Toxicological screening of zinc oxide nanoparticles in mongrel dogs after seven days of repeated subcutaneous injections

Marwa H Hassan; Ibrahim A Emam; Haitham Farghali; Marwa A Ibrahim; Neven H Hassan; Khaled Y Farroh; Eman I Hassanen

doi:10.1186/s12917-024-04268-5

. 2024 Oct 18;20:476. doi: 10.1186/s12917-024-04268-5

Toxicological screening of zinc oxide nanoparticles in mongrel dogs after seven days of repeated subcutaneous injections

Marwa H Hassan ^1,², Ibrahim A Emam ², Haitham Farghali ², Marwa A Ibrahim ³, Neven H Hassan ⁴, Khaled Y Farroh ⁵, Eman I Hassanen ^6,^✉

PMCID: PMC11487719 PMID: 39425163

Abstract

Zinc oxide nanoparticles (ZnO NPs) have recently been applied in various veterinary and medical fields, however, the toxicological evaluations of these NPs in dogs are lacking. Therefore, the current study is designed to assess the impact of exposure to daily subcutaneous (SC) injections of ZnO NPs at different concentrations on various organs of mongrel dogs. Nine dogs were randomly divided into three groups (n = 3 for each) as follows: group (1) served as the control group, whereas groups (2&3) received SC injections of 50 and 100 ppm ZnO NPs (8 and 16 μg/kg bwt), respectively, once/day for 7 days. Our results revealed that ZnO NPs disrupted the oxidant/antioxidant balance in the lungs, liver, and kidneys of dogs in a dose-dependent manner. ZnO NPs induced dose-dependent radiological, ultrasonographical, and histopathological alterations in various organs especially lungs, spleen, liver, and kidneys along with disturbance in both liver and kidney biomarkers levels. Most organs of both ZnO NPs receiving groups displayed strong caspase-3 protein expression. Additionally, it upregulates the transcriptase levels of TNF-α and VEGF, as well as downregulates the antiapoptotic gene IL-10 in lung, kidney, and liver tissue homogenates. It was concluded that the daily SC injections of dogs with ZnO NPs at concentrations of 50 and 100 ppm caused extensive oxidative stress damage in various organs which provoked serious pathological processes such as apoptosis and inflammation.

Keywords: Gene expression, Oxidative stress, Pathology, Ultrasonography, ZnO NPs

Introduction

Nanotechnology is the process of manipulating the shape and size of structures, electronics, and systems at the nanometer scale [1, 2]. Nanoparticles (NPs) with nanometer regions sized from 1 to 100 nm show exceptional characteristics because of their high surface area to volume ratio and diminutive size compared with macro-sized particles [3, 4]. They have been implanted in plentiful novel industrial branches such as pharmaceutical, chemical, mechanical, and food processing, moreover optics branches, drug delivery, medicinal techniques, and environmental sciences [5]. These NPs have the dimensions that make them suitable candidates for nanoengineering [6, 7].

Zinc oxide nanoparticles (ZnO NPs) are among the most significant metal oxide NPs due to their several key properties, including intense ultraviolet (UV) and infrared (IR) adsorption, strong catalytic activity, physical and chemical stability, and potent antibacterial activity [8]. Because nanosized particles can interact with the bacterial surface and/or the bacterial core once they enter the cell, they exhibit different bactericidal processes and have considerable antibacterial activity against a wide range of bacterial species [9–11]. ZnO NPs have been utilized for feed additives, food preservatives, and tissue repair [12]. ZnO NPs are broadly utilized in veterinary fields because of their potent antimicrobial, antineoplastic, and angiogenic activity [12]. They have been used to treat various skin lesions, such as infected wounds, eczema, dermatitis, and hemorrhoids in various animal species [13]. Recently, few studies revealed the ability of ZnO nanoparticles alone or in combination with other nanomaterials to accelerate the process of wound healing in dogs [14, 15]. Another study investigated the beneficial effect of Zn-containing drugs against canine atopic dermatitis [16]. Additionally, a further study determined the antifungal potential of ZnO NPs against Microsporum canis that was isolated from dogs and therefore, they recommend using ZnO NPs as an antimicrobial therapy for dermatophytes-mediated skin lesions in dogs after evaluating its safety in dogs [17]. Many reserchers validated that the direct topical application of ZnO NPs either alone or with antifungal agent for 14 days is markedly reduced the skin lesions of Malassezia and other fungal infections in dogs [18, 19].

The features that offer a promising opportunity for the creation of novel technologies in the medical field come with an unidentified risk to the welfare of animals and environmental safety. Besides the extensive uses of ZnO NPs, unknown risks could be created and most of them related to various cellular oxidative stress [20]. Mitochondrial malfunction, oxidative stress, and loss of cell viability are caused by changes in cellular zinc homeostasis [21]. Unexpected increases in free Zn²⁺ levels have the potential to damage lysosomes, releasing their contents into the cytoplasm and leading to cell death [22]. Many factors influencing ZnO NPs toxicity, including NPs size, concentration, route of administration, and frequency of exposure as well as animal species and breeding also control the pathological changes related to ZnO NPs [23, 24]. One study investigated the hepatotoxic effect of ZnO NPs in dogs after repeated oral administration that attributed to the oxidative stress damage [25].

Despite increasing the medicinal application of ZnO NPs, the potential toxicity of these metal oxide NPs is still sparse in various animal species, including dogs. It is important to investigate the toxicological effects of ZnO NPs at different concentrations via different routes to maintain their medicinal uses and reduce unfavorable adverse impacts. For this reason, the goal of the current study is to assess the possible systemic toxicity of different concentrations of ZnO NPs after 7-days of repeated subcutaneous injections in mongrel dogs. In addition, we explored the potential mechanism of such toxicity with a comprehensive insight into the molecular mechanisms.

Materials and methods

Preparation and characterization of zinc oxide nanoparticles (ZnO NPs)

In accordance with Kumar et al. [26], the precipitation process was used to create ZnO NPs. In a typical method, 50 ml of deionized water (Milli-Q, Millipore, USA) were used to dissolve 7.1883 g of zinc sulphate heptahydrate (ZnSO4 · 7H2O, 99% purity, Sigma-Aldrich, USA). Next, sodium hydroxide (50 mL, 1 M) (98% purity, Sigma-Aldrich, USA) was added dropwise during magnetic stirring. Following the addition, the stirring was conducted for a further 30 min. Multiple rounds of pure water were used to filter and wash the precipitates. The precipitates were then dried at 60 °C for 24 h and calcined at 500 °C for two hours.

Two distinct examinations were performed on a powder of zinc oxide in the nano-size range. The chemical structures of the prepared NPs were evaluated using XRD technique. In the scanning mode of an X-ray diffractometer (X ‘pert PRO, PAN analytical, Netherlands) using a Cu K radiation tube (= 1.54 A) operating at 40 kV and 30 mA, the appropriate XRD pattern was captured. The standard ICCD library built into the PDF4 software was used to analyze the acquired diffraction pattern. The actual morphology of the as-prepared ZnO NPs was imaged by a High-Resolution Transmission Electron Microscope (HR-TEM) operating at an accelerating voltage of 200 kV (Tecnai G2, FEI, Netherlands). Diluted ZnO NPs solution was ultra-sonicated for 5 min to reduce the particle aggregation. Using a micropipette, three drops from the sonicated solution were deposited on a carbon-coated coated copper grid and left to dry at room temperature. HR-TEM images of the ZnO NPs that were deposited on the grid were captured for morphological evaluation.

Experimental animals

The current investigation was designed following the ARRIVE guidelines (PLoS Bio 8(6), e1000412,2010), and conducted after the approval of the Institutional Animal Care and Use Committee of Cairo University (IACUC), CU/F/40/23.

Nine healthy male mongrel dogs of different ages (1–1½ years), weighing (15–20 kg), were obtained from dogs’ owners to be enrolled in the present study. All dogs’ owners were aware that their animals will be included in research purposes and signed a written consent indicating their approval. The Power Calculation Method was used for sample size calculation as we calculated the sample size on SPSS version 18.0 software (SPSS Inc, Chicago, IL., USA) using Paired t-test http://www.biomath.info/power/prt.htm. Dogs were housed individually at the kennels of the Department of Surgery, Anesthesiology and Radiology, Faculty of Veterinary Medicine, Cairo University. They were kept under standard environmental conditions of 12/12 hrs light/dark cycle, 25^oC, 55 ± 5% humidity. Dogs were given regular dry food twice a day and unrestricted access to tap water during the study. They were acclimatized two weeks before the beginning of the experiment. Additionally, complete clinical examination, hematological evaluation, liver and kidney function tests were performed on each dog prior to ZnO NPs injections to exclude evidence of systemic diseases.

The block randomization method was used to allocate dogs into three groups (n = 3, the experimental unit is a single animal). All dogs were subcutaneously injected by 3mL normal saline or ZnO NPs at different concentrations every day for one week in a circular manner at one side of the chest region. Group I received normal saline and kept as a control group, group II received 50 ppm ZnO NPs corresponding to 8 μg/kg bwt, and group III received 100 ppm ZnO NPs corresponding to 16 μg/kg bwt. To minimize the impact of potential confounders in our study, several strategies were implemented. First, the order of treatments and measurements were randomized to mitigate any bias introduced by the sequence of drug interventions. Furthermore, several steps were taken to control the potential influence of animal/cage location. The cages were arranged to minimize spatial effects, and the animals were rotated between cage locations throughout the study period. The personnel responsible for administering the treatments, conducting the measurements, and performing the assessments were blinded to the group assignments. While processing and analyzing the data, the experimenters were kept blind to the treatment. Because there isn’t a reference dose of ZnO NPs in dogs, the doses were chosen based on the previous studies in mice that used ZnO NPs at low concentrations 250–500 ppm (50–100 μg/kg bwt) [27, 28], following the dose conversion formula between different species as the following:

Dog equivalent dose (mg/kg) = dose to be converted / (dog K _m /Mouse K _m

Whereas Dog K_m= 3, Mouse K_m=20

Each dog was admitted to routine physical examination, including general body condition (hair, skin, and body weight), appetite and mucus membrane. The experimental study would be stopped if there is a progressive weight loss (more than 20%), severe colic, unavoidable pain or distress, ulcerative dermatitis, echzyma, and other skin lesions. Since there were no reports of serious adverse events during the trial, all dogs were included in the study and none were excluded.

Radiographical and ultrasonographical examination

Radiographical examinations of the chest and abdomen were applied by left lateral recumbency of the dogs at the end of the experiment (7th day). Radiographs were independently blindly reviewed by three veterinary radiologists. Ultrasonographical examinations of the kidney, liver and spleen were applied at 7th day post-injection.

Sample collection

Fresh whole blood samples were collected from the right cephalic vein from all dogs at 0 day and 7th day after ZnO-NPs exposure. Some of them used immediately for hematological parameters, while others collected on anticoagulant and centrifuged at 3500 x.g for 5 min to isolate serum samples. Serum samples were preserved at -20°c till used for biochemical parameters. At the end of the experiment (7 days), all dogs were sedated with xylazine and butorphanol and then humanly euthanized using overdose of pentobarbital sodium (25 mg/kg bwt, intravenous injection through cephalic vein). Afterwards, skin at the site of injection and some organs (liver, kidneys, lungs, spleen, heart) were collected from all groups. Some samples were preserved at -80°c till used for oxidative stress evaluation and molecular studies, while others were fixed in 10% neutral buffer formalin till used for histopathological analysis.

Hematological and biochemical parameters

Fresh whole blood samples were used for hematological analysis (RBCs count, HB, PCV, MCV, MCHC, WBC count, differential leucocytic count using Giemsa stain, and Platelets counts) as previously described [29, 30].

Serum samples were used for estimating different biochemical parameters (AST, ALT, ALP, total proteins, albumin, urea, and creatinine) using highly specialized kits from Spectrum, Germany.

Oxidant/antioxidant assay

The collected frozen tissue samples (liver, kidney, and lung) were homogenized using ice-cold buffer (phosphate buffer saline, pH 7.4). Tissue homogenits were used to estimate malondialdehyde (MDA), and reduced glutathione (GSH) levels following the instruction of manufacturer’s instructions of the standardized kits purchased from Biodiagnostic Co. Egypt.

Determination of the transcript levels of TNF-α, VEGF and IL-10 genes

The ABT Total RNA Mini Extraction Kit (Applied Biotechnology Co. Ltd, Egypt) was used to extract total RNA. Nanodrop Technology was utilized to assess the quantity and quality of RNA [31]. The ABT H-minus cDNA synthesis kit (Applied Biotechnology Co. Ltd, Egypt) was applied to create the cDNA. Following the manufacturer’s instructions, ABT 2X SYBR mix (Applied Biotechnology co. ltd, Egypt) was used for the quantitative evaluation of cDNA amplification. The internal control was the GAPDH gene. The qRT-PCR primers are displayed in Table 1 and were created using the primer designing tool (Primer Designing Tool, n.d.). Triplicates of each qRT-PCR were run. The comparative 2^−ΔΔCT approach was utilized to ascertain the relative transcription levels [32].

Table 1.

Primers sequences used for qRT-PCR

Gene symbol	Gene description	Accession number	Primer Sequence
TNF-α	Tumor necrosis factor	NM_001003244.4	F: 5′- CTCTCTGCCATCAAGAGCCC ‐3′ R: 5′- CTAAGCCTGAAGGGGGTGAG ‐3′
IL-10	Interleukin 10	NM_001003077.1	F: 5′- CGCTGTCACCGATTTCTTCC − 3′ R: 5′- GGTCGGCTCTCCTACATCTC − 3′
VEGFA	Vascular endothelial growth factor	NM_001003175.2	F: 5’-CCCGGTATAAACCCTGGAGC-3’ R: 5’-ACGCGAGTCTGTGTTTTTGC-3’
GAPDH	Glyceraldehyde3-phosphate dehydrogenase	NM_001003142.2	F: 5′- CGGGAAACTTGTCATCAACGG − 3′ R: 5′- TTTGGCTAGAGGAGCCAAGC − 3′

Open in a new tab

Histopathology

After 48 h from formalin fixation, all samples were washed and treated by the traditional method using ascending grade of alcohol for dehydration and xylene for clearance. After that, they embedded in paraffin wax to create blocks that an ordinary microtome could slice into 4.5 μm tissue sections. Hematoxylin and eosin stain (H&E) was used to color all sections, which were then examined under an Olympus BX43 light microscope. The DP27 Olympus camera, which was connected to Cell Sens dimensions software, took the pictures [33].

The ordinal Semiquantitative microscopic scoring system was performed to determine the extent of the pathological alterations in all the examined organs following the scheme described by Hassanen et al. [34], . The criteria used for grading the hepatorenal lesions were cellular degeneration, necrosis, vascular congestion, edema, hemorrhage, and interstitial inflammatory cells infiltration. Furthermore, the same parameters were graded distinctively in each pulmonary area, including bronchi, bronchioles, alveoli, and interstitial tissue to identify the histological distribution of lesions within the lung lobule according to Hassanen et al. [35], , whereas the spleen was graded via assessing the extent of lymphocytolysis [36]. The above-mentioned lesions were scored as mild, moderate, severe, and extensive severe, on a five-pointed ordinal scale, as following; 0 = ordinal histology, 1 < 25%, 2 = 25:50%, 3 = 50:75%, and 4 > 75% tissue damage. All parameters were assessed by a pathologist who was not aware of the treatment groups to prevent bias.

Immunohistochemistry

The dewaxed-tissue sections were washed and blocked by peroxidase blocker (Sakura BIO), then the antigen retrieval was done by heat and citrate solution. After that, the primary antibody (Abcam, Ltd.) was added at a dilution of 1/200. Then, the materials involved in the immunostaining/DAB kit (Power-Stain 1.0 Poly HRP DAB Kit; Sakura) were added. The slides were counterstained with Haematoxylin, and finally inspected under a light microscope (Olympus BX43). Photomicrographs were taken using an Olympus DP27 digital camera connected to the Cell Sens dimensions program.

Statistical analysis

The data obtained from the present study were statistically subjected to one-way (ANOVA) and repeated measure ANOVA by the computerized program SPSS software, version “25” Data was represented as Mean ± SD. Furthermore, the nonparametric values were analyzed using Kruskal Wallis H test and the Mann-Whitney U test, then the data was represented as the median. Values were considered significant at P ≤ 0.05.

Results

Characterization of the prepared nanoparticles

Figure 1A displayed the X-ray diffraction patterns of ZnO NPs. The peaks at 2 = 31.77°, 34.42°, 36.25°, 47.54°, 56.59°, 62.85° and 67.95° were attributed to (100), (002), (101), (102), (110), (103), and (112) of ZnO NPs, indicating the crystalline structure of synthesized ZnO NPs that presented a hexagonal phase structure of the zincite mineral name (JCPDS 04-007-5097). HR-TEM images as illustrated in Fig. 1B demonstrated spherical-shaped particles with an average size of 19.3 nm.

Fig. 1 — Characterization of ZnO NPs. (A): XRD pattern analysis indicating the formation of ZnO NPs. (B): HR-TEM image showing nearly spherical shape of prepared ZnO NPs with average size 19.3 nm

Physical examinations

At the start point of the experiment (0 day), all dogs showed healthy body condition with normal value of temperature, heart rate, respiratory rate and capillary refilling time. At 4 d post-injection till 7 d, the mucous membrane of dogs in the control group was rosy-red, whereas pale mucosa was observed in both 50 and 100 ppm receiving groups. The general body condition (appetite, hair, and body weight) had no evidence to be affected by ZnO NPs injections compared with the control group. Temperature, heart rate, respiratory rate and capillary refilling time in all groups are shown in Table 2. The temperature was constant in all treatment groups throughout the experiment. Whereas, both heart rates, respiratory rates, and capillary refilling time were significantly increased in the group receiving 100 ppm ZnO NPs compared with other groups. The cardiac sound of dogs in the control group and those receiving 50 ppm ZnO NPs was lup - dup sound through the period of the experiment while this sound was reduced from day 4 in group receiving 100 ppm and the sound disappeared at 7 d post-injection. Normal bronchial and vesicular sounds were heard in both the control group and 50 ppm ZnO NPs receiving group all over the experiment, however, a crackling sound was heard in the group receiving 100 ppm.

Table 2.

Mean value of Temperature, heart rate, respiratory rate, and capillary refilling time of various experimental groups at 0 day and after ZnO NPs exposure through 7 days

Days	Control	50 ppm	100 ppm
Temperature (ºc)
0	37.5 ± 0.2 ^{a, A}	37.4 ± 0.1 ^{a, A}	37.5 ± 0.3 ^{a, A}
1	37.6 ± 0.1 ^{a, A}	38 ± 0.1 ^{b, B}	37.9 ± 0.1 ^{b, A}
2	37.8 ± 0.1 ^{a, A}	38.1 ± 0.1 ^{b, B}	38.4 ± 0.1 ^{c, B}
3	38.2 ± 0.3 ^{a, B}	38.1 ± 0.1 ^{a, B}	38.4 ± 0.1 ^{a, B}
4	38.1 ± 0.1 ^{a, B}	38.2 ± 0.1 ^{a, B}	38.5 ± 0.1 ^{b, B}
5	38.1 ± 0.1 ^{a, B}	38 ± 0.1 ^{a, B}	38.4 ± 0.1 ^{a, B}
6	38 ± 0.1 ^{a, A}	38.1 ± 0.1 ^{a, B}	38.4 ± 0.2 ^{b, B}
7	38.2 ± 0.2 ^{a, B}	38.1 ± 0.1 ^{a, B}	38.5 ± 0.2 ^{a, B}
Heart rate (bpm)
0	76 ± 2.5 ^{a, A}	76 ± 0.5 ^{a, A}	75 ± 3.5 ^{a, A}
1	76 ± 0.6 ^{a, A}	75.3 ± 0.6 ^{a, A}	74.7 ± 0.6 ^{a, A}
2	75.3 ± 0.6 ^{a, A}	76.3 ± 1.2 ^{a, A}	89 ± 3.6 ^{b, B}
3	76 ± 1 ^{a, A}	79.7 ± 0.6 ^{b, B}	117.3 ± 2.5 ^{c, C}
4	76 ± 1 ^{a, A}	81.7 ± 0.6 ^{b, B}	131.7 ± 2.9 ^{c, D}
5	77.3 ± 1.5 ^{a, B}	80.1 ± 1.2 ^{a, B}	153.3 ± 2.9 ^{b, E}
6	76 ± 1 ^{a, A}	80.3 ± 0.6 ^{b, B}	158 ± 3.5 ^{c, E}
7	79 ± 1 ^{a, C}	81.1 ± 1.2 ^{a, B}	167 ± 5.8 ^{b, F}
Respiratory rate (bpm)
0	15 ± 1.5 ^{a, A}	15 ± 0.1 ^{a, A}	15 ± 1.8 ^{a, A}
1	15 ± 1 ^{a, A}	14.7 ± 0.6 ^{a, A}	15.3 ± 0.6 ^{a, A}
2	17.7 ± 0.6 ^{a, B}	19.7 ± 0.6 ^{b, B}	19.7 ± 0.6 ^{b, B}
3	19.3 ± 1.2 ^{a, C}	21.7 ± 0.6 ^{b, C}	29.7 ± 0.6 ^{c, C}
4	19.7 ± 0.6 ^{a, C}	25.3 ± 0.6 ^{b, D}	39.3 ± 1.2 ^{c, D}
5	20.1 ± 0.6 ^{a, D}	25.6 ± 0.6 ^{b, D}	44.7 ± 0.6 ^{c, E}
6	21.3 ± 1.2 ^{a, D}	29.3 ± 1.2 ^{b, E}	47.3 ± 1.2 ^{c, F}
7	21.7 ± 0.6 ^{a, D}	30.1 ± 1.2 ^{b, E}	49.3 ± 1.2 ^{c, F}
Capillary refilling time (seconds)
0	1.5 ± 0.1 ^{a, A}	1.5 ± 0.1 ^{a, A}	1.5 ± 0.1 ^{a, A}
1	1.5 ± 0.1 ^{a, A}	1.5 ± 0.1 ^{a, A}	1.5 ± 0.1 ^{a, A}
2	1.5 ± 0.1 ^{a, A}	1.5 ± 0.1 ^{a, A}	1.5 ± 0.1 ^{a, A}
3	1.5 ± 0.1 ^{a, A}	1.7 ± 0.1 ^{a, b, B}	1.8 ± 0.2 ^{b, B}
4	1.5 ± 0.1 ^{a, A}	1.7 ± 0.1 ^{b, B}	2.1 ± 0.1 ^{c, C}
5	1.5 ± 0.1 ^{a, A}	1.7 ± 0.1 ^{a, B}	2.8 ± 0.3 ^{b, D}
6	1.5 ± 0.1 ^{a, A}	1.9 ± 0.1 ^{b, C}	3.2 ± 0.2 ^{c, E}
7	1.5 ± 0.1 ^{a, A}	2 ± 0.1 ^{b, D}	3.4 ± 0.2 ^{c, F}

Open in a new tab

Values presented as mean ± SD (n = 3). Small letters (a, b, c) mean significant difference between groups at P ≤ 0.05, while capital letters (A, B, C, D, E, F) mean significant difference between time points (1-7th day postdosing) at P ≤ 0.05. Notes: normal temperature in dogs: 37-38.8 °c, heart rates: 80–160 bpm, respiratory rates: 15–30 bpm, capillary refilling time: < 2 s

Radiological and ultrasonographic examinations

No obvious radiological changes in thoracic radiograph in the control group, while mild to moderate degree of pleural effusion manifested by thin radio dense line accumulated between the caudal and accessory lobes of the lungs was noticed in group receiving either 50 or 100 ppm ZnO NPs. Additionally, both ZnO NPs receiving groups showed a vascular pattern of pneumonia in which the pulmonary vessels became more visible as it engorged with blood along with a change of size, form, and direction. Moreover, a severe bronchial pattern of pneumonia which appeared as a ring-like shadow with tramline-like appearance was observed in the group receiving 100 ppm ZnO NPs. On the other hand, there were no obvious radiological changes observed in the abdominal radiography of both ZnO NPs receiving groups compared with the control group (Fig. 2)

Fig. 2 — Radiographic examination of dogs in various groups. (a-c) Left lateral thoracic radiograph representing, (a) control group has normal lung and cardiac silhouette. (b & c) groups receiving 50 and 100 mg ZnO NPs, respectively, showed mild to moderate radiographic changes. Note: pleural effusion (white arrow), vascular pattern of pneumonia (yellow arrow), bronchial pattern of pneumonia (blue arrow). (d-f) Normal abdominal radiograph of all ZnO NPs receiving groups

The abdominal ultrasonographic examination of dogs in the control group showed normal homogenous parenchymal echogenicity of the liver with smooth capsule and regular contour. Moreover, the spleen had a uniform echotexture appearance of the head, body and tail and appeared slightly more hyperechoic than the liver. Additionally, the kidney appeared bean-shaped with smooth well-defined contour, and a thin linear hyperechoic renal capsule. On the other side, the abdominal ultrasonography of both ZnO NPs receiving groups showed moderate to marked alteration in the liver, spleen, and kidneys. The liver appeared heterogenous with parenchymal echogenicity and, thick and irregular capsule. The spleen also appeared heterogenous and slightly more hypoechoic than the liver besides the echotexture appearance of the head, body, and tail. The kidney had an ill-defined irregular contour with a thick hyperechoic renal capsule (Fig. 3).

Fig. 3 — Abdominal ultrasonography of dogs in various groups. (a-c) Dog in the control group showed normal appearance of liver, spleen, and kidneys. (d-f) Dog receiving 50 ppm ZnO NPs, and (g-i) dog receiving 100 ppm ZnO NPs displayed various changes in some organs. Note: heterogenous liver with parenchymal echogenicity and severe thick capsule (yellow arrow), heterogenous hypoechoic spleen with echotexture appearance of the head, body, and tail (white arrow), kidney with thick hyperechoic capsule and ill-defined parenchyma (blue arrow)