MAD1 upregulation sensitizes to inflammation-mediated tumor formation

Sarah E Copeland; Santina M Snow; Jun Wan; Kristina A Matkowskyj; Richard B Halberg; Beth A Weaver

doi:10.1371/journal.pgen.1011437

. 2024 Oct 7;20(10):e1011437. doi: 10.1371/journal.pgen.1011437

MAD1 upregulation sensitizes to inflammation-mediated tumor formation

Sarah E Copeland ¹, Santina M Snow ^2,^3,⁴, Jun Wan ⁵, Kristina A Matkowskyj ^6,⁷, Richard B Halberg ^3,^4,⁷, Beth A Weaver ^3,^7,^8,^*

Editor: Ajit P Joglekar⁹

PMCID: PMC11486420 PMID: 39374311

Abstract

Mitotic Arrest Deficient 1 (gene name MAD1L1), an essential component of the mitotic spindle assembly checkpoint, is frequently overexpressed in colon cancer, which correlates with poor disease-free survival. MAD1 upregulation induces two phenotypes associated with tumor promotion in tissue culture cells–low rates of chromosomal instability (CIN) and destabilization of the tumor suppressor p53. Using CRISPR/Cas9 gene editing, we generated a novel mouse model by inserting a doxycycline (dox)-inducible promoter and HA tag into the endogenous mouse Mad1l1 gene, enabling inducible expression of HA-MAD1 following exposure to dox in the presence of the reverse tet transactivator (rtTA). A modest 2-fold overexpression of MAD1 in murine colon resulted in decreased p53 expression and increased mitotic defects consistent with CIN. After exposure to the colon-specific inflammatory agent dextran sulfate sodium (DSS), 31% of mice developed colon lesions, including a mucinous adenocarcinoma, while none formed in control animals. Lesion incidence was particularly high in male mice, 57% of which developed at least one hyperplastic polyp, adenoma or adenocarcinoma in the colon. Notably, mice expressing HA-MAD1 also developed lesions in tissues in which DSS is not expected to induce inflammation. These findings demonstrate that MAD1 upregulation is sufficient to promote colon tumorigenesis in the context of inflammation in immune-competent mice.

Author summary

Worldwide, colorectal cancer is the third most commonly diagnosed cancer and the second-highest cause of cancer-related deaths. A better understanding of the molecular causes of colorectal cancer could provide novel therapeutic targets for this disease. Mitotic Arrest Deficient-1 (MAD1) is commonly overexpressed in colorectal cancers, and elevated expression of MAD1 is associated with worse prognosis. Here we generated a new mutant mouse with inducible, modest overexpression of MAD1. First identified for its role in mitosis, MAD1 is required to ensure proper chromosome segregation. Elevated expression of MAD1 causes chromosome mis-segregation in the colons of these mice. During interphase, overexpressed MAD1 destabilizes the well-known tumor suppressor protein, p53. Consistent with this, mouse colons modestly overexpressing MAD1 show decreased expression of p53. Since inflammation is a risk factor for colorectal cancer, we induced inflammation in the colon using dextran sulfate sodium (DSS) and found that MAD1 overexpression significantly increased the incidence of colon tumors. Like inflammation-mediated colon tumors in humans, in the mice these tumors were more common in males than females. This work shows that MAD1 overexpression can promote colon cancer and suggests that MAD1 may be a novel drug target for this disease.

Introduction

Colorectal cancer is the third leading cause of cancer-related death in the US [1], underscoring the necessity of identifying and validating drivers of the disease that may serve as novel therapeutic targets. Overexpression of mitotic genes, including MAD1L1, is commonly observed in colorectal and other cancers [2]. Many mitotic genes are cell cycle regulated, so their apparent upregulation may simply be due to the increased proliferation of cancerous versus normal tissue. However, MAD1 is not cell cycle regulated at the mRNA or protein level [3,4], suggesting that MAD1 overexpression confers a selective advantage to tumors. Consistent with this, MAD1 overexpression causes at least two phenotypes associated with tumor-promoting effects. First, MAD1 overexpression induces low rates of recurrent chromosome missegregation termed chromosomal instability (CIN) [3]. Low CIN promotes tumorigenesis in some contexts [5,6], though it has also been reported to activate the immune system, which limits tumorigenesis by eliminating aneuploid cells [7,8]. Second, MAD1 overexpression results in destabilization of the tumor suppressor p53 [9].

The best characterized function of MAD1 is in preventing CIN, a feature present in ~50% of colon cancers [5]. MAD1 was one of the original mitotic spindle assembly checkpoint genes discovered in budding yeast [10]. It plays a well-established, evolutionarily conserved role in the mitotic checkpoint [11–14], which ensures that cells segregate DNA equally during mitosis to produce two genetically identical daughter cells [15,16]. Chromosomes, which enter mitosis as connected pairs of replicated sister chromatids, are sorted on a mitotic spindle composed of microtubules. The mitotic checkpoint delays separation of the sister chromatids until each sister chromatid pair has made proper attachments to the mitotic spindle. MAD1 functions in the mitotic checkpoint by recruiting its binding partner MAD2 from a large inactive soluble pool to the microtubule attachment sites of unattached chromatids (kinetochores) [17,18], where MAD2 undergoes a conformational change that allows it to inhibit the Anaphase Promoting Complex/Cyclosome (APC/C), an E3 ubiquitin ligase whose activity drives mitotic progression [15,16,19,20]. MAD1 overexpression weakens mitotic checkpoint signaling by binding MAD2 in the cytoplasm and reducing the number of free MAD2 molecules available for conversion into APC/C inhibitors at kinetochores [3,21]. Thus, increased MAD1 expression causes cells to enter anaphase before all sister chromatid pairs are properly attached to the mitotic spindle, resulting in CIN.

Though MAD1 was originally characterized for its role in mitosis, it is expressed throughout the cell cycle [3]. Overexpressed MAD1 localizes to PML (promyelocytic leukemia) nuclear bodies and destabilizes p53 [9]. p53 levels are normally low due to ubiquitination and degradation [22,23]. In response to cellular stress, PML sequesters the E3 ubiquitin ligase MDM2 into nucleoli, physically separating it from p53 and allowing p53 levels to accumulate [24]. Overexpressed MAD1 displaces MDM2 from PML, allowing MDM2 to continue ubiquitinating p53 [9].

Though MAD1 is commonly overexpressed in colorectal cancer and has potential tumor-promoting activities, it has remained unknown whether upregulation of MAD1 is sufficient to initiate tumorigenesis in immune-competent animals. Here, we describe the generation of a novel genetically engineered mouse model (GEMM) with doxycycline (dox)-inducible expression of endogenous Mad1l1. We show that modest MAD1 overexpression increased mitotic defects consistent with CIN, decreased p53, and sensitized immune-competent mice to colon tumors in the context of inflammation.

Results

MAD1L1 overexpression is common in colon cancer where it serves as a marker of poor prognosis

When compared to normal samples, the gene encoding MAD1, MAD1L1, is overexpressed in 25% of colon adenocarcinomas in The Cancer Genome Atlas (TCGA) PanCancer Atlas (Fig 1A). Reduced expression, mutation and amplification of MAD1L1 are rare (5.7%, 1.2% and 0.3%, respectively; Fig 1A) in colon cancer. Kaplan-Meier analysis of 1336 colon cancer patients (kmplot.com [25]) demonstrated that high expression of MAD1L1 associates with significantly worse prognosis as measured by relapse free survival (Fig 1B). Similarly, post-progression survival was worse in patients with tumors expressing high levels of MAD1L1 (Fig 1C) as compared to those with low levels. Thus, MAD1L1 overexpression commonly occurs in colon cancer and correlates with poor patient outcome.

Fig 1 — (A) Alterations in the gene encoding MAD1, *MAD1L1*, in 524 samples of normal versus colon adenocarcinoma from TCGA PanCancer Atlas (cancer study identifier: coadread_tcga_pan_can_atlas_2018). z threshold = 2.0. (B-C) Kaplan-Meier survival analysis (KMPlot [25]) showing high expression of *MAD1L1* mRNA is associated with worse relapse free survival in a cohort of 1336 patients (B) and post-progression survival in a cohort of 311 colon cancer patients (C). Q1 (lower quartile; “low”) vs Q4 (upper quartile; “high”) analysis is shown. HR = hazard ratio.

Generation of dox-inducible HA-MAD1 mice

To interrogate the functional consequences of MAD1 upregulation in vivo, we used CRISPR/Cas9 to create a novel GEMM. We introduced a tetracycline (tet)/dox-inducible promoter into the endogenous Mad1l1 locus, along with an N-terminal HA tag to facilitate detection of induced MAD1 (Figs 2A and A in S1 Text). Donor DNA used for homology directed repair, Cas9 protein, and two sgRNAs were injected into zygotes from C57BL/6J (B6) animals and transferred to a pseudopregnant female (Fig A in S1 Text). Next generation sequencing identified two founder mice with the precise edit and one with an additional 13 bp deletion in the intron following exon 2. Germline transmission from one mouse with the precise edit as well as the mouse with the 13 bp deletion occurred (Fig A in S1 Text). Mad1l1 is essential [26], and we were unable to generate homozygous TetO-HA-MAD1 mice, consistent with dox-regulated control of the edited allele (Table A in S1 Text). Mice heterozygous for the TetO-HA-MAD1 edit were bred with B6 mice expressing rtTA3 from the CAG promoter, a strong synthetic promoter, inserted into the Rosa26 locus (JAX 029627 [27,28]) for expression in multiple tissues. Dox feed resulted in increased MAD1 mRNA but not protein in TetO-HA-MAD1^KI/+;Rosa26-CAG-rtTA3^KI/+ tissues (Fig B in S1 Text). We tested whether mice homozygous for the Rosa26-CAG-rtTA3 knock in allele expressed higher levels of rtTA3, resulting in increased MAD1 protein. However, mice homozygous for this allele, which are born at less than expected frequency and are poor breeders, did not show evidence for increased expression of HA-MAD1 (Fig B panels E-F in S1 Text). We therefore tested Rosa26-rtTA-M2 mice (JAX 006965 [29]), which express an optimized version of the reverse tet transactivator from the Rosa26 promoter, and can be maintained as homozygous lines. Two rounds of mating of TetO-HA-MAD1^KI/+ with Rosa26-rtTA-M2 mice produced TetO-HA-MAD1^KI/+;rtTA-M2^KI/KI (hereafter HA-MAD1) animals (Fig 2B). HA-MAD1 expression was not detected in the absence of dox feed (Fig B panel H in S1 Text). In the presence of dox chow to induce expression in this Tet-On model (Fig 2C), these animals expressed HA-MAD1 protein in multiple tissues including spleen, colon, and skin (Fig 2D, upper band in MAD1 doublet), while control MAD1^+/+;rtTA-M2^KI/KI (hereafter control) animals did not. Quantitation revealed that the amount of MAD1 upregulation at the protein level was modest (~2 fold; Fig 2E), though the increase in mRNA expression was higher (Fig 2F). These data demonstrate successful generation of a novel GEMM which modestly overexpresses MAD1 in response to dox.

Fig 2 — (A) Schematic showing strategy for editing the endogenous mouse *Mad1l1* locus (top) and the donor DNA template used for homology directed repair (bottom). (B) Breeding scheme used to obtain mice with both the inducible *Mad1l1* allele and the rtTA-M2 reverse tetracycline transactivator protein. KI = Knock In. (C) Schematic shows dox-inducible Tet-ON expression of endogenous mouse *Mad1l1*. (D) Immunoblots show inducible expression of HA-MAD1 after 1 week of 6 mg/kg dox feed. Red arrows indicate HA-MAD1. (E) Quantification of MAD1 protein levels (mean +/- SE). Each dot represents tissue from a different animal. (F) qRT-PCR quantification of *Mad1l1* mRNA expression after 1 week of 6 mg/kg dox feed. * = p<0.05. Biorender was used to generate illustrations in 2B.

HA-MAD1 mice have increased mitotic defects and decreased p53

To determine whether 2-fold overexpression of MAD1 protein was sufficient to induce CIN and p53 degradation in colon, we supplied HA-MAD1 and control animals with dox feed ad libitum for 1 week and then harvested colon samples for immunofluorescence. The HA tag was readily apparent in the colonic epithelium of HA-MAD1, but not control mice, and showed the expected MAD1 localization pattern at the nucleus and nuclear envelope (Fig 3A). Total MAD1 levels were also increased and showed a similar localization (Fig 3B and 3C). We next tested whether p53 levels were decreased in the colon by HA-MAD1 expression. Immunoblotting with two different p53 antibodies revealed that subtle overexpression of MAD1 was sufficient to decrease p53 levels in the colon (Fig 3D and 3E). Quantitative immunofluorescence revealed that p53 expression was reduced in the colonic epithelium (Fig 3F and 3G).

Fig 3 — (A-B) Immunofluorescence of colonic epithelium showing expression of HA (A) and increased expression of MAD1 (B) in HA-MAD1 animals after 1 week of 6 mg/kg dox feed. (C) Quantification of MAD1 expression as in B. Colors indicate samples from different animals. Large circles show mean of cells from 5 fields of view from a single animal. (D) Immunoblot showing p53 protein expression is decreased in colon tissue from 5-month old HA-MAD1 mice after 1 week of 6 mg/kg dox feed as compared to control. Lanes 2 and 3 are from different mice of the same genotype. (E) Quantification (mean +/- SEM) of p53 protein levels, based on immunoblotting with the 1C12 antibody. (F) Immunofluorescence showing p53 is decreased in the colonic epithelium after HA-MAD1 expression. (G) Quantification of p53 expression as in F. Colors indicate individual animals. Large circles show mean from 5 fields of view from a single animal. (H-I) 1 week of 6 mg/kg dox feed is sufficient to induce mitotic defects indicative of CIN in colons of 10–27 week old HA-MAD1 mice. (H) Representative H&E images of normal anaphase and anaphase with evidence of chromosome missegregation in mouse colon. (I). Quantitation (mean +/- SEM) of anaphase defects as in H. n≥20 anaphase cells per mouse in each of 3 mice/genotype. * = p<0.05. ** = p<0.001.

We also tested whether ~2-fold overexpression of MAD1 protein was sufficient to reduce mitotic fidelity and induce mitotic defects consistent with a low rate of CIN in colon. Examination of H&E-stained colon sections revealed a substantial increase in abnormal mitotic figures. As expected in MAD1 overexpressing cells with a weakened mitotic checkpoint, HA-MAD1 mice had a significantly higher incidence of lagging chromosomes (that lag behind the segregating masses of DNA in anaphase and telophase) than control mice (Fig 3H and 3I). These data demonstrate that a modest increase in MAD1 expression in the colonic epithelium is sufficient to decrease p53 expression and increase mitotic defects that are consistent with CIN.

Modest upregulation of MAD1 sensitizes immune-competent mice to colon lesion formation in the context of inflammation

To test whether modest MAD1 upregulation initiates colon lesion formation, we used dextran sulfate sodium (DSS) to induce inflammation in the colon. DSS is commonly used to model colitis [30,31] and colon cancer when used in combination with mutagenic agents or predisposing genetic mutations [32]. We included p53+/- animals in our experiment as a positive control, since they are predisposed to develop tumors after DSS treatment [33,34].

Experimental cohorts of control, HA-MAD1, and p53+/- animals received 2% DSS in drinking water for 4 days followed by a rest period of water for 17 days (Fig 4A). This treatment regimen was considered one cycle and was repeated for a total of 3 cycles of DSS treatment. Control cohorts in each of the 3 genotypes were given water for the entire length of the experiment. All mice in the experiment received dox feed (Fig 4A). 2% DSS treatment was sufficient to cause inflammatory damage with modest effects on weight gain (Fig C in S1 Text), as 2 cycles of 2% DSS induced morphological changes resembling that of chronic colitis compared to the organized and consistent crypt architecture observed in water-treated control colons (Fig 4B).

Serial colonoscopies were performed on the first cohorts of animals to monitor for tumor development (Fig 4C). Tumor size was assessed based on the percentage of the lumen occluded by the lesion (Fig 4D). Subsequent cohorts received colonoscopies at month 10 after starting DSS treatment (Fig 4E). 5/16 (31%) of HA-MAD1 mice and 1/7 (14%) of p53+/- DSS-treated mice developed tumors (Fig 4F). No tumors formed in control mice treated with DSS or in any of the water treated controls (Fig 4F). Tumors in HA-MAD1 mice varied in size from occluding 7–34% of the lumen of the colon (Fig 4G). 4/7 (57%) male HA-MAD1 mice but only 1/9 (11%) of female HA-MAD1 animals developed tumors (Fig 4H). These data demonstrate that modest overexpression of MAD1 is sufficient to sensitize immune-competent animals to colon tumorigenesis in the context of inflammation.

Pathology of colon tumors

Lesions identified by colonoscopy were subjected to histological analysis by a board-certified pathologist. 2 hyperplastic polyps, 2 tubular adenomas with high grade dysplasia, and 1 mucinous adenocarcinoma were identified in HA-MAD1 mice (Fig 5 and Table 1). Two lesions were identified by colonoscopy in p53+/- mice; histological analysis revealed that one was a tubular adenoma whereas the other was a lymphoid aggregate (Table 1). Overall, DSS-treated HA-MAD1 colons showed a range of morphologies, from hyperplastic polyps to overt adenocarcinoma.

Fig 5 — Lesions in HA-MAD1 and p53+/- colons were excised, embedded in paraffin, sectioned, and stained with H&E, Ki-67, and β-catenin. Example images of normal colon, hyperplastic polyp, tubular adenoma, tubular adenoma with high grade dysplasia, and a mucinous adenocarcinoma are shown. Black insets in the 1^st column are enlarged in the 2^nd column. Red insets in the 2^nd column are enlarged in the Ki-67 and β-catenin columns. Serial sections were used for staining with H&E, Ki67 and β-catenin. Ki67 staining is confined to the base of the crypts in the no lesion control and the hyperplastic polyp. Ki67 positive cells are identified higher up in the crypts in the tubular adenoma. The tubular adenoma with high grade dysplasia loses crypt structure, but has positive Ki67 staining throughout. The adenocarcinoma had pockets of epithelial cells with positive Ki67 lining the large mucin pools. Arrows indicate cells with positive Ki-67 staininig. β-catenin staining was primarily found to be membranous and excluded from the nucleus in all samples with the exception of the tubular adenoma with high grade dysplasia, which contained β-catenin positive nuclei (arrowhead).

Table 1. Pathologically confirmed colon lesions.

Genotype	no lesion	hyperplastic polyp	tubular adenoma (TA)	TA with high grade dysplasia	mucinous adenocarcinoma
control (n = 16)	16	0	0	0	0
p53+/- (n = 7)	6	0	1	0	0
HA-MAD1 (n = 16)	11	2	0	2	1

Open in a new tab

Tumors were stained for Ki-67 to assess proliferation (Fig 5). In sections without lesions, Ki-67 staining is isolated to the base of the crypts where the stem cells are located (Fig 5, 3^rd column, 1^st row). The extent of Ki-67 staining correlated with the morphology of the lesion and potential risk for progression to carcinoma, with tubular adenoma samples with high grade dysplasia showing positive Ki-67 staining throughout (Fig 5, 3^rd column, 4^th row). The mucinous adenocarcinoma showed diffuse Ki-67 expression in the tumor epithelium lining the mucin pools.

β-catenin is typically present at adherens junctions and in the cytoplasm in normal colon (Fig 5, 4^th column, 1^st row), but translocates into the nucleus in response to activation of the Wnt signaling pathway, which is the most common initiating event in colorectal cancer [35]. Nuclear localization of β-catenin was observed in the tubular adenomas with high grade dysplasia (Fig 5, 4^th column, 4^th row), but not in the mucinous adenocarcinoma (Fig 5, 4^th column, 5^th row). Mucinous adenocarcinomas account for approximately 10% of colorectal cancers and are less likely to have aberrant Wnt signaling and β-catenin localization [36].

Additional tumors in HA-MAD1 mice

In addition to the distal colon, where DSS is expected to induce inflammation, we observed tumors in the small intestine and prostate of HA-MAD1 mice (Table B in S1 Text). Pathological analysis identified the small intestine tumor as a tubular adenoma (Fig D panel A in S1 Text). HA staining confirmed expression of HA-MAD1 in this tumor (Fig D panel B in S1 Text). Note that HA-MAD1 expression was also detectable in the small intestine of a 26-week old mouse after 1 week of dox feed (Fig D panel C in S1 Text). Both small intestine and prostate tumors were unexpected since the inflammatory effects of DSS are thought to be restrained to the distal colon [37,38]. Indeed, on colonoscopy we observed decreasing damage from DSS when moving proximally in the colon. Despite the lack of expected inflammatory effects outside the colon, we note that both the small intestine and prostate tumors in HA-MAD1 mice developed in DSS-treated animals. No tumors were observed in water or DSS-treated control animals (Table B in S1 Text). One DSS-treated p53+/- animal developed a splenic tumor and one water-treated p53+/- mouse developed a prostate tumor (Table B in S1 Text). These data suggest that modest upregulation of MAD1 may be sufficient for tumor promotion independent of localized inflammation in the tissue.

HA-MAD1 tumors and tissue display mitotic defects and decreased p53 expression

Colon tumors in HA-MAD1 mice continued to show modest overexpression of MAD1 relative to control animals after 10 months of dox feed (Fig 6A and 6B). DSS treatment had minimal impact on mitotic defects consistent with CIN in control, p53+/-, or HA-MAD1 colon (Fig 6C and 6D). Interestingly, HA-MAD1 tumors showed similar rates of mitotic defects as observed in normal colon from age-matched 12-month-old HA-MAD1 mice. All HA-MAD1 colon tissue showed significantly higher rates of abnormal mitotic figures than age-matched control colon (~60% versus ~10%, Fig 6C and 6D). The rate of mitotic defects in 12-month-old HA-MAD1 mice was also substantially higher than the ~30% of cells with mitotic defects in younger HA-MAD1 mice (Fig 3I), consistent with the previously reported increase in CIN that occurs with age [39,40].

p53 expression was reduced by approximately half in HA-MAD1 tumors and adjacent normal tissue as compared to water-treated controls, similar to the level of expression in p53+/- animals (Fig 6E and 6F). This level of reduction was also similar to the level in younger HA-MAD1 animals (Fig 3G). Together, these data demonstrate that subtly increased expression of MAD1 increases mitotic defects consistent with CIN, decreases p53 expression, and sensitizes to tumorigenesis in animals with an intact immune system.

Discussion

In this study, we developed a novel GEMM to test whether modest overexpression of MAD1, which is commonly observed in colon cancer, is sufficient for colon tumorigenesis. As predicted from studies in cellular models, we show that mice with modest (~2-fold) overexpression of MAD1 have an increase in mitotic defects that contribute to CIN and decreased p53 protein expression. Moreover, modest MAD1 upregulation sensitized immune-competent mice to colon tumor formation in the context of inflammation.

In humans, inflammation is a risk factor associated with a higher incidence of colon cancer in males than females [41]. Consistent with this, colon tumor formation was particularly pronounced in male HA-MAD1 mice. While 4/7 (57%) of male HA-MAD1 mice formed colon tumors, only 1/9 (11%) of female animals did. DSS treatment has previously been noted to cause more substantial damage, such as decreased colon length, greater weight loss, and more severe changes in stool consistency, in male animals [38,42]. In our cohort, DSS reduced weight gain specifically in male mice, though this difference was driven largely by the final timepoint. Previous studies have demonstrated that estrogen is protective against DSS-induced damage, and 17-β-estradiol treatment rescued phenotypes in male mice back to control levels [42]. Thus, the increased incidence of tumors in male mice in our model recapitulates the sex specific difference observed in human.

MAD1 upregulation increased mitotic defects consistent with CIN and decreased p53 expression, which are both associated with tumor promotion. Increased expression of MAD1 has previously been shown to induce CIN by weakening the mitotic checkpoint [3,21]. Excess MAD1 binds MAD2 in the cytoplasm, thereby reducing the pool of free MAD2 that is converted into active inhibitors of the APC/C. MAD1 upregulation destabilizes p53 by displacing MDM2 from PML, allowing MDM2 to ubiquitinate p53 [9]. HA-MAD1 mice had increased tumor incidence relative to p53+/- animals, though this difference did not reach statistical significance, suggesting that MAD1 overexpression may confer tumor promoting activity beyond destabilization of p53. This activity could be due to the increase in mitotic defects, which have been implicated in tumor promotion [5,6]. However, the affect of CIN on tumors is complex, and CIN can also be tumor suppressive, either through induction of cell death [43–45] or activation of the immune system [7,8]. α5 integrin expression is commonly upregulated in primary tumors, and binding of α5β1 integrin to its ligand fibronectin promotes transformation and tumor cell survival [46,47]. Thus, additional tumor promoting activity from MAD1 upregulation could occur due to increased secretion of α5 integrin [48,49], or from as yet undiscovered roles of MAD1. One important area of future research will be in parsing the relative contributions of the specific functions of MAD1 responsible for tumor promotion.

It is interesting to note that we also observed tumors developing in the small intestine and prostate of HA-MAD1 mice. DSS has not been reported to induce inflammation in these tissues [38,42], suggesting these tumors are independent of inflammation. Small intestine and prostate may be particularly susceptible to the tumor promoting activities of MAD1 upregulation. However, we cannot exclude the possibility that DSS treatment caused a low level of inflammation in these tissues, and tumors outside the colon only arose in HA-MAD1 animals treated with DSS. Future studies are therefore necessary to determine if fully spontaneous tumors form in these mice in the absence of exogenously induced inflammation.

Overall, this work reports a novel GEMM with inducible, modest overexpression of MAD1. MAD1 upregulation confers tumor-promoting phenotypes and is sufficient for colon tumor formation in the context of inflammation in the presence of an intact immune system. These data implicate MAD1 as a novel prognostic marker and potential therapeutic target in colon cancer.

Materials and methods

Ethics statement

This study was conducted under approved protocols by the Institutional Animal Care and Use Committee of University of Wisconsin-Madison in compliance with policies established by the Office of Laboratory Animal Welfare at the National Institutes of Health (Protocols: M005342, M005601). All animal studies were performed in compliance with all relevant ethical regulations for animal testing and research. All animals were housed in a specific pathogen-free facility with water and standard chow diet ad libitum, unless noted. Mouse stocks were maintained on Teklad Global 2020X Rodent Diet (Inotiv, Lafayette, IN) prior to doxycycline feed, as described in the “Dextran Sodium Sulfate (DSS) Treatment” methods section.

Generation of Mad1l1 GEMM

Gene edited mice were generated by the University of Wisconsin Genome Editing and Animal Models (GEAM) core facility. One-cell C57BL/6J fertilized embryos were microinjected with a mixture of 25 ng/μL each of sgRNA (2 total), 40 ng/μL Cas9 protein (PNA Bio, Newbury Park, California) and 216 ng/uL donor plasmid. sgRNA sequences were: 5’-CCTGATCGTTTACTCCATAA-3’ and 5’-CCATCACAAGGATCCCTATA-3’. Injected embryos were transplanted into pseudopregnant B6D2 F1 females. Pups were sequenced at weaning to screen for editing. HA-MAD1 founders were crossed with C57BL/6J mates and offspring sequenced to test for germline transmission. Sequence-confirmed HA-MAD1 F1 mice were crossed with strain B6.Cg Rosa26-CAG-rtTA3 knock-in (Jackson Laboratory strain #029627) and strain B6.Cg R26-rtTA-M2 knock-in (Jackson Laboratory strain #006965) mice. Heterozygous HA-MAD1 animals were maintained by backcrossing with C57BL/6J mice.

Genotyping

Ear punch DNA was isolated using QuickExtract DNA Extraction Solution (LGC Biosearch Technologies) according to the manufacturer’s protocol. The following primers were used for genotyping TetO-HA-MAD1 knock-in animals: mMAD1-GT-KI-201bp-F, 5’–GATGTTCCAGATTACGCTTACCCATAC– 3’; mMAD1-WT-285bp-F, 5’–GGCAGTATTGGCTTCATGTTAATGTTG– 3’; mMAD1-WT-285bp-R, 5’–CATGTGATACTCATACTGCTTCTGTAGG– 3’. All 3 primers were included in a single reaction with GoTaq DNA Polymerase (Promega) according to the manufacturer’s protocol with an annealing temperature of 55°C for 35 cycles. Rosa26-CAG-rtTA3 knock-in mice were genotyped according to The Jackson Laboratory protocol #20245. R26-rtTA-M2 knock-in mice were genotyped according to The Jackson Laboratory protocol #29915. B6.129S2-Trp53tm1Tyj/J (Jax #002101) were genotyped according to The Jackson Laboratory protocol #27521.

qRT-PCR

Tissue (50–100 mg) was lysed with the BeadBug microtube homogenizer (Benchmark Scientific). RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. RNA was reverse transcribed with iScript (Bio-Rad) according to the manufacturer’s protocol and the cDNA was then used for real-time PCR analysis using IQ SYBR Green Supermix (Bio-Rad) with an annealing temperature of 60°C. Primers spanning exon-exon junctions were used to detect spliced mRNA. Expression levels were calculated using the relative quantification method (ΔΔCt). Each sample was run in triplicate and GAPDH was used as a housekeeping gene. Primers are as follows: mMad1 Forward, 5’-AGCTTGGGGTTCAGAAGC-3’; mMad1 Reverse, 5’-TCACCCTCCAGCTCCTCC-3’; mGAPDH Forward, 5’-CTCCCACTCTTCCACCTTCG-3’; mGAPDH Reverse, 5’-GCCTCTCTTGCTCAGTGTCC-3’.

Immunoblotting

Tissue (20–50 mg) was lysed in 500 mL RIPA buffer (150 mM NaCl, 25 mM Tris, 1% NP40, 1% deoxycholic acid sodium salt, pH 7.0–7.4) supplemented with protease inhibitor (cOmplete Protease Inhibitor Cocktail, Roche) using the BeadBug microtube homogenizer (Benchmark Scientific). Proteins were separated by 12% SDS-PAGE, transferred to nitrocellulose membrane, blocked with 5% milk in TBST for 1 hour at room temperature. Primary antibodies were diluted in 2% BSA + 0.02% sodium azide in PBS and incubated overnight at 4°C. Secondary antibodies were diluted in 5% milk in TBST and incubated for 45 minutes at room temperature. Membranes were imaged on the LI-COR Odyssey imager and analyzed using LI-COR Image Studio. Primary antibody dilutions: MAD1 (affinity purified rabbit anti-MAD1 against amino acids 333–617 [3]), 1:3000; HA (16B12, BioLegend), 1:1000; alpha-tubulin (12G10, Developmental Studies Hybridoma Bank) 1:5000. Secondary antibodies were diluted 1:10,000 (IRDye, LI-COR).

Tissue Immunostaining

p53 and MAD1: Paraffin-embeded sections of 5 μm thickness were dewaxed by incubation in xylene (3 x 5 minutes) and rehydrated by ethanol series: 100% (2 x 2 minutes), 95% (2 minutes), 80% (2 minutes), 70% (2 minutes), 50% (2 minutes), and water (5 minutes). Antigen retrieval was performed using Decloaking Chamber NxGen (BioCare Medical) for 15 minutes at 110°C in citrate buffer pH 6.0 (10 mM citric acid, 0.05% Tween-20) for MAD1 and p53 antibodies and in Tris-EDTA buffer pH 9.0 (10 mM Tris, 1 mM EDTA, 0.05% Tween-20) for the HA antibody. Samples were allowed to cool to room temperature for 30 minutes, rinsed in PBS, and blocked in 10% goat serum in PBS for 1 hour at room temperature. Primary antibodies were diluted in PBS with 1% goat serum and 0.01% Triton X-100 and incubated on tissues overnight at 4°C. Tissues were washed in PBS (3 x 5 minutes) followed by incubation with secondary antibody diluted in PBS for 30 minutes at room temperature. Tissues were washed in PBS (3 x 5 minutes) and then mounted using vectashield antifade mounting medium with DAPI (Vector Laboratories, H-1200). Primary antibody dilutions: MAD1 (affinity purified rabbit anti-MAD1 against amino acids 333–617 [3]), 1:1600; p53 (ab131442, Abcam), 1:100; HA (C29F4, Cell Signaling), 1:400. Secondary antibodies were diluted 1:500 (Goat anti-Rabbit Alexa Fluor 594, ThermoFisher A-11037). Z-stack images were acquired using a Nikon Ti-E inverted microscope with a CoolSNAP HQ2 camera using a 60x 1.4 NA objective with 0.3 μm steps. Nikon Elements software was used to process and analyze the images. Max intensity projections are shown. Sections for quantification were stained contemporaneously. Quantification was performed on images collected comtemporaneously using identical exposure times. Mean fluorescent intensity of MAD1 or p53 was quantified in nuclei of 5 cells in 5 fields per sample (25 cells/sample) using DAPI to create nuclear ROIs.

Ki67 and β-catenin: Slides were heated for 5 minutes at 65°C, deparaffinized in xylenes for (2) 10 minute incubations and rehydrated using a series of ethanol dilutions (100%, 95%, 80%, 70%, 50%). Washes, blocks and primary antibody dilutions were performed with 1x PBS + 0.5% Tween 20 (1x PBST) for Ki67 stains or 1x Tris Buffered Saline + 0.5% Tween 20 (1x TBST) for β-catenin. Antigen retrieval was performed by boiling samples for 30 minutes in citrate buffer (pH 6.0) for Ki67 or 30 minutes in Tris-EDTA buffer (pH 9.0) for β-catenin. Peroxidase activity was blocked for 5 minutes at room temperature with BLOXALL (SP-6000-100, VectorLab). 5% normal goat serum (S1000-20, Vector Labs) in 5% skim milk in the appropriate salt buffer listed above for each antibody was used to block for 1 hour at room temperature and to dilute primary antibodies for anti-β-catenin (1:200, CloneD10A8, #8480S, Cell Signaling Technology) and anti-Ki67 (1:400, Clone D3B5, #12202T, Cell Signaling Technology). Primary antibodies were incubated overnight at 4°C in a humid chamber. Anti-rabbit HRP secondary antibody (RHRP520L, BioCare) was incubated for 30 minutes at room temperature. Slides were developed with diaminobenzidine (DAB; #11725S Cell Signaling Technology) prepared per the manufacturer’s protocol and incubated for 45 seconds for Ki67 and 4 minutes for β-catenin. Counterstaining was conducted with CAT hematoxylin (CATHE-M, BioCare) for 30 seconds. Slides were dehydrated in the ethanol series previously described, incubated in xylenes for 10 minutes and cover slipped with permount. Slides were imaged using the Aperio AT2 digital RBG slide scanner at 40x.

Dextran sulfate sodium (DSS) treatment

Mice between 8–11 weeks of age started on dox feed approximately one week before starting DSS or water treatment (Rodent Diet 2018, 6000 mg/kg Doxycycline; TD.01533) to ensure MAD1 overexpression. Mice were then randomly assigned to either DSS or water treatment. DSS (MW ca 40,000; Thermo Scientific Chemicals catalog number AAJ6360622, lot# Y08H016) was used to induce inflammation in colon. Each DSS cycle consisted of ad libitum 2% DSS dissolved in water for 4 days, followed by 17 days of regular water. After this first cycle, two additional cycles of DSS treatment were given for a total of three DSS cycles. Mice in the water group only received water and were handled on the same days as the DSS treatment mice. All mice in both treatment groups were weighed at the start and end of each 4 day period to monitor for weight loss and examined at least once daily to identify signs of distress (i.e. hunched posture, bloating, pallor, etc.). All mice were euthanized when moribund or 10 months after the start of the first treatment cycle.

Colonoscopy tumor surveillance

The first two cohorts of mice received serial colonoscopies at 7, 9, and 10 months after beginning DSS to observe tumor formation in the distal colon and to determine the appropriate endpoint. All other cohorts received colonoscopies at the 10 month time point. The Karl Storz Coloview system was used as previously described [50]. In brief, mice were weighed to assess for weight loss, anesthetized with 2% isoflurane and the distal colon was gently cleared of fecal pellets by 1x PBS enemas. A compressed air pump on the operating sheath insufflated the colon, and the colonoscope was inserted approximately 4 cm into the distal colon to carefully examine the epithelial lining with bright light. Digital video and still images of the mucosa were recorded as the colonoscope was slowly withdrawn. Mice were monitored post-procedurally and allowed to recover from anesthesia without complication. Still images of tumors were analyzed for the percentage of colon occluded by the tumor using Image J.

Histopathological analysis

Pathological diagnosis of each colon tumor was determined by a board-certified pathologist (K.A.M.) blinded to treatment regimens using an Olympus BX43 microscope. Slides were imaged using the Aperio AT2 digital RBG slide scanner at 40x.

Statistical analysis

Statistal analysis was performed using GraphPad Prism (Version 10.2.3). Significance was assed using an unpaired Student’s t test, unless otherwise noted. Superplot statistical analysis was run on means (large dots) rather than individual values (small dots) in Fig 3C and 3G. Two-tailed chi-square test was used for Fig 4F and 4H, and Table A in S1 Text. Sen-Adichie test for parallelism was used in Fig C in S1 Text and was performed using MSTAT (https://oncology.wisc.edu/mstat/).

Supporting information

S1 Text. Supporting Figures and Tables. Fig A. Generation and validation of dox-inducible HA-MAD1 mice.

(A) Schematic showing targeting strategy for editing MAD1 (encoded by the Mad1l1 gene, left) and edited allele (right). Two gRNAs were used to cut on either side of exon 2, the first coding exon of mouse Mad1l1. The edited allele of Mad1l1 includes a TRE3G promoter and an HA tag after the first ATG, which is in exon 2. (B) Schematic of method used to generate dox inducible HA-MAD1 mice. Cas9, 2 sgRNAs, and donor DNA were injected into C57BL/6 zygotes, which were then transferred to a pseudopregnant mouse. Three founder mice had the intended edit, though 1 founder had an additional 13 base-pair deletion in the intronic region after exon 2. Founder mice were bred with a C56BL/6 mouse and the resulting F1 mice were genotyped to ensure germline transmission of the edit. The schematic was generated in Biorender. (C) Genotyping strategy with three primers used to screen for edited mice. (D) Agarose gel showing successful editing in founder mice. KI = Knock In. The founder with a 13-base pair indel is indicated by KI*. NC = No DNA control. (E) Agarose gel showing germline transmission of the edited alleles in the F1 generation. Fig B. CAG-rtTA3 results in dox-inducible expression of HA-MAD1 RNA. (A) Breeding strategy to produce mice that are doubly heterozygous for HA-MAD1 and CAG-rtTA3 (Jax strain #029627). Doubly heterozygous HA-MAD1^KI/+;CAG-rtTA3^KI/+ animals were used in B-G. Doubly heterozygous mice were bred with animals heterozygous for CAG-rtTA3 to produce HA-MAD1^KI/+;CAG-rtTA3^KI/KI animals in E-F. Biorender was used to generate the schematic. (B) qRT-PCR of Mad1l1 mRNA showing substantial increase in Mad1l1 mRNA expression (spliced transcripts) in spleen and fat after 1 week of 625 mg/kg dox feed. (C-D) MAD1 protein expression in mice after 1 week on 625 mg/kg dox feed. Red arrows in immunoblot (C) indicate HA-MAD1. (D) Quantification of MAD1 protein level as assessed by immunoblot. (E-F) Immunoblot (E) and quantitation (F) showing that mice homozygous for CAG-rtTA3 do not exhibit increased expression of dox-inducible HA-MAD1 relative to mice heterozygous for CAG-rtTA3. (G) Use of dox feed for 1 week and 1 month result in similar levels of MAD1 expression in spleen tissues isolated from HA-MAD1^KI/+;rtTA-M2^KI/+ mice. (H) Immunoblot showing expression of HA and MAD1 in control or HA-MAD1 colon with or without dox feed. HA-MAD1 is not expressed in the absence of dox feed. Fig C. Effects of DSS treatment on weight. Mice weight as a percentage of starting weight on day 0 +/- SEM. DSS treatment occurred on days 0–4, 21–25, and 42–46. Mice were weighed at the beginning and end of each cycle. (A) Female mice have similar weight gain in water or DSS treatment groups. (B) DSS treatment impaired weight gain in male mice. (C-D) Data from A-B separated by sex rather than treatment group. ns = not significant; * = p < 0.05. Fig D. HA-MAD1 expression in small intestine. (A) H&E images of normal small intestine and tubular adenoma in HA-MAD1 mouse. Normal indicates normal adjacent tissue. (B) Immunofluorescence showing expression of HA-MAD1 in small intestine tubular adenoma. (C) Dox-inducible expression of HA-MAD1 in small intestine. Tissue for immunoblot was collected after 1 week of dox feed (without DSS treatment). MAD1 upper band (red arrow) corresponds with HA band. Table A. Homozygous HA-MAD1 mice are embryonic lethal in the absence of dox. Table B. Potentially inflammation-independent tumors 10 months after cohorts initiated DSS treatment.

(PDF)

pgen.1011437.s001.pdf^{(1.7MB, pdf)}

S1 Data. Excel file containing source data for Figs 1–4, 6, B and C in S1 Text.

(XLSX)

pgen.1011437.s002.xlsx^{(37.7KB, xlsx)}

Acknowledgments

We thank Kathy Krentz and Dr. C. Dustin Rubinstein in the UW Genome Editing and Animal Models Core Facility (GEAM) for generating HA-MAD1 mice, Conrad Blosch in the Biomedical Research Model Services (BRMS) Rodent Breeding Core and Research Services Core for assistance with mouse colony management, Magdaline Baus for her assistance with DSS treatments, Toshi Kinoshita in the Translational Research Initiatives in Pathology (TRIP) lab for histology services, and members of the Weaver, Halberg, Burkard, Suzuki, and Cosper laboratories for insightful discussions. The authors thank the UWCCC Shared Resources GEAM and University of Wisconsin Translational Research Initiatives in Pathology (TRIP), supported by in part by UWCCC (P30 CA014520), for use of their facilities and services.

Data Availability

The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files.

Funding Statement

 This work was supported, in part, by National Institutes of Health (grant R01CA270133 to BAW), the University of Wisconsin UW2020 award for Advancing CRISPR-mediated Genome Editing Technology at UW-Madison to Model Human Disease, and Wisconsin Dual Sports Riders (to SMS and RBH). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Society AC. Cancer Facts and Figures. American Cancer Society: Atlanta, 2024. [Google Scholar]
2.Cosper PF, Copeland SE, Tucker JB, Weaver BA. Chromosome Missegregation as a Modulator of Radiation Sensitivity. Semin Radiat Oncol 2022; 32: 54–63. doi: 10.1016/j.semradonc.2021.09.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Ryan SD, Britigan EM, Zasadil LM, Witte K, Audhya A, Roopra A et al. Up-regulation of the mitotic checkpoint component Mad1 causes chromosomal instability and resistance to microtubule poisons. Proc Natl Acad Sci U S A 2012; 109: E2205–2214. doi: 10.1073/pnas.1201911109 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Grant GD, Brooks L, Zhang X, Mahoney JM, Martyanov V, Wood TA et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell 2013; 24: 3634–3650. doi: 10.1091/mbc.E13-05-0264 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Zasadil LM, Britigan EM, Weaver BA. 2n or not 2n: Aneuploidy, polyploidy and chromosomal instability in primary and tumor cells. Semin Cell Dev Biol 2013; 24: 370–379. doi: 10.1016/j.semcdb.2013.02.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Vasudevan A, Schukken KM, Sausville EL, Girish V, Adebambo OA, Sheltzer JM. Aneuploidy as a promoter and suppressor of malignant growth. Nat Rev Cancer 2021; 21: 89–103. doi: 10.1038/s41568-020-00321-1 [DOI] [PubMed] [Google Scholar]
7.Santaguida S, Richardson A, Iyer DR, M’Saad O, Zasadil L, Knouse KA et al. Chromosome Mis-segregation Generates Cell-Cycle-Arrested Cells with Complex Karyotypes that Are Eliminated by the Immune System. Dev Cell 2017; 41: 638–651.e635. doi: 10.1016/j.devcel.2017.05.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Wang RW, Viganò S, Ben-David U, Amon A, Santaguida S. Aneuploid senescent cells activate NF-κB to promote their immune clearance by NK cells. EMBO Rep 2021; 22: e52032. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Wan J, Block S, Scribano CM, Thiry R, Esbona K, Audhya A et al. Mad1 destabilizes p53 by preventing PML from sequestering MDM2. Nat Commun 2019; 10: 1540. doi: 10.1038/s41467-019-09471-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Li R, Murray AW. Feedback control of mitosis in budding yeast. Cell 1991; 66: 519–531. doi: 10.1016/0092-8674(81)90015-5 [DOI] [PubMed] [Google Scholar]
11.Chen RH, Shevchenko A, Mann M, Murray AW. Spindle checkpoint protein Xmad1 recruits Xmad2 to unattached kinetochores. J Cell Biol 1998; 143: 283–295. doi: 10.1083/jcb.143.2.283 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Hardwick KG, Murray AW. Mad1p, a phosphoprotein component of the spindle assembly checkpoint in budding yeast. J Cell Biol 1995; 131: 709–720. doi: 10.1083/jcb.131.3.709 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Kitagawa R, Rose AM. Components of the spindle-assembly checkpoint are essential in Caenorhabditis elegans. Nat Cell Biol 1999; 1: 514–521. doi: 10.1038/70309 [DOI] [PubMed] [Google Scholar]
14.Seeley TW, Wang L, Zhen JY. Phosphorylation of human MAD1 by the BUB1 kinase in vitro. Biochem Biophys Res Commun 1999; 257: 589–595. doi: 10.1006/bbrc.1999.0514 [DOI] [PubMed] [Google Scholar]
15.Musacchio A, Salmon ED. The spindle-assembly checkpoint in space and time. Nat Rev Mol Cell Biol 2007; 8: 379–393. [DOI] [PubMed] [Google Scholar]
16.Cleveland DW, Mao Y, Sullivan KF. Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell 2003; 112: 407–421. doi: 10.1016/s0092-8674(03)00115-6 [DOI] [PubMed] [Google Scholar]
17.Jackman M, Marcozzi C, Barbiero M, Pardo M, Yu L, Tyson AL et al. Cyclin B1-Cdk1 facilitates MAD1 release from the nuclear pore to ensure a robust spindle checkpoint. J Cell Biol 2020; 219. doi: 10.1083/jcb.201907082 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Allan LA, Camacho Reis M, Ciossani G, Huis In ’t Veld PJ, Wohlgemuth S, Kops GJ et al. Cyclin B1 scaffolds MAD1 at the kinetochore corona to activate the mitotic checkpoint. EMBO J 2020; 39: e103180. doi: 10.15252/embj.2019103180 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Collin P, Nashchekina O, Walker R, Pines J. The spindle assembly checkpoint works like a rheostat rather than a toggle switch. Nat Cell Biol 2013; 15: 1378–1385. doi: 10.1038/ncb2855 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Lara-Gonzalez P, Pines J, Desai A. Spindle assembly checkpoint activation and silencing at kinetochores. Semin Cell Dev Biol 2021; 117: 86–98. doi: 10.1016/j.semcdb.2021.06.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Chung E, Chen RH. Spindle checkpoint requires Mad1-bound and Mad1-free Mad2. Mol Biol Cell 2002; 13: 1501–1511. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Levine AJ. p53: 800 million years of evolution and 40 years of discovery. Nat Rev Cancer 2020; 20: 471–480. doi: 10.1038/s41568-020-0262-1 [DOI] [PubMed] [Google Scholar]
23.Kubbutat MH, Jones SN, Vousden KH. Regulation of p53 stability by Mdm2. Nature 1997; 387: 299–303. doi: 10.1038/387299a0 [DOI] [PubMed] [Google Scholar]
24.Bernardi R, Scaglioni PP, Bergmann S, Horn HF, Vousden KH, Pandolfi PP. PML regulates p53 stability by sequestering Mdm2 to the nucleolus. Nat Cell Biol 2004; 6: 665–672. doi: 10.1038/ncb1147 [DOI] [PubMed] [Google Scholar]
25.Győrffy B. Survival analysis across the entire transcriptome identifies biomarkers with the highest prognostic power in breast cancer. Comput Struct Biotechnol J 2021; 19: 4101–4109. doi: 10.1016/j.csbj.2021.07.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Iwanaga Y, Chi YH, Miyazato A, Sheleg S, Haller K, Peloponese JM, Jr. et al. Heterozygous deletion of mitotic arrest-deficient protein 1 (MAD1) increases the incidence of tumors in mice. Cancer Res 2007; 67: 160–166. doi: 10.1158/0008-5472.CAN-06-3326 [DOI] [PubMed] [Google Scholar]
27.Dow LE, Nasr Z, Saborowski M, Ebbesen SH, Manchado E, Tasdemir N et al. Conditional reverse tet-transactivator mouse strains for the efficient induction of TRE-regulated transgenes in mice. PLoS One 2014; 9: e95236. doi: 10.1371/journal.pone.0095236 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Dow LE, O’Rourke KP, Simon J, Tschaharganeh DF, van Es JH, Clevers H et al. Apc Restoration Promotes Cellular Differentiation and Reestablishes Crypt Homeostasis in Colorectal Cancer. Cell 2015; 161: 1539–1552. doi: 10.1016/j.cell.2015.05.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Hochedlinger K, Yamada Y, Beard C, Jaenisch R. Ectopic expression of Oct-4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues. Cell 2005; 121: 465–477. doi: 10.1016/j.cell.2005.02.018 [DOI] [PubMed] [Google Scholar]
30.Cooper HS, Murthy S, Kido K, Yoshitake H, Flanigan A. Dysplasia and cancer in the dextran sulfate sodium mouse colitis model. Relevance to colitis-associated neoplasia in the human: a study of histopathology, B-catenin and p53 expression and the role of inflammation. Carcinogenesis 2000; 21: 757–768. doi: 10.1093/carcin/21.4.757 [DOI] [PubMed] [Google Scholar]
31.Okayasu I, Yamada M, Mikami T, Yoshida T, Kanno J, Ohkusa T. Dysplasia and carcinoma development in a repeated dextran sulfate sodium-induced colitis model. J Gastroenterol Hepatol 2002; 17: 1078–1083. [DOI] [PubMed] [Google Scholar]
32.Tanaka T, Kohno H, Suzuki R, Yamada Y, Sugie S, Mori H. A novel inflammation-related mouse colon carcinogenesis model induced by azoxymethane and dextran sodium sulfate. Cancer Sci 2003; 94: 965–973. doi: 10.1111/j.1349-7006.2003.tb01386.x [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Fujii S, Fujimori T, Kawamata H, Takeda J, Kitajima K, Omotehara F et al. Development of colonic neoplasia in p53 deficient mice with experimental colitis induced by dextran sulphate sodium. Gut 2004; 53: 710–716. doi: 10.1136/gut.2003.028779 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Chang WC, Coudry RA, Clapper ML, Zhang X, Williams KL, Spittle CS et al. Loss of p53 enhances the induction of colitis-associated neoplasia by dextran sulfate sodium. Carcinogenesis 2007; 28: 2375–2381. doi: 10.1093/carcin/bgm134 [DOI] [PubMed] [Google Scholar]
35.White BD, Chien AJ, Dawson DW. Dysregulation of Wnt/β-catenin signaling in gastrointestinal cancers. Gastroenterology 2012; 142: 219–232. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Pai P, Rachagani S, Dhawan P, Batra SK. Mucins and Wnt/β-catenin signaling in gastrointestinal cancers: an unholy nexus. Carcinogenesis 2016; 37: 223–232. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Kitajima S, Takuma S, Morimoto M. Histological analysis of murine colitis induced by dextran sulfate sodium of different molecular weights. Exp Anim 2000; 49: 9–15. [DOI] [PubMed] [Google Scholar]
38.Chassaing B, Aitken JD, Malleshappa M, Vijay-Kumar M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr Protoc Immunol 2014; 104: 15.25.11–15.25.14. doi: 10.1002/0471142735.im1525s104 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Baker DJ, Jeganathan KB, Cameron JD, Thompson M, Juneja S, Kopecka A et al. BubR1 insufficiency causes early onset of aging-associated phenotypes and infertility in mice. Nat Genet 2004; 36: 744–749. doi: 10.1038/ng1382 [DOI] [PubMed] [Google Scholar]
40.Macedo JC, Vaz S, Bakker B, Ribeiro R, Bakker PL, Escandell JM et al. FoxM1 repression during human aging leads to mitotic decline and aneuploidy-driven full senescence. Nat Commun 2018; 9: 2834. doi: 10.1038/s41467-018-05258-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Söderlund S, Granath F, Broström O, Karlén P, Löfberg R, Ekbom A et al. Inflammatory bowel disease confers a lower risk of colorectal cancer to females than to males. Gastroenterology 2010; 138: 1697–1703. [DOI] [PubMed] [Google Scholar]
42.Bábíčková J, Tóthová Ľ, Lengyelová E, Bartoňová A, Hodosy J, Gardlík R et al. Sex Differences in Experimentally Induced Colitis in Mice: a Role for Estrogens. Inflammation 2015; 38: 1996–2006. doi: 10.1007/s10753-015-0180-7 [DOI] [PubMed] [Google Scholar]
43.Kops GJ, Foltz DR, Cleveland DW. Lethality to human cancer cells through massive chromosome loss by inhibition of the mitotic checkpoint. Proc Natl Acad Sci U S A 2004; 101: 8699–8704. doi: 10.1073/pnas.0401142101 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Funk LC, Wan J, Ryan SD, Kaur C, Sullivan R, Roopra A et al. p53 Is Not Required for High CIN to Induce Tumor Suppression. Mol Cancer Res 2021; 19: 112–123. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Zhou AS, Tucker JB, Scribano CM, Lynch AR, Carlsen CL, Pop-Vicas ST et al. Diverse microtubule-targeted anticancer agents kill cells by inducing chromosome missegregation on multipolar spindles. PLoS Biol 2023; 21: e3002339. doi: 10.1371/journal.pbio.3002339 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Miroshnikova YA, Rozenberg GI, Cassereau L, Pickup M, Mouw JK, Ou G et al. α5β1-Integrin promotes tension-dependent mammary epithelial cell invasion by engaging the fibronectin synergy site. Mol Biol Cell 2017; 28: 2958–2977. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Yu M, Chu S, Fei B, Fang X, Liu Z. O-GlcNAcylation of ITGA5 facilitates the occurrence and development of colorectal cancer. Exp Cell Res 2019; 382: 111464. doi: 10.1016/j.yexcr.2019.06.009 [DOI] [PubMed] [Google Scholar]
48.Wan J, Weaver BA. Mad1 at the Golgi apparatus: a story beyond kinetochores. Cell Cycle 2015; 14: 1763–1764. doi: 10.1080/15384101.2015.1032639 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Wan J, Zhu F, Zasadil LM, Yu J, Wang L, Johnson A et al. A Golgi-localized pool of the mitotic checkpoint component Mad1 controls integrin secretion and cell migration. Curr Biol 2014; 24: 2687–2692. doi: 10.1016/j.cub.2014.09.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Becker C, Fantini MC, Neurath MF. High resolution colonoscopy in live mice. Nat Protoc 2006; 1: 2900–2904. doi: 10.1038/nprot.2006.446 [DOI] [PubMed] [Google Scholar]

PLoS Genet. doi: 10.1371/journal.pgen.1011437.r001

Decision Letter 0

David J Kwiatkowski, Ajit P Joglekar

22 Jul 2024

Dear Dr Weaver,

Thank you very much for submitting your Research Article entitled 'MAD1 upregulation sensitizes to inflammation-mediated tumor formation' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. All three reviewers found your work to be well-conceived and executed; they agree that it presents impactful findings of broad interest. Their comments indicate that the manuscript needs only minor revisions. Some edits are needed to ensure that the discussion better aligns with the data (see reviewer #3). Reviewers #1 and 2 suggests some modifications to the figures so that they are more accessible to cell biologists and cancer biologists.

We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, log into your Editorial Manager account and select the option 'Revise Submission' in the 'Submissions Needing Revision' folder.

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Ajit P. Joglekar, Ph.D.

Guest Editor

PLOS Genetics

David Kwiatkowski

Section Editor

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: In the current manuscript the authors develop a novel mouse model that has modest overexpression of the important spindle assembly checkpoint protein Mad1. Previous studies have shown that Mad1 is overexpressed in multiple tumor types and there is some evidence that it can induce chromosome mis-segregation as well as destabilize p53, two events that are pro-tumorigenic. In the present study, the authors use CRISPR genome editing to introduce a doxycycline inducible promotor and HA tag into the endogenous Mad1l1 gene locus in mice, such they were able to induce expression by feeding the mice doxycycline. This resulted in ~ 2-fold increase in expression of the Mad1p, which resulted in a decrease in p53 and an increase in chromosome segregation errors. They next treated the animals with a colon-specific inflammatory agent, which induced colon tumors in 31% of the mice, suggesting that overexpression of Mad1 can cause tumors in response to inflammation in immune-competent mice. Overall, the findings are important and will be of interest to the readership of PLOS Genetics, as Mad1 is a critical player in the spindle assembly checkpoint, and there is ample evidence that its mis-expression is correlated with tumorigenesis. This paper is largely the characterization of this mouse, which is necessary before this valuable tool can be utilized by the research community. I am in strong support for publication after the authors address the comments below.

General Comments:

1. My main concern with the paper is that the number of tumors formed is small, making it difficult to draw strong conclusions in some of the experiments or to do robust statistics. The authors started out with a reasonable sample size (16 each for control and experimental), but then only a percentage of the mice formed tumors. It would be crazy to repeat the entire study to increase sample size when it is unlikely that any of the major conclusions would change. To address this concern, there are several places where the authors should change their wording to be slightly more cautious on their interpretations- specific examples are listed below.

2. A second general comment is that the authors can improve clarity and presentation with better labeling of figures and descriptions in figure legends. Their work is at the intersection of cancer biology and cell biology. Many of the tissue images and the pathology analysis have no arrows or other indicators to draw the reader’s attention to specific areas. In addition, in many places the figure legends are written as results or conclusions rather than stating specifically what is shown in the figure. Again, specific examples will be given below, but overall, the authors should revisit all of the figures and legends with a focus on improving clarity.

Specific Comments:

1. I understand that the authors have genetically engineered the mice with the dox-inducible promotor to overexpress Mad1, but I find the comparison to mice with WT Mad1 to be a bit confusing. The overexpressed Mad1 is also WT- there is just more of it. When someone compares something to WT, my first thought is always a mutant vs. WT gene. Please consider changing the nomenclature for the WT control. Examples I can think of is Mad1 control vs. Mad1-OE or some variation of the control rtTA. These are just suggestions, and I leave it to the authors to choose the clearest option.

2. Throughout the paper the authors use the term CIN to describe the defects in chromosome segregation. Technically, they have only showed anaphase defects and have not demonstrated true CIN, which occurs through multiple cell divisions.

3. Please add the specific study number (numbers) for the TCGA data used in Figure 1.

4. There is inadequate description of how the increased fluorescence signal was measured. There is no detail in the methods, and the figure legend is insufficient.

5. Curious in Fig. 2F why the increased ratio of mRNA/protein is not maintained in the skin- perhaps it is just that there are only two skin samples so insufficient to make a strong conclusion.

6. For Figure 3B, in the merged image in the red channel still looks grey. If it is indeed red, then the images need to be changed to have increased contrast.

7. Figure 1D labels are not clear: there are two lanes of the same thing, but the blots are different. Also, for the p53 labels, I am assuming that the two blots are the different antibodies, but then which one is used for quantification in E? And for the IF in F and G- I realize that the layout doesn't fit, but the quantification in F comes from the images in G- thus the data in F needs to be after G. I understand the layout problems- but having figures out of order is confusing for the reader.

8. I disagree with the conclusion that the effects of weight are more pronounced in males. The difference comes down to a single measurement at the latest time point; otherwise, the curves are essentially the same. In addition, the difference between males and females on water (C) is the same magnitude as the DSS effect comparison in (D).

9. I appreciate that you started with a good number of mice and ended up with much fewer, but I don't think you have a sufficient number of tumors to conclude that there is significance to the finding that there were more tumors in male mice- especially when you consider that 14% of tumors in p53hets in panel F is not significant- because what it represents is one mouse. Please soften the wording to suggest a trend rather than a strong conclusion.

10. In the description of the tumors in Figure 5, it describes the pathology on 5 tumors, but the data from figure 4 say there were 7 tumors. What happened to the other ones?

11. For the data in Figure 5, you need arrows, arrowheads and other labels to illustrate this figure. This work is important to both cancer biologists, as well as to cell biologists who may have less experience in pathology. Also, the Ki67 staining is very difficult to detect in these images at the presented magnification because it is not all that high contrast. Please consider scaling to enhance the contrast and visibility of the staining.

12. I am unable to discern the differences in localization of the B-catenin staining at this magnification. Please include insets with increased magnification to better illustrate this point.

Reviewer #2: This study describes the impact of a modest (2-fold) overexpression of MAD1 in the mouse. Decreased p53 expression and increased chromosomal instability (CIN) are observed in the colon. When combined with exposure to the inflammatory agent dextran sulphate sodium (DSS), 31% of mice develop colon lesions and cancers are observed. More lesions are observed in males. In addition, lesions are observed in tissues (small intestine and prostate) not directly impacted by DSS-induced inflammation.

This is a well controlled study, carefully examining the impact of mild MAD1 overexpression in a novel genetically-engineered mouse model. The manuscript is very clearly written. Once a few issues with the figures and legends have been clarified, I will be happy to recommend publication.

Figure 3: how low are the p53 levels in the colonic epithelium? No numbers are given in the text. The datapoints in Fig3E-G look close to zero.

MAD1 levels seem to vary significantly from one mouse to another. Eg. Relatively low in the light blue mouse (Fig.3C): do MAD1 expression levels correlate with phenotypes (p53 levels and CIN)? It appears not from panels F and I. Why don’t they (in particular for the light blue mouse)?

Discussion (p10): ‘beyond stabilization of p53’. The authors should expand this section of their discussion, saying how the excess Mad1 protein might perturb chromosome segregation leading to CIN. Similarly, a little more speculation on why tumors are developing in the small intestine/prostate, but only in the mice treated with DSS, will be of general interest.

Other points, generally improving figures and legends:

Figure 1: the labelling should be improved and clearly explained in the figure legend. egs. RFS and PPS can be written in full. Q1 (lower quartile) is labelled as ‘low’ in B and C? Q4 as high? The labelling and description in the legend should be more consistent. HR is ??

Figure 2: can the Mad1 western be improved (Fig.2D)? Particularly in the skin, the Mad1 band is very weak, with several other bands nearby.

Figure 6: Panel D, color should be added to the graph so that individual data-points can be seen (the greys are too dark here, in the mutants). Too many abbreviations are being used here for the general reader. (TA/HGD/HP).

Figure S2. Western: what are the striking bands observed with anti-Mad1 in the first three fat samples?

Reviewer #3: In this study by Copeland et. al., the authors aimed to investigate the role of Mitotic Arrest Deficient 1 (MAD1L1, MAD1) up regulation, in sensitizing the colon to cancerous lesions. Prior work from this group has shown that MAD1 up regulation in cell lines leads to chromosome instability and destabilization of p53. In this study, the authors successfully generated a mouse model with tet-inducible MAD1 to study the effects of MAD1 up regulation in the colon. They show that a modest 2-fold up regulation in MAD1 leads to chromosome instability and p53 down regulation. MAD1 up regulation, when paired with DSS-induced inflammation, also led to the development of tumorous lesions in the colon, small intestine and prostate. The authors propose that MAD1 up regulation in the colon is sufficient to promote tumorigenesis in inflamed colonic epithelium.

The authors have developed and characterized an elegant tool to generate modest and inducible protein up regulation in-vivo. They have used it to then answer precise questions in a well-designed manner and the conclusions are supported by the data presented. I am overall enthusiastic about the publication of this study in PLOS Genetics. I would only suggest some modifications to the text and the figures for the purpose of making the work accessible to non-experts of the field.

Comments

1. In the section where the authors describe the generation of inducible HA-MAD1 mice, the switch between the Rosa26-CAG-rtTA3 and Rosa26-rtTA-M2 systems is very abrupt. A description of these systems is critical to understand their differences in inducing the up regulation of HA-MAD1 mRNA and protein levels.

2. All the data shown in figure 2 and the following figures are from mice fed with Dox chow. Though the fact that a homozygous TetO-HA-MAD1 could not be generated suggests that the promoter is suppressed, it would be important to show the basal expression of HA-MAD1 in the absence of Dox chow or, at the very least, explain why there are no experiments where the “no Dox” condition is present.

3. Could the authors also comment on why the p53+/- cohort has only one female mouse (figure 4H)? Also, the text states that “14% of p53+/- mice developed tumors”, even though this represents only 1 out of 7 mice and the increase is, according to the author’s analysis, not significant (figure 4F). The authors must tone this statement down.

4. In Figure 3D, could the authors please clarify what difference between lanes 2 and 3 are.

5. In Figure 4H could the authors please comment on whether the difference in incidences of lesions between male and female mice could be because of the extent of DSS induced inflammation itself? It is important to address this as there is evidence to suggest that DSS affects males more than females (Figure S3 and Chassaing B et. al., 2014).

6. The authors claim that the tumors in the small intestine and the prostate in DSS treated HA-MAD1 mice are independent of inflammation. To conclude this, the authors must either show that there are no markers of inflammation present in these tissues (low level inflammation could still be present in the absence of any widespread morphological changes) or tone this statement down.

7. In the section titled “HA-MAD1 tumors display mitotic defects and decreased p53 expression” the text and data presented indicates that there is not much difference in mitotic defects or p53 levels between tumor and normal colon tissues. The authors should title the section to better represent the data and conclusions presented.

8. Table S2, Could the authors please separate water and DSS treated animals. This would make the data easier to understand/interpret and align better with the text that references this data.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

PLoS Genet. 2024 Oct 7;20(10):e1011437. doi: 10.1371/journal.pgen.1011437.r002

Author response to Decision Letter 0

11 Sep 2024

Attachment

Submitted filename: Response to Reviewers 9-3-24.pdf

pgen.1011437.s003.pdf^{(79.2KB, pdf)}

PLoS Genet. doi: 10.1371/journal.pgen.1011437.r003

Decision Letter 1

Kent W Hunter, Ajit P Joglekar

23 Sep 2024

Dear Dr Weaver,

We are pleased to inform you that your manuscript entitled "MAD1 upregulation sensitizes to inflammation-mediated tumor formation" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Ajit P. Joglekar, Ph.D.

Guest Editor

PLOS Genetics

David Kwiatkowski

%CORR_ED_EDITOR_ROLE%

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-24-00657R1

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

PLoS Genet. doi: 10.1371/journal.pgen.1011437.r004

Acceptance letter

Kent W Hunter, Ajit P Joglekar

3 Oct 2024

PGENETICS-D-24-00657R1

MAD1 upregulation sensitizes to inflammation-mediated tumor formation

Dear Dr Weaver,

We are pleased to inform you that your manuscript entitled "MAD1 upregulation sensitizes to inflammation-mediated tumor formation" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Anita Estes

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Text. Supporting Figures and Tables. Fig A. Generation and validation of dox-inducible HA-MAD1 mice.

(PDF)

pgen.1011437.s001.pdf^{(1.7MB, pdf)}

S1 Data. Excel file containing source data for Figs 1–4, 6, B and C in S1 Text.

(XLSX)

pgen.1011437.s002.xlsx^{(37.7KB, xlsx)}

Attachment

Submitted filename: Response to Reviewers 9-3-24.pdf

pgen.1011437.s003.pdf^{(79.2KB, pdf)}

Data Availability Statement

The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files.

[pgen.1011437.ref001] 1.Society AC. Cancer Facts and Figures. American Cancer Society: Atlanta, 2024. [Google Scholar]

[pgen.1011437.ref002] 2.Cosper PF, Copeland SE, Tucker JB, Weaver BA. Chromosome Missegregation as a Modulator of Radiation Sensitivity. Semin Radiat Oncol 2022; 32: 54–63. doi: 10.1016/j.semradonc.2021.09.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref003] 3.Ryan SD, Britigan EM, Zasadil LM, Witte K, Audhya A, Roopra A et al. Up-regulation of the mitotic checkpoint component Mad1 causes chromosomal instability and resistance to microtubule poisons. Proc Natl Acad Sci U S A 2012; 109: E2205–2214. doi: 10.1073/pnas.1201911109 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref004] 4.Grant GD, Brooks L, Zhang X, Mahoney JM, Martyanov V, Wood TA et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell 2013; 24: 3634–3650. doi: 10.1091/mbc.E13-05-0264 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref005] 5.Zasadil LM, Britigan EM, Weaver BA. 2n or not 2n: Aneuploidy, polyploidy and chromosomal instability in primary and tumor cells. Semin Cell Dev Biol 2013; 24: 370–379. doi: 10.1016/j.semcdb.2013.02.001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref006] 6.Vasudevan A, Schukken KM, Sausville EL, Girish V, Adebambo OA, Sheltzer JM. Aneuploidy as a promoter and suppressor of malignant growth. Nat Rev Cancer 2021; 21: 89–103. doi: 10.1038/s41568-020-00321-1 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref007] 7.Santaguida S, Richardson A, Iyer DR, M’Saad O, Zasadil L, Knouse KA et al. Chromosome Mis-segregation Generates Cell-Cycle-Arrested Cells with Complex Karyotypes that Are Eliminated by the Immune System. Dev Cell 2017; 41: 638–651.e635. doi: 10.1016/j.devcel.2017.05.022 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref008] 8.Wang RW, Viganò S, Ben-David U, Amon A, Santaguida S. Aneuploid senescent cells activate NF-κB to promote their immune clearance by NK cells. EMBO Rep 2021; 22: e52032. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref009] 9.Wan J, Block S, Scribano CM, Thiry R, Esbona K, Audhya A et al. Mad1 destabilizes p53 by preventing PML from sequestering MDM2. Nat Commun 2019; 10: 1540. doi: 10.1038/s41467-019-09471-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref010] 10.Li R, Murray AW. Feedback control of mitosis in budding yeast. Cell 1991; 66: 519–531. doi: 10.1016/0092-8674(81)90015-5 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref011] 11.Chen RH, Shevchenko A, Mann M, Murray AW. Spindle checkpoint protein Xmad1 recruits Xmad2 to unattached kinetochores. J Cell Biol 1998; 143: 283–295. doi: 10.1083/jcb.143.2.283 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref012] 12.Hardwick KG, Murray AW. Mad1p, a phosphoprotein component of the spindle assembly checkpoint in budding yeast. J Cell Biol 1995; 131: 709–720. doi: 10.1083/jcb.131.3.709 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref013] 13.Kitagawa R, Rose AM. Components of the spindle-assembly checkpoint are essential in Caenorhabditis elegans. Nat Cell Biol 1999; 1: 514–521. doi: 10.1038/70309 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref014] 14.Seeley TW, Wang L, Zhen JY. Phosphorylation of human MAD1 by the BUB1 kinase in vitro. Biochem Biophys Res Commun 1999; 257: 589–595. doi: 10.1006/bbrc.1999.0514 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref015] 15.Musacchio A, Salmon ED. The spindle-assembly checkpoint in space and time. Nat Rev Mol Cell Biol 2007; 8: 379–393. [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref016] 16.Cleveland DW, Mao Y, Sullivan KF. Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell 2003; 112: 407–421. doi: 10.1016/s0092-8674(03)00115-6 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref017] 17.Jackman M, Marcozzi C, Barbiero M, Pardo M, Yu L, Tyson AL et al. Cyclin B1-Cdk1 facilitates MAD1 release from the nuclear pore to ensure a robust spindle checkpoint. J Cell Biol 2020; 219. doi: 10.1083/jcb.201907082 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref018] 18.Allan LA, Camacho Reis M, Ciossani G, Huis In ’t Veld PJ, Wohlgemuth S, Kops GJ et al. Cyclin B1 scaffolds MAD1 at the kinetochore corona to activate the mitotic checkpoint. EMBO J 2020; 39: e103180. doi: 10.15252/embj.2019103180 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref019] 19.Collin P, Nashchekina O, Walker R, Pines J. The spindle assembly checkpoint works like a rheostat rather than a toggle switch. Nat Cell Biol 2013; 15: 1378–1385. doi: 10.1038/ncb2855 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref020] 20.Lara-Gonzalez P, Pines J, Desai A. Spindle assembly checkpoint activation and silencing at kinetochores. Semin Cell Dev Biol 2021; 117: 86–98. doi: 10.1016/j.semcdb.2021.06.009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref021] 21.Chung E, Chen RH. Spindle checkpoint requires Mad1-bound and Mad1-free Mad2. Mol Biol Cell 2002; 13: 1501–1511. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref022] 22.Levine AJ. p53: 800 million years of evolution and 40 years of discovery. Nat Rev Cancer 2020; 20: 471–480. doi: 10.1038/s41568-020-0262-1 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref023] 23.Kubbutat MH, Jones SN, Vousden KH. Regulation of p53 stability by Mdm2. Nature 1997; 387: 299–303. doi: 10.1038/387299a0 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref024] 24.Bernardi R, Scaglioni PP, Bergmann S, Horn HF, Vousden KH, Pandolfi PP. PML regulates p53 stability by sequestering Mdm2 to the nucleolus. Nat Cell Biol 2004; 6: 665–672. doi: 10.1038/ncb1147 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref025] 25.Győrffy B. Survival analysis across the entire transcriptome identifies biomarkers with the highest prognostic power in breast cancer. Comput Struct Biotechnol J 2021; 19: 4101–4109. doi: 10.1016/j.csbj.2021.07.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref026] 26.Iwanaga Y, Chi YH, Miyazato A, Sheleg S, Haller K, Peloponese JM, Jr. et al. Heterozygous deletion of mitotic arrest-deficient protein 1 (MAD1) increases the incidence of tumors in mice. Cancer Res 2007; 67: 160–166. doi: 10.1158/0008-5472.CAN-06-3326 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref027] 27.Dow LE, Nasr Z, Saborowski M, Ebbesen SH, Manchado E, Tasdemir N et al. Conditional reverse tet-transactivator mouse strains for the efficient induction of TRE-regulated transgenes in mice. PLoS One 2014; 9: e95236. doi: 10.1371/journal.pone.0095236 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref028] 28.Dow LE, O’Rourke KP, Simon J, Tschaharganeh DF, van Es JH, Clevers H et al. Apc Restoration Promotes Cellular Differentiation and Reestablishes Crypt Homeostasis in Colorectal Cancer. Cell 2015; 161: 1539–1552. doi: 10.1016/j.cell.2015.05.033 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref029] 29.Hochedlinger K, Yamada Y, Beard C, Jaenisch R. Ectopic expression of Oct-4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues. Cell 2005; 121: 465–477. doi: 10.1016/j.cell.2005.02.018 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref030] 30.Cooper HS, Murthy S, Kido K, Yoshitake H, Flanigan A. Dysplasia and cancer in the dextran sulfate sodium mouse colitis model. Relevance to colitis-associated neoplasia in the human: a study of histopathology, B-catenin and p53 expression and the role of inflammation. Carcinogenesis 2000; 21: 757–768. doi: 10.1093/carcin/21.4.757 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref031] 31.Okayasu I, Yamada M, Mikami T, Yoshida T, Kanno J, Ohkusa T. Dysplasia and carcinoma development in a repeated dextran sulfate sodium-induced colitis model. J Gastroenterol Hepatol 2002; 17: 1078–1083. [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref032] 32.Tanaka T, Kohno H, Suzuki R, Yamada Y, Sugie S, Mori H. A novel inflammation-related mouse colon carcinogenesis model induced by azoxymethane and dextran sodium sulfate. Cancer Sci 2003; 94: 965–973. doi: 10.1111/j.1349-7006.2003.tb01386.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref033] 33.Fujii S, Fujimori T, Kawamata H, Takeda J, Kitajima K, Omotehara F et al. Development of colonic neoplasia in p53 deficient mice with experimental colitis induced by dextran sulphate sodium. Gut 2004; 53: 710–716. doi: 10.1136/gut.2003.028779 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref034] 34.Chang WC, Coudry RA, Clapper ML, Zhang X, Williams KL, Spittle CS et al. Loss of p53 enhances the induction of colitis-associated neoplasia by dextran sulfate sodium. Carcinogenesis 2007; 28: 2375–2381. doi: 10.1093/carcin/bgm134 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref035] 35.White BD, Chien AJ, Dawson DW. Dysregulation of Wnt/β-catenin signaling in gastrointestinal cancers. Gastroenterology 2012; 142: 219–232. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref036] 36.Pai P, Rachagani S, Dhawan P, Batra SK. Mucins and Wnt/β-catenin signaling in gastrointestinal cancers: an unholy nexus. Carcinogenesis 2016; 37: 223–232. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref037] 37.Kitajima S, Takuma S, Morimoto M. Histological analysis of murine colitis induced by dextran sulfate sodium of different molecular weights. Exp Anim 2000; 49: 9–15. [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref038] 38.Chassaing B, Aitken JD, Malleshappa M, Vijay-Kumar M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr Protoc Immunol 2014; 104: 15.25.11–15.25.14. doi: 10.1002/0471142735.im1525s104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref039] 39.Baker DJ, Jeganathan KB, Cameron JD, Thompson M, Juneja S, Kopecka A et al. BubR1 insufficiency causes early onset of aging-associated phenotypes and infertility in mice. Nat Genet 2004; 36: 744–749. doi: 10.1038/ng1382 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref040] 40.Macedo JC, Vaz S, Bakker B, Ribeiro R, Bakker PL, Escandell JM et al. FoxM1 repression during human aging leads to mitotic decline and aneuploidy-driven full senescence. Nat Commun 2018; 9: 2834. doi: 10.1038/s41467-018-05258-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref041] 41.Söderlund S, Granath F, Broström O, Karlén P, Löfberg R, Ekbom A et al. Inflammatory bowel disease confers a lower risk of colorectal cancer to females than to males. Gastroenterology 2010; 138: 1697–1703. [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref042] 42.Bábíčková J, Tóthová Ľ, Lengyelová E, Bartoňová A, Hodosy J, Gardlík R et al. Sex Differences in Experimentally Induced Colitis in Mice: a Role for Estrogens. Inflammation 2015; 38: 1996–2006. doi: 10.1007/s10753-015-0180-7 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref043] 43.Kops GJ, Foltz DR, Cleveland DW. Lethality to human cancer cells through massive chromosome loss by inhibition of the mitotic checkpoint. Proc Natl Acad Sci U S A 2004; 101: 8699–8704. doi: 10.1073/pnas.0401142101 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref044] 44.Funk LC, Wan J, Ryan SD, Kaur C, Sullivan R, Roopra A et al. p53 Is Not Required for High CIN to Induce Tumor Suppression. Mol Cancer Res 2021; 19: 112–123. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref045] 45.Zhou AS, Tucker JB, Scribano CM, Lynch AR, Carlsen CL, Pop-Vicas ST et al. Diverse microtubule-targeted anticancer agents kill cells by inducing chromosome missegregation on multipolar spindles. PLoS Biol 2023; 21: e3002339. doi: 10.1371/journal.pbio.3002339 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref046] 46.Miroshnikova YA, Rozenberg GI, Cassereau L, Pickup M, Mouw JK, Ou G et al. α5β1-Integrin promotes tension-dependent mammary epithelial cell invasion by engaging the fibronectin synergy site. Mol Biol Cell 2017; 28: 2958–2977. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref047] 47.Yu M, Chu S, Fei B, Fang X, Liu Z. O-GlcNAcylation of ITGA5 facilitates the occurrence and development of colorectal cancer. Exp Cell Res 2019; 382: 111464. doi: 10.1016/j.yexcr.2019.06.009 [DOI] [PubMed] [Google Scholar]

[pgen.1011437.ref048] 48.Wan J, Weaver BA. Mad1 at the Golgi apparatus: a story beyond kinetochores. Cell Cycle 2015; 14: 1763–1764. doi: 10.1080/15384101.2015.1032639 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref049] 49.Wan J, Zhu F, Zasadil LM, Yu J, Wang L, Johnson A et al. A Golgi-localized pool of the mitotic checkpoint component Mad1 controls integrin secretion and cell migration. Curr Biol 2014; 24: 2687–2692. doi: 10.1016/j.cub.2014.09.052 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011437.ref050] 50.Becker C, Fantini MC, Neurath MF. High resolution colonoscopy in live mice. Nat Protoc 2006; 1: 2900–2904. doi: 10.1038/nprot.2006.446 [DOI] [PubMed] [Google Scholar]

PERMALINK

MAD1 upregulation sensitizes to inflammation-mediated tumor formation

Sarah E Copeland

Santina M Snow

Jun Wan

Kristina A Matkowskyj

Richard B Halberg

Beth A Weaver

Roles

Abstract

Author summary

Introduction

Results

MAD1L1 overexpression is common in colon cancer where it serves as a marker of poor prognosis

Fig 1. Overexpression of MAD1L1 is common in colon cancer, where it correlates with worse prognosis.

Generation of dox-inducible HA-MAD1 mice

Fig 2. Generation of dox-inducible HA-MAD1 mouse model.

HA-MAD1 mice have increased mitotic defects and decreased p53

Fig 3. Dox-inducible expression of HA-MAD1 in colon is sufficient to decrease p53 expression and cause chromosome missegregation.

Modest upregulation of MAD1 sensitizes immune-competent mice to colon lesion formation in the context of inflammation

Fig 4. Modest MAD1 upregulation sensitizes to colon tumorigenesis.

Pathology of colon tumors

Fig 5. Pathology of colon tumors in DSS-treated HA-MAD1 mice.

Table 1. Pathologically confirmed colon lesions.

Additional tumors in HA-MAD1 mice

HA-MAD1 tumors and tissue display mitotic defects and decreased p53 expression

Fig 6. HA-MAD1 tumors have increased CIN and decreased p53.

Discussion

Materials and methods

Ethics statement

Generation of Mad1l1 GEMM

Genotyping

qRT-PCR

Immunoblotting

Tissue Immunostaining

Dextran sulfate sodium (DSS) treatment

Colonoscopy tumor surveillance

Histopathological analysis

Statistical analysis

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

David J Kwiatkowski

Ajit P Joglekar

Roles

Author response to Decision Letter 0

Decision Letter 1

Kent W Hunter

Ajit P Joglekar

Roles

Acceptance letter

Kent W Hunter

Ajit P Joglekar

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases