogenesis of depression are still confusing, and related genes could explain parts of the symptoms of affective disorder. Studies have shown that the interaction of genes and environment may be associated with affective disorders (Caspi et al. 2003). The most common stress in the human living environment is from spirit or society, and chronic stress could accelerate the pathophysiological process of depression (Bjorkqvist 2001). Chronic mild stress and acute stress could not produce the same symptoms, the former may produce depression-like symptoms (Anisman and Merali 1997), and the latter may promote the symptoms of posttraumatic stress disorder (PTSD) (Maier 2001). Human predictability stress and unpredictability stress may produce different results, unpredictability stress create typical and greater negative impact (Baker and Stephenson 2000). Therefore, the animal depression model induced by chronic unpredicted stress (CUS) has some advantages. CUS model is the most widely used and most effective rodent depression model (Hsiung et al. 2003; Dwivedi et al. 2006; Banasr and Duman 2008). Nevertheless, the depression model cannot be in line with the human condition fully. In order to be considered valid, it must meet a minimum standard (Nemeroff 2002; Newport et al. 2002; Willner and Mitchell 2002). Many experiments are good at using the validity of model standards, but it should be recognized that no animal model has a 100 % prediction rate.

Social stress could bring about different behaviors including reduced activity (Koolhaas et al. 1997), will diminish (McGrady 1984) and compliance (Ruis et al. 1999). Weight loss is also one of the typical symptoms of stress. The open-field test was used to monitor the exploratory behavior in an unfamiliar environment, the extent of nervous fear, alertness to the new environment, adaptability and cognitive ability of rat model of depression. Horizontal movement, vertical movement, and body weight were used to evaluate the success of depression model. This study showed that the ability of movement increased during 21-day stimulation, and then decreased after prolonged stimulation. There is reason to believe that acute stress increased rat activity, but the activity gradually decreased with the extension of the stress. Excitement and anxiety are transformed to suppression and depression (Beck and Luine 1999). This rat depression model was similar with the parts of human depression performance, such as less exercise, will decline and lack of interest.

MAKP is a conserved signaling pathway that is activated by a series of different extracellular stimuli. It could regulate physiological and pathological processes in mammals including cell proliferation, differentiation, transformation, stress response, inflammation and growth retardation, and apoptosis (Chang and Karin 2001; Pearson et al. 2001; Dong et al. 2002; Wada and Penninger 2004). MKP-1 is one of the phosphatases encoded by genome in mammalian and a member of dual-specificity phosphatase family (Camps et al. 2000; Farooq and Zhou 2004; Dickinson and Keyse 2006). MKP-1 could adjust three classic MAKP pathways (ERK, JNK, and P38), and to make dephosphorylation and inactivation (Muda et al. 1996; Tanoue et al. 1999; Slack et al. 2001). MKP-1 is also the endogenous inhibitor of MAKP activation pathway (Wang and Liu 2007), which leads to the instability of microtubule by reducing c-Jun N-terminal kinase (JNK) substrate phosphorylation (Bogoyevitch and Kobe 2006; Jeanneteau et al. 2010). The longer is the expression of MKP-1, the more serious is the phosphorylation of JNK and microtubule instability. It has shown that long-term entopic expression of MKP-1 hinder axonal growth in neuronal development stage (Jeanneteau and Deinhardt 2011). The disorder of MKP-1 may cause a serious impact on learning and memory. It was speculated that MKP-1 plays an important role in the nervous system by regulating the MAKP pathway to influence the physiological and pathological process of neurons and synapses.

The changes of hippocampus structure and function lead to the occurrence of MDD including the symptoms of cognitive damage, depressed mood, feelings of helplessness, anorgasmia, and damage of hypothalamus–pituitary–adrenal axis. Chronic stress could cause the structure and function damage in brain especially hippocampus. The present study showed that MKP-1 mRNA expression increased in the hippocampus during the chronic unpredicted stress stimulation, and the fluoxetine could prevent this increasement of MKP-1 mRNA expression in a dose-dependent manner. The data suggested that MKP-1 in the hippocampus was involved in the etiology of depression.

The expression of MKP-1 is dominated by neuronal activity in the brain sensory area, and often is detected together with brain derived neurotrophic factor (BDNF) (Genoud et al. 2004; Horita et al. 2010). The conditional deletion of BDNF in prefrontal cortex reduced the transcription of MKP-1 significantly (Glorioso et al. 2006). A study in vivo found that the expression of MKP-1 protein was low in developing inhibitory neurons and excitatory neurons, but turned higher after BDNF treatment (Bogoyevitch and Kobe 2006).

Organisms differ in the pattern of DNA methylation across their genome (Suzuki and Bird 2008). DNA methylation is an indispensable epigenetic form in mammalian genomes. In mammals, DNA methylation occurs mainly at the CpG dinucleotide which not only presents widely in CpG islands (CGIs), but also distribute sparsely in the genome (Gardiner-Garden and Frommer 1987). However, DNA methylation is not exclusively influenced by intrinsic signals during development. In fact, internal factors or environmental factors cause the methylation (Weaver et al. 2004; Blewitt et al. 2006; Manning et al. 2006; Crews et al. 2007; Kucharski et al. 2008; Jablonka and Raz 2009). DNA methylation pattern change is related to human diseases including cancer (Feinberg and Tycko 2004). Human tumor is lack of DNA methylation, but gene promoter exists hypermethylation (Herman and Baylin 2003). A high level of methylation is usually associated with silent (Weaver et al. 2004).

The main purpose of this study was to confirm the influence of environmental factors on DNA methylation and the relationship between DNA methylation and depression. However, it showed that the fluoxetine intervention did not influence the DNA methylation of MKP-1 gene promoter in the hippocampus during the chronic unpredicted stress. The data suggested that DNA methylation in MKP-1 gene promoter might not be involved in depression. However, brain tissue heterogeneity could influence DNA methylation (Jeanneteau and Deinhardt 2011). So the best way may determine DNA methylation in different brain cells. It is necessary to research in the future.

The present study made clear that (1) the chronic unpredicted stress increased significantly MKP-1 mRNA expression in the hippocampus; (2) fluoxetine intervention prevented the increase of MKP-1 mRNA expression in the hippocampus; and (3) the fluoxetine did not influence the DNA methylation of MKP-1 gene promoter in the hippocampus during the chronic unpredicted stress in the rat depressive model. The data indicated that MKP-1 in the hippocampus might be involved in the etiology of depression, and DNA methylation of MKP-1 gene promoter in the hippocampus did not related with the depression.

Acknowledgments

We thank many investigators in Department of Clinical Mental Health, the Second Affiliated Hospital of Xinxiang Medical University. This work was supported by Grants from the Medical Technology Foundation of Henan Province (112102310211 and 142300410025), Basic Research of Natural Science Foundation of Henan Province (2009A330009), Cultivate scientific research project funds of Xinxiang Medical College (2013ZD117), Scientific Research Projects of High-level Personnel of Xinxiang Medical University (08BSKYQD-004), and Laboratory for Biological Psychiatry of Henan Province.

Conflict of interest

The authors declare that they have no conflict of interest.

Footnotes

Chang-Hong Wang and Xiao-Li Zhang have contributed equally to this work.

References

  1. Anisman H, Matheson K (2005) Stress, depression, and anhedonia: caveats concerning animal models. Neurosci Biobehav Rev 29:525–546 [DOI] [PubMed] [Google Scholar]
  2. Anisman H, Merali Z (1997) Chronic stressors and depression: distinguishing characteristics and individual profiles. Psychopharmacology 134:330–332 [DOI] [PubMed] [Google Scholar]
  3. Baker SR, Stephenson D (2000) Prediction and control as determinants of behavioural uncertainty: effects on task performance and heart rate reactivity. Integr Physiol Behav Sci 35:235–250 [DOI] [PubMed] [Google Scholar]
  4. Banasr M, Duman RS (2008) Glial loss in the prefrontal cortex is sufficient to induce depressive-like behaviors. Biol Psychiatry 64:863–870 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Beck KD, Luine VN (1999) Food deprivation modulates chronic stress effects on object recognition in male rats: role of monoamines and amino acids. Brain Res 830:56–71 [DOI] [PubMed] [Google Scholar]
  6. Bjorkqvist K (2001) Social defeat as a stressor in humans. Physiol Behav 73:435–442 [DOI] [PubMed] [Google Scholar]
  7. Blewitt ME, Vickaryous NK, Paldi A, Koseki H, Whitelaw E (2006) Dynamic reprogramming of DNA methylation at an epigenetically sensitive allele in mice. PLoS Genet 2:e49 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bogoyevitch MA, Kobe B (2006) Uses for JNK: the many and varied substrates of the c-Jun N-terminal kinases. Microbiol Mol Biol Rev 70:1061–1095 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Boutros T, Chevet E, Metrakos P (2008) Mitogen-activated protein (MAP) kinase/MAP kinase phosphatase regulation: roles in cell growth, death, and cancer. Pharmacol Rev 60:261–310 [DOI] [PubMed] [Google Scholar]
  10. Camps M, Nichols A, Arkinstall S (2000) Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J 14:6–16 [PubMed] [Google Scholar]
  11. Caspi A, Sugden K, Moffitt TE, Taylor A, Craig IW, Harrington H, McClay J, Mill J, Martin J, Braithwaite A, Poulton R (2003) Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene. Science 301:386–389 [DOI] [PubMed] [Google Scholar]
  12. Chang L, Karin M (2001) Mammalian MAP kinase signalling cascades. Nature 410:37–40 [DOI] [PubMed] [Google Scholar]
  13. Crews D, Gore AC, Hsu TS, Dangleben NL, Spinetta M, Schallert T, Anway MD, Kinner MK (2007) Transgenerational epigenetic imprints on mate preference. Proc Natl Acad Sci USA 104:5942–5946 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dickinson RJ, Keyse SM (2006) Diverse physiological functions for dual-specificity MAP kinase phosphatases. J Cell Sci 119:4607–4615 [DOI] [PubMed] [Google Scholar]
  15. Dong C, Davis RJ, Flavell RA (2002) MAP kinases in the immune response. Annu Rev Immunol 20:55–72 [DOI] [PubMed] [Google Scholar]
  16. Duric V, Banasr M, Licznerski P, Schmidt HD, Stockmeier CA, Simen AA, Newton SS, Duman RS (2010) A negative regulator of MAP kinase causes depressive behavior. Nat Med 16:1328–1332 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dwivedi Y, Rizavi HS, Roberts RC, Conley RC, Tamminga CA, Pandey GN (2001) Reduced activation and expression of ERK1/2 MAP kinase in the post-mortem brain of depressed suicide subjects. J Neurochem 77:916–928 [DOI] [PubMed] [Google Scholar]
  18. Dwivedi Y, Rizavi HS, Conley RR, Pandey GN (2006) ERK MAP kinase signaling in post-mortem brain of suicide subjects: differential regulation of upstream Raf kinases Raf-1 and B-Raf. Mol Psychiatry 11:86–98 [DOI] [PubMed] [Google Scholar]
  19. Farooq A, Zhou MM (2004) Structure and regulation of MAPK phosphatases. Cell Signal 16:769–779 [DOI] [PubMed] [Google Scholar]
  20. Feinberg AP, Tycko B (2004) The history of cancer epigenetics. Nat Rev Cancer 4:143–153 [DOI] [PubMed] [Google Scholar]
  21. Fukunaga K, Miyamoto E (1998) Role of MAP kinase in neurons. Mol Neurobiol 16:79–95 [DOI] [PubMed] [Google Scholar]
  22. Gardiner-Garden M, Frommer M (1987) CpG islands in vertebrate genomes. J Mol Biol 196:261–282 [DOI] [PubMed] [Google Scholar]
  23. Genoud C, Knott GW, Sakata K, Lu B, Welker E (2004) Altered synapse formation in the adult somatosensory cortex of brain-derived neurotrophic factor heterozygote mice. J Neurosci 24:2394–2400 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Glorioso C, Sabatini M, Unger T, Hashimoto T, Monteggia LM, Lewis DA, Mirnics K (2006) Specificity and timing of neocortical transcriptome changes in response to BDNF gene ablation during embryogenesis or adulthood. Mol Psychiatry 11:633–648 [DOI] [PubMed] [Google Scholar]
  25. Grewal SS, York RD, Stork PJ (1999) Extracellular-signal-regulated kinase signalling in neurons. Curr Opin Neurobiol 9:544–553 [DOI] [PubMed] [Google Scholar]
  26. Hammen C, Brennan PA, Keenan-Miller D, Hazel NA, Najman JM (2010) Chronic and acute stress, gender, and serotonin transporter gene–environment interactions predicting depression symptoms in youth. J Child Psychol Psychiatry 51:180–187 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Henikoff S, Matzke MA (1997) Exploring and explaining epigenetic effects. Trends Genet 13:293–295 [DOI] [PubMed] [Google Scholar]
  28. Herman JG, Baylin SB (2003) Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 349:2042–2054 [DOI] [PubMed] [Google Scholar]
  29. Horita H, Wada K, Rivas MV, Hara E, Jarvis ED (2010) The dusp1 immediate early gene is regulated by natural stimuli predominantly in sensory input neurons. J Comp Neurol 518:2873–2901 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hsiung SC, Adlersberg M, Arango V, Mann JJ, Tamir H, Liu KP (2003) Attenuated 5-HT1A receptor signaling in brains of suicide victims: involvement of adenylyl cyclase, phosphatidylinositol 3-kinase, Akt and mitogen-activated protein kinase. J Neurochem 87:182–194 [DOI] [PubMed] [Google Scholar]
  31. Jablonka E, Raz G (2009) Transgenerational epigenetic inheritance: prevalence, mechanisms, and implications for the study of heredity and evolution. Q Rev Biol 84:131–176 [DOI] [PubMed] [Google Scholar]
  32. Jeanneteau F, Deinhardt K (2011) Fine-tuning MAPK signaling in the brain: the role of MKP-1. Commun Integr Biol 4:281–283 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Jeanneteau F, Deinhardt K, Miyoshi G, Bennett AM, Chao MV (2010) The MAP kinase phosphatase MKP-1 regulates BDNF-induced axon branching. Nat Neurosci 13:1373–1379 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Jia W, Liu R, Shi JG, Wu B, Dang W (2013) Differential regulation of MAPK phosphorylation in the dorsal hippocampus in response to prolonged morphine withdrawal-induced depressive-like symptoms in mice. PLoS ONE 8:e66111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kodama M, Fujioka T, Duman RS (2004) Chronic olanzapine or fluox-etine treatment increases cell proliferation in rat hippocampus and frontal cortex. J Biol Psychiatry 56:570–580 [DOI] [PubMed] [Google Scholar]
  36. Koolhaas JM, De Boer SF, De Rutter AJ, Meerlo P, Sgoifo A (1997) Social stress in rats and mice. Acta Physiol Scand Suppl 640:69–72 [PubMed] [Google Scholar]
  37. Krishnan V, Nestler EJ (2008) The molecular neurobiology of depression. Nature 455:894–902 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kucharski R, Maleszka J, Foret S, Maleszka R (2008) Nutritional control of reproductive status in honeybees via DNA methylation. Science 319:1827–1830 [DOI] [PubMed] [Google Scholar]
  39. Li Y, Wang HL, Wang XP, Liu ZC, Wan QR, Wang GH (2014) Differential expression of hippocampal EphA4 and ephrinA3 in anhedonic-like behavior, stress resilience, and antidepressant drug treatment after chronic unpredicted mild stress. Neurosci Lett 566:292–297 [DOI] [PubMed] [Google Scholar]
  40. Lloyd C (1980) Life events and depressive disorder reviewed. II. Events as precipitating factors. Arch Gen Psychiatry 37:541–548 [DOI] [PubMed] [Google Scholar]
  41. Luo DD, An SC, Zhang X (2008) Involvement of hippocampal serotonin and neuropeptide Y in depression induced by chronic unpredicted mild stress. Brain Res Bull 77:8–12 [DOI] [PubMed] [Google Scholar]
  42. Magarinos AM, Deslandes A, McEwen BS (1999) Effects of antidepressants and benzodiazepine treatments on the dendritic structure of CA3 pyramidal neurons after chronic stress. Eur J Pharmacol 371:113–122 [DOI] [PubMed] [Google Scholar]
  43. Maier SF (2001) Exposure to the stressor environment prevents the temporal dissipation of behavioral depression/learned helplessness. Biol Psychiatry 49:763–773 [DOI] [PubMed] [Google Scholar]
  44. Malberg J, Eisch AJ, Nestler EJ, Duman RS (2000) Chronic antidepressant treatment increases neurogenesis in adult hippocampus. J Neurosci 20:9104–9110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Manning K, Tor M, Poole M, Hong Y, Thompson AJ, King GJ, Giovannoni JJ, Seymour GB (2006) A naturally occurring epigenetic mutation in a gene encoding an SBP-box transcription factor inhibits tomato fruit ripening. Nat Genet 38:948–952 [DOI] [PubMed] [Google Scholar]
  46. McGowan PO, Kato T (2008) Epigenetics in mood disorders. Environ Health Prev Med 13:16–24 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. McGrady AV (1984) Effects of psychological stress on male reproduction: a review. Arch Androl 13:1–7 [DOI] [PubMed] [Google Scholar]
  48. Mill J, Petronis A (2007) Molecular studies of major depressive disorder: the epigenetic perspective. Mol Psychiatry 12:799–814 [DOI] [PubMed] [Google Scholar]
  49. Muda M, Theodosiou A, Rodrigues N, Boschert U, Camps M, Gillieron C, Davies K, Ashworth A, Arkinstall S (1996) The dual specificity phosphatases M3/6 and MKP-3 are highly selective for inactivation of distinct mitogen-activated protein kinases. J Biol Chem 271:27205–27208 [DOI] [PubMed] [Google Scholar]
  50. Nan X, Campoy FJ, Bird A (1997) MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin. Cell 88:471–481 [DOI] [PubMed] [Google Scholar]
  51. Nemeroff CB (2002) Recent advances in the neurobiology of depression. Psychopharmacol Bull 36(Suppl 2):6–23 [PubMed] [Google Scholar]
  52. Neumeister A, Wood S, Bonne O, Nugent AC, Luckenbaugh DA, Young T, Bain EE, Charney DS, Drevets WC (2005) Reduced hippocampal volume in unmedicated, remitted patients with major depression versus control subjects. Biol Psychiatry 57:935–937 [DOI] [PubMed] [Google Scholar]
  53. Newport DJ, Stowe ZN, Nemeroff CB (2002) Parental depression: animal models of an adverse life event. Am J Psychiatry 159:1265–1283 [DOI] [PubMed] [Google Scholar]
  54. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH (2001) Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev 22:153–183 [DOI] [PubMed] [Google Scholar]
  55. Qi X, Lin W, Wang D, Pan Y, Wang W, Sun M (2009) A role for the extracellular signal-regulated kinase signal pathway in depressive-like behavior. Behav Brain Res 199:203–209 [DOI] [PubMed] [Google Scholar]
  56. Ruis MA, te Brake JH, Buwalda B, De Boer SF, Meerlo P, Korte SM, Blokhuis HJ, Koolhaas JM (1999) Housing familiar male wildtype rats together reduces the long-term adverse behavioural and physiological effects of social defeat. Psychoneuroendocrinology 24:285–300 [DOI] [PubMed] [Google Scholar]
  57. Schmidt HD, Duman RS (2007) The role of neurotrophic factors in adult hippocampal neurogenesis, antidepressant treatments and animal models of depressive-like behavior. Behav Pharmacol 18:391–418 [DOI] [PubMed] [Google Scholar]
  58. Sheline YI, Wang PW, Gado MH, Csernansky JG, Vannier MW (1996) Hippocampal atrophy in recurrent major depression. Proc Natl Acad Sci USA 93:3908–3913 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Sheline YI, Gado MH, Kraemer HC (2003) Untreated depression and hippocampal volume loss. Am J Psychiatry 160:1516–1518 [DOI] [PubMed] [Google Scholar]
  60. Slack DN, Seternes OM, Gabrielsen M, Keyse SM (2001) Distinct binding determinants for ERK2/p38alpha and JNK map kinases mediate catalytic activation and substrate selectivity of map kinase phosphatase-1. J Biol Chem 276:16491–16500 [DOI] [PubMed] [Google Scholar]
  61. Stockmeier CA, Mahajan GJ, Konick LC, Overholser JC, Jurjus GJ, Meltzer HY, Uylings HB, Friedman L, Rajkowska G (2004) Cellular changes in the postmortem hippocampus in major depression. Biol Psychiatry 56:640–650 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Sullivan PF, Neale MC, Kendler KS (2000) Genetic epidemiology of major depression: review and meta-analysis. Am J Psychiatry 157:1552–1562 [DOI] [PubMed] [Google Scholar]
  63. Suzuki MM, Bird A (2008) DNA methylation landscapes: provocative insights from epigenomics. Nat Rev Genet 9:465–476 [DOI] [PubMed] [Google Scholar]
  64. Tanoue T, Moriguchi T, Nishida E (1999) Molecular cloning and characterization of a novel dual specificity phosphatase, MKP-5. J Biol Chem 274:19949–19956 [DOI] [PubMed] [Google Scholar]
  65. Wada T, Penninger JM (2004) Mitogen-activated protein kinases in apoptosis regulation. Oncogene 23:2838–2849 [DOI] [PubMed] [Google Scholar]
  66. Wang X, Liu Y (2007) Regulation of innate immune response by MAP kinase phosphatase-1. Cell Signal 19:1372–1382 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Watanabe Y, Gould E, McEwen BS (1992) Stress induces atrophy of apical dendrites of hippocampal CA3 pyramidal neurons. Brain Res 588:341–345 [DOI] [PubMed] [Google Scholar]
  68. Weaver IC (2009) Shaping adult phenotypes through early life environments. Birth Defects Res C 87:314–326 [DOI] [PubMed] [Google Scholar]
  69. Weaver IC, Cervoni N, Champagne FA, D’Alessio AC, Sharma S, Seckl JR, Dymov S, Szyf M, Meaney MJ (2004) Epigenetic programming by maternal behavior. Nat Neurosci 7:847–854 [DOI] [PubMed] [Google Scholar]
  70. Willner P, Mitchell PJ (2002) The validity of animal models of predisposition to depression. Behav Pharmacol 13:169–188 [DOI] [PubMed] [Google Scholar]
  71. Yang C, Wang GH, Wang HL, Liu ZC, Wang XP (2009) Cytoskeletal alterations in rat hippocampus following chronic unpredictable mild stress and re-exposure to acute and chronic unpredictable mild stress. Behav Brain Res 205:518–524 [DOI] [PubMed] [Google Scholar]

Articles from Cellular and Molecular Neurobiology are provided here courtesy of Springer

RESOURCES