Abstract
Human herpesvirus 8 is associated with all forms of Kaposi's sarcoma, AIDS-associated body cavity-based lymphomas, and some forms of multicentric Castleman's disease. Herpesvirus 8, like other gammaherpesviruses, can establish a latent infection in which viral genomes are stably maintained as multiple episomes. The latent nuclear antigen (LANA or LNAI) may play an essential role in the stable maintenance of latent episomes, notably by interacting concomitantly with the viral genomes and the metaphase chromosomes, thus ensuring an efficient transmission of the neoduplicated episomes to the daughter cells. To identify the regions responsible for its nuclear and subnuclear localization in interphase and mitotic cells, LNAI and various truncated forms were fused to a variant of green fluorescent protein. This enabled their localization and chromosome binding activity to be studied by low-light-level fluorescence microscopy in living HeLa cells. The results demonstrate that nuclear localization of LNAI is due to a unique signal, which maps between amino acids 24 and 30. Interestingly, this nuclear localization signal closely resembles those identified in EBNA1 from Epstein-Barr virus and herpesvirus papio. A region encompassing amino acids 5 to 22 was further proved to mediate the specific interaction of LNA1 with chromatin during interphase and the chromosomes during mitosis. The presence of putative phosphorylation sites in the chromosome binding sites of LNA1 and EBNA1 suggests that their activity may be regulated by specific cellular kinases.
The human herpesvirus 8 (HHV-8), also called Kaposi's sarcoma-associated herpesvirus, is a gamma-2 herpesvirus (rhadinovirus) that is associated with all forms of Kaposi's sarcoma (2, 10, 15, 23, 31, 42), with primary effusion or AIDS-associated body cavity-based lymphomas (8, 33), and with some cases of multicentric Castleman's disease (14, 46).
HHV-8, like its closest known relative in humans, Epstein-Barr virus (EBV), can persist in a latent form in most tumor cells and lymphoma-derived cell lines (reviewed in reference 43). In these cells, multiple copies of the viral genome are stably maintained as covalently closed circular molecules (9, 13, 39–41). For EBV it is well established that only one viral protein, EBNA1, is required for the viral episomes to be maintained over long periods in dividing cells (26, 29). In conjunction with the latent origin of replication (oriP) to which it binds, EBNA1 would prevent the loss of neoduplicated episomes during mitosis by tethering the viral genomes to the cellular chromosomes (reviewed in reference 28). There is no sequence homology between any known or putative HHV-8 proteins and EBNA1 (41). However, recent studies have suggested that the latent nuclear antigen (LNA1) is encoded by open reading frame 73 (ORF73) (22, 24, 38) may be functionally analogous to EBNA1. Indeed, LNA1 associates with metaphase chromosomes and colocalizes with the viral genomes both in interphase nuclei and on mitotic chromatin (4, 12, 47). In addition, it binds specifically to an OriP-like-containing region located near the 5′ end of the genome and allows the stable maintenance of plasmids that contain this region (4, 12).
To date, only a few studies have investigated the structural and functional aspects of LNA1. In the reference strain BC-1, LNA1 is 1,162 amino acids long (41) and has an apparent molecular mass of 224 to 234 kDa on sodium dodecyl sulfate (SDS)–8% polyacrylamide gels (38). However, its size varies greatly among HHV-8 isolates, mainly because of variations in length that affect a large internal acidic domain (18, 19, 35, 38, 51). LNA1 has recently been shown to bind to and inactivate the tumor suppressor p53 gene product (16). In addition, it can act as a transcriptional repressor when targeted to constitutively active promoters (44), a least in part by tethering of an mSin3-containing corepressor complex (25). Taken together, these data suggest that LNA1 can act as a transcriptional regulator, a function that may play a role in HHV-8-mediated oncogenesis. LNA1 also interacts with RING3, a cellular protein that may mediate a specific phosphorylation of the LNA1 C terminus (37), and with histone H1, a possible partner of LNA1 on mitotic chromosomes (12).
The aim of the present work was to identify the region(s) of LNA1 that is important for its association with mitotic chromosomes. Since nuclear targeting was assumed to be a preliminary condition for this interaction to occur, studies were conducted to identify the LNA1 nuclear localization signal (NLS). For this purpose, we investigated the cellular and subcellular localization of LNA1 and various truncated forms fused to a variant of the green fluorescent protein with enhanced fluorescence (EGFP) by using low-light-level fluorescence microscopy in living HeLa cells. A short basic N-terminal sequence comprising amino acids 1 to 32 was proven to be essential both for nuclear localization and chromosome binding. Further experiments indicated that the LNA1 NLS was localized between amino acids 24 to 30 whereas the unique chromosome binding site (CBS) of LNA1 mapped between amino acids 5 and 22. Interestingly, this CBS was required for LNA1 to colocalize with chromatin during interphase. These results are discussed with regard to their possible implication for our understanding of LNA1 functions that are related to the stable maintenance of latent episomes.
MATERIALS AND METHODS
Cell lines.
BBG1 is a malignant B-cell line established from the blood of a human immunodeficiency virus-infected patient presenting with a cutaneous B-cell lymphoma, in which both EBV and HHV-8 were detected (32). BBG1 cells were grown in RPMI 1640 medium supplemented with 10% fetal calf serum, streptomycin (105 U/liter), vancomycin (0.1 g/liter), and glutamine (2 mM). The human epithelial cell line HeLa (ATCC CCL2) was grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, streptomycin (105 U/liter), vancomycin (0.1 g/liter), and glutamine (2 mM).
Plasmids.
pEGFP-CI and pEGFP-NI (Clontech), encoding EGFP, were used to express LNA1 and its various derivatives fused to the N terminus (pEGFP-NI) or the C terminus (pEGFP-CI) of EGFP. A 3,127-bp PCR product containing the entire ORF73 coding region was generated from BBG1 DNA by high-fidelity PCR using Pwo DNA polymerase (Roche) and primers ORF73G1 and ORF73G2 (Table 1). This PCR product was cloned in frame with EGFP in pEGFP-NI digested by SmaI. The resulting plasmid, pEGFP-NI-LNA, was used as a template to generate the following deletion mutants by PCR using the Pwo DNA polymerase and the primers indicated in parentheses: 73B (73B BamHI and 73B HindIII), K7 (LNA1241 KpnI and LNA1090 BglII), K3 (LNA2 KpnI and LNA854 BglII), K4 (LNA2 KpnI and LNA438 BglII), 73A (73A BglII and 73A HindIII), K5 (LNA2 KpnI and LNA216 BglII), K10 (LNA2 EcoRI and LNA189 KpnI), K6 (LNA2 KpnI and LNA100 BglII), K8 (LNA2 EcoRI and LNA45 KpnI), K9 (LNA2 EcoRI and LNA15 KpnI), K14 (LNA46 EcoRI and LNA1090 BglII), and K15 (LNA33 KpnI and LNA1090 BglII). The resulting PCR products were cloned into pEGFP-CI. pEGFP-CI-LNA was constructed by introducing the PCR product generated with primers LNA2 EcoRI and LNA189 KpnI within the plasmid encoding mutant K7.
TABLE 1.
Primers used for the constructs in this study
| Primer | Sequence (5′→3′) |
|---|---|
| ORF73G1 | p-AGACCAGATTTCCCGAGGATGGCG |
| ORF73G2 | p-ATGTCATTTCCTGTGGAGAGTCCC |
| 73B BamHI | GGATCCTCATCCGAGGACG |
| 73B HindIII | GAAGCTTTTATGTCATTTCCTGTGG |
| LNA1241 KpnI | GACTCTTTAGGTACCTCTACCCTG |
| LNA1090 BglII | GGCGACCGGAGATCTCATGTCATTTC |
| LNA2 KpnI | GCGGGCCCAGACCAGGTACCCCGAGGATGGCGCC |
| LNA854 BglII | GCTGCTGCAGATCTACCCCCTG |
| LNA438 BglII | CTGCTGTTGAGATCTTTGGATGCTCAA |
| 73A BglII | CAGATCTGCATGCGAGCTCGGTACCCCGGGAATGCGCCTGAGG |
| 73A HindIII | GAAGCTTGTCAACCTGACT |
| LNA216 BglII | GGGCGACTGAGATCTTGGGTTTAG |
| LNA2 EcoRI | CTGCAGAAGAATTCCCCGAGGATGGCGCCCCG |
| LNA189 KpnI | CTGCAGAAGGTACCCGGAGCTAAAGAGTCTGG |
| LNA100 BglII | TGGAGGTAAAGATCTTGCGGG |
| LNA45 KpnI | CTGCAGAAGGTACCGTCGGCGACATGCTTCCTTCG |
| LNA15 KpnI | CTGCAGAAGGTACCTCTTTCCGGAGACCTGTTTCG |
| LNA46 EcoRI | CTGCAGAAGAATTCTTCCGTCGACGGCCGGGAATGTGG |
| LNA33 KpnI | ACTGCCGGGTACCTGTGACCTTGGCGATGACCTACATCTACAAC |
| NLS S | GATCTCCTAAGAAAAAGAAAGGTAGATGCG |
| NLS AS | AATTCGCATCTACCTTTCTTTTTCTTAGGA |
| K11 S | CATGGCGCCCCCGGGAATGCGCCTGAGGTCGGGACGGAGCACCGGCTGAG |
| K11 AS | CTCAGCCGGTGCTCCGTCCCGACCTCAGGCGCATTCCCGGGGGCGCCATGGTAC |
| K12 S | CGGCGCGCCCTTAACGAGAGGAAGTTGTAGGAAACGAAACAGGTCTCCGGAAAGATGAG |
| K12 AS | GATCCTCATCTTTCCGGAGACCTGTTTCGTTTCCTACAACTTCCTCTCGTTAAGGGCGCGCCGGTAC |
| K13 S | CTGTGACCTTGGCGATGACCTACATCTACAACCGCGAAGGAAGCATGTCGCCGACTCCGTCTGAG |
| K13 AS | GATCCTCAGACGGAGTCGGCGACATGCTTCCTTCGCGGTTGTAGATGTAGGTCATCGCCAAGGTCACAGGTAC |
| K16 S | AATTCTGGAATGCGCCTGAGGTCGGGACGGAGCACCGGCGCGCCCTTAACGAGAGGATCCGGTAC |
| K16 AS | CGGATCCTCTCGTTAAGGGCGCGCCGGTGCTCCGTCCCGACCTCAGGCGCATTCCAG |
| K17 S | p-GAAAGATGTGACCTTGGC |
| K17 AS | p-ACAACTTCCTCTCGTTAAGGG |
| LNA280 KpnI | TTCTTCTGGTACCTCCGCAAGGAGCAC |
| LNA 20–32 S | p-CTAGAGGATCCTGTAGGAAACGAAACAGGTCTCCGGAAAGGGTAC |
| LNA 20–32 AS | p-CCTTTCCGGAGACCTGTTTCGTTTCCTACAGGATCCTCTAGGTAC |
| LNA 1–15 S | CCATGGCGCCCCCGGGAATGCGCCTGAGGTCGGGACGGAGCACCGGGGTAC |
| LNA 1–15 AS | CCCGGTGCTCCGTCCCGACCTCAGGCGCATTCCCGGGGGCGCCATGGGTAC |
| HEPTA S | CCAGGAAACGAAACAGGTCTCCGGTAC |
| HEPTA AS | CGGAGACCTGTTTCGTTTCCTGGTAC |
| LNA1 KpnI | GATCGGGGTACCAGATTTCCCGAGGATGGCGCC |
| LNA32 KpnI | ACTGCCGGGTACCCTTTCCGGAGACCTGTTTCG |
| L7K280 | AGCCAGGGGGGTACCTCGTG |
| L7K411 | TCTAGATCCGGTGGTACCCC |
The following constructs were generated by inserting the indicated synthetic linkers into pEGFP-CI: EGFP-NLS, which encodes EGFP fused to the NLS of simian virus 40 (SV40 T) antigen (T.NLS) (NLS S and NLS AS), K11 (K11 S and K11 AS), K12 (K12 S and K12 AS), K13 (K13 S and K13 AS), and K16 (K16 S and K16 AS). NLS-K7 was obtained by cloning the linker NLS S and NLS AS downstream of the region encoding EGFP in K7. The mutant K8-K7 was obtained by subcloning the EcoRI-KpnI insert from mutant K8 into K7. Similarly, K9-K7 resulted from subcloning of the EcoRI-KpnI insert from K9 into K7. K2 was generated by subcloning the BamHI-BamHI fragment from pEGFP-NI-LNA into pEGFP-CI digested by BamHI. NLS-K15 was obtained by cloning the PCR product generated from pEGFP-NI-LNA with primers LNA33 KpnI and LNA1090 BglII in EGFP-NLS. K16-K15 and K16-K7 were obtained by inserting the linker K16 S and K16 AS downstream of the region encoding EGFP in K15 and K7, respectively. K17 was obtained by simultaneously cloning two PCR products, generated with primers K17 AS and LNA2 KpnI and primers K17 S and LNA280 KpnI, into the construct encoding mutant K7 between the KpnI and BamHI sites.
Most plasmids used for the β-galactosidase assays were derived from pcDNA3.1-hisB-LacZ (Invitrogen) following insertion, at the KpnI site, of linkers encoding LNA1 amino acids 1 to 15 (mutant N2) (LNA 1–15 S and LNA 1–15 AS), 20 to 32 (mutant N3) (LNA 20–32 S and LNA 20–32 AS), and 24 to 30 (mutant N4) (HEPTA S and HEPTA AS). A PCR product encoding amino acids 1 to 32 was generated with primers LNA1 KpnI and LNA32 KpnI and cloned at the KpnI site into pcDNA3.1-hisB-LacZ (mutant N1). L7 encoded the EBNA1 NLS fused to β-galactosidase. This construct was obtained by cloning a PCR product (L7K280 and L7K411) generated from pEGFP-EBV-EBNA1 (30) into pcDNA3.1-hisB-LacZ at the KpnI site.
Plasmid DNA was purified using the plasmid Maxi kit (Qiagen).
DNA sequencing was performed by automated sequencing using the dideoxynucleotide chain termination method as recommended by the manufacturer (ABI Prism dRhodamine Terminator Cycle Sequencing Ready Mix; Applied Biosystems).
Sequence analyses were performed with Sequence Navigator version 1.0.1 (Perkin-Elmer). The sequences were aligned using Clustal W (49). DNA tandem repeats in ORF73 were located with Tandem Repeats Finder (http://c3.biomath.mssm.edu/trf.html) (5).
Transfections.
HeLa cells were grown in six-well plates until they reached approximately 80% confluence. A 1-μg portion of purified plasmid DNA and 8 μl of LipofectAMINE (Life Technologies) were used for each transfection as recommended by the manufacturer. The DNA-LipofectAMINE complex was overlaid on the cells, which were then incubated at 37°C for 5 h in serum- and antibiotic-free Dulbecco's modified Eagle's medium. The cells were then washed before being incubated for another 12 to 24 h in the presence of culture medium supplemented with 10% fetal calf serum.
Fluorescence microscopy at low light levels.
Epifluorescence microscopy imaging was carried out at room temperature on living cells, using very low excitation light levels to prevent cell damage. HeLa cells were grown on coverslips (diameter, 32 mm; Bachofer) and transfected as described above. The cells were incubated with Hoechst 33342 (0.1 μg/ml) for 15 min at 37°C. After being washed, the coverslips were mounted on a thermostatted holder for direct microscopic observation in the presence of prewarmed phenol red-free medium. Cells were viewed through an Ultrafluor objective (magnification, ×100; NA = 1.3) on an inverted microscope (Leica DMIRBE). The detector was a cooled slow-scan charge-coupled device camera with 1,024 by 1,024 pixels, digitized on 4,096 gray levels (S1-8M; SILAR, St. Petersburg, Russia). The excitation was provided by a 50-W high-pressure mercury lamp. For low excitation light levels, a neutral-density filter with optical density of 1 was placed on the excitation path. For Hoechst 33342 fluorescence, the maximum excitation wavelength was 365 nm and the emission wavelengths were between 425 and 495 nm. For EGFP fluorescence, the maximum excitation wavelength was 436 nm and the emission wavelengths were between 515 and 560 nm. Image processing was carried out as described previously (11), by using Khoros software (Khoral Research, Albuquerque, N.M.) running on a Sun Microsystems workstation. The images were displayed over 256 gray levels in false color (blue for Hoechst 33342 fluorescence images, green for EGFP fluorescence images).
Western blot analysis.
Western blot analyses were performed 24 h after transfection as previously described (30), except that total proteins were separated on an SDS–8% polyacrylamide gel in a Tris-Tricine buffer system by the procedure described by Gallagher (17). EGFP-fused proteins were detected with a 1:1,000 dilution of the mouse JL-8 monoclonal antibody (Clontech) and a 1:10,000 dilution of a peroxidase-conjugated anti-mouse immunoglobulin G polyclonal antibody (Amersham Pharmacia Biotech). Protein was detected by chemiluminescence as recommended by the manufacturer (ECL Western blotting detection reagents; Amersham Pharmacia Biotech).
Histochemical staining.
HeLa cells were grown on coverslides and transfected by the various β-galactosidase-encoding constructs as described above. At 24 h after transfection, the cells were briefly rinsed and fixed in 2% formaldehyde–0.2% glutaraldehyde in phosphate-buffered saline for 15 min. The staining solution was prepared immediately before use by diluting the X-Gal stock solution (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside, 20 mg/ml in dimethylformamide) 1:20 in the salt mix solution [4 mM K3Fe(CN)6, 4 mM K4Fe(CN)6 · 3H2O, and 2 mM MgCl2 · 6H2O in phosphate-buffered saline (pH 7.4)]. The cells were washed three times with phosphate-buffered saline and incubated with the staining solution for 1 to 3 h at 37°C. After a further three washes with the buffer, the cells were observed under a light microscope (Axioskop 20; Zeiss).
Nucleotide sequence accession number.
The sequence of ORF73 from BBG1 has been deposited with GenBank and has been assigned accession number AF305694.
RESULTS
Cloning and characterization of ORF73 from BBG1.
Only a few full-length sequences for HHV8 ORF73 were available at the time this study was initiated. Since sequence variability can provide important information regarding the putative functional domains of a protein, we isolated and analyzed the LNA1 coding region (ORF73) from a recently characterized B-cell line that is dually infected by EBV and HHV-8 (32). The ORF73 gene was obtained by high-fidelity PCR from purified DNA. Following analysis by agarose gel electrophoresis, a unique PCR product was observed (data not shown). Since ORF73 varies greatly in size from one isolate to another, this result indicated that BBG1 was infected by a single HHV-8 variant. The PCR product was gel purified and cloned in frame with the N terminus of EGFP in pEGFP-NI, and the resulting plasmid, pEGFP-NI-LNA, was fully sequenced in the region encoding the fusion protein. Since some artifactual mutations may have arisen during the PCR and cloning procedures, two independent gel-purified PCR products were also fully sequenced. All three sequences were identical and were deposited with GenBank.
In BBG1, ORF73 encodes a putative 1,036-amino-acid polypeptide. The sequence was compared both at the nucleotide and at the amino acid levels with the three other full-length sequences that were available. The first of these was from the prototypic BC1 cell line (GenBank U75698), and the other two, KS1 (GenBank U93872) and KS2 (GenBank AF148805), were obtained from DNA libraries generated from two Kaposi's sarcoma biopsy specimens (19, 35, 41).
Sequence alignment showed that LNA1 could be divided into two conserved regions, spanning amino acids 1 to 337 (the unique left region) and 798 to 1036 (the unique right region), that are separated by an internal region composed mainly of a limited number of repeated motifs. Nucleotide alignments revealed that only four nucleotide positions were variable in the unique left region whereas the unique right region was perfectly conserved (Table 2). This contrasts with the high variability observed in the central acidic domain, both at the nucleotide and at the amino acid levels. The region encoding amino acids 338 to 797 is composed of a series of short conserved tandem repeats whose number is characteristic of each HHV-8 isolate (Fig. 1). This region is interrupted by a conserved nonrepeated sequence (the unique central region) encompassing amino acids 439 to 452.
TABLE 2.
Sequence variation in the unique left region of LNA1
| Nucleotide positiona | Sequence of ORF73 in isolateb:
|
|||
|---|---|---|---|---|
| BC1 | BBG1 | KS1 | KS2 | |
| 154 | Atc (I) | Gtc (V) | Gtc (V) | Gtc (V) |
| 195 | ccT (P) | ccA (P) | ccA (P) | ccA (P) |
| 262 | Ccc (P) | Tcc (S) | Ccc (P) | Ccc (P) |
| 827 | tGg (W) | tCg (S) | tGg (W) | tGg (W) |
Nucleotide position refers to the sequence of ORF73 in BC1. Note that the positions are identical in BC-1, KS1, KS2, and BBG1 (see the text).
The variable nucleotide is capitalized for each codon, and the resulting amino acid is specified in parentheses.
FIG. 1.
Organization of the central acidic region of LNA1. Sequence alignments of the central acidic region of LNA1 from BC1, BBG1, KS1 and KS2 (see the text) were performed with Clustal W, and tandem repeats were located with Tandem Repeats Finder. The position of the amino acids is given for LNA1 from BBG1. The corresponding positions in LNA1 from BC1 are indicated in parentheses. The unique central region is shaded. Each repeat is delimited by brackets. The leucine residues that have been proposed to be involved in a leucine zipper structure are underlined.
Nuclear and subnuclear localization of LNA1.
Previous studies have shown that LNA1 is localized in the nuclei of latently infected cells and that it interacts with the border of heterochromatin during interphase and with chromosomes during mitosis (4, 12, 47, 48). To identify the regions of LNA1 that are responsible for its nuclear and subnuclear distribution, we analyzed the localization of LNA1 and truncated forms fused to the EGFP by means of low-light-level fluorescence microscopy of living HeLa cells. This procedure allowed the detection of EGFP-fused polypeptides in living cells even when the expression level was low and with limited damage to the cells.
For this purpose, ORF73 was cloned in frame with either the N terminus (pEGFP-NI-LNA) or the C terminus (pEGFP-CI-LNA) of the EGFP. The expression of the fusion proteins was assessed by Western blot analysis using a monoclonal antibody directed against EGFP (Fig. 2). As shown in Fig. 2, pEGFP-NI-LNA encoded a large polypeptide that migrated with an approximate molecular mass of 176 kDa, which was slightly higher than expected (146 kDa). This phenomenon has already been observed for the native LNA1 and is probably related to the presence of the central acidic region. pEGFP-CI-LNA gave rise to a protein of comparable mobility in SDS-polyacrylamide gel electrophoresis. In both cases, several EGFP-tagged polypeptides whose molecular mass ranged from 27 to 53 kDa were observed, suggesting that LNA1 may be subjected to multiple proteolytic cleavages at both its N and C termini. However, since high-molecular-weight proteins were detected for both EGFP-LNA1- and LNA1-EGFP-encoding constructs, it can be deduced that proteolysis was only partial.
FIG. 2.
Immunoblot analysis of LNA1 and representative truncated forms fused to EGFP. HeLa cells were transfected with constructs encoding EGFP-EBNA1, K7 (LNA1 amino acids 194 to 1036), NLS-K15 (LNA1 amino acids 33 to 1036 fused to the SV40 T.NLS), LNA1-EGFP, and EGFP-LNA1. The cells were collected 24 h after transfection, and 25 μg of total protein extract was subjected to SDS-polyacrylamide gel electrophoresis (8% polyacrylamide) with a Tris-Tricine buffer system. Immunoblotting was performed with a monoclonal antibody directed against EGFP. A major band of 176 kDa was detected for the constructs encoding LNA1-EGFP and EGFP-LNA1 (thick arrow). Smaller polypeptides were also detected for these constructs, indicating that there might be partial proteolysis of LNA1 in its N and C termini (thin arrows).
Microscopic analysis indicated that EGFP diffused freely both in the cytoplasm and in the nucleus of HeLa cells whereas LNA1-EGFP and EGFP-LNA1 accumulated in the nucleus (Fig. 3). Both proteins largely, but not exclusively, colocalized with the chromatin. Indeed, LNA1-EGFP and EGFP-LNA1 were occasionally concentrated within nuclear foci that did not colocalize with the Hoechst 33342 staining.
FIG. 3.
Localization of EGFP and various derivatives of LNA1 fused to EGFP in living HeLa cells. HeLa cells were transiently transfected by constructs encoding EGFP and various derivatives of LNA1 fused to EGFP. Chromatin was stained with Hoechst 33342. The fluorescence of EGFP (green) and Hoechst 33342 (blue) was observed by low-light-level fluorescence microscopy 24 h after transfection.
To identify LNA1 regions that are required for its nuclear and possibly subnuclear localization, several truncated forms of LNA1 were tested for their ability to target EGFP in the nucleus (Fig. 4). The proper expression of the fusion proteins was assessed by Western blot analysis for all constructs (Fig. 2 and data not shown). Surprisingly, initial experiments indicated that both the N terminus and the C terminus of LNA1 might contain functional NLS. Indeed, a mutant encoding amino acids 816 to 1036 (mutant 73B) was strictly nuclear, although its theoretical molecular mass (52.2 kDa) was slightly higher than the limit for passive diffusion through the nuclear pore (6). However, the putative NLS that localized in the C terminus of LNA1 was unlikely to be required for LNA1 nuclear targeting for at least two reasons: mutants K2 and K7 were strictly cytoplasmic, and a large deletion that removed amino acids 800 to 1036 did not prevent nuclear accumulation of mutant K3. Rather, this would suggest that one or several NLS are located between amino acids 1 and 799. Further analysis indicated that the region encompassing amino acids 1 to 32 contains a sequence that is essential for the proper nuclear localization of LNA1. First, deletion of amino acids 1 to 32 totally abrogated nuclear localization, as indicated by the cytoplasmic localization of mutant K15, although nuclear targeting could be restored by the addition of the well-characterized NLS of the SV40 large T antigen (T.NLS) (21) (mutant NLS-K15). Second, amino acids 1 to 32 could restore the nuclear localization of mutant K7, which is otherwise cytoplasmic (mutant K9-K7). Third, amino acids 1 to 32 were able to target the EGFP to the nucleus (mutant K9). Since mutant K9 has an approximate molecular mass of 32.8 kDa, it might be argued that its nuclear localization results exclusively from passive diffusion through the nuclear pore and subsequent retention within the nucleus. However, this argument is not valid since amino acids 1 to 32 were also able to target β-galactosidase, a heterologous cytoplasmic protein, to the nucleus, which confirmed that this region contained a functional NLS (mutant N1) (Fig. 5).
FIG. 4.
Structure, nuclear localization, and chromosome binding activity of LNA1 and derivatives fused to EGFP. The structures of the various truncated forms of LNA1 that were fused to EGFP are indicated. The nuclear (N) or cytoplasmic (C) localization of the fusion proteins expressed in HeLa cells and their interaction with mitotic chromosomes were analyzed by low-light-level fluorescence microscopy in living cells. Note that EGFP and K7 fused to the SV40 T.NLS were mainly but not exclusively nuclear. When detected, binding to chromosomes was observed in all mitotic cells, independent of the expression level of the fusion protein, except for mutant K11, which exhibited binding in less than 1 of 30 transfected cells.
FIG. 5.
Identification of the LNA1 NLS. (A) Several regions derived from the N terminus of LNA1 were tested for their ability to translocate β-galactosidase into the nucleus. The NLS is boxed. The CBS of LNA1 is shaded (see the text). (B) Histochemical staining of HeLa cells transfected by LNA1 derivatives fused to β-galactosidase. Note the cytoplasmic localization of β-galactosidase and the nuclear localization of β-galactosidase fused to the NLS of EBV EBNA1 (L7). The LNA1 NLS mapped between amino acids 24 and 30. (C) Alignment of the NLS (boxed) identified in LNA1 from HHV-8 and EBNA1 from EBV and herpesvirus papio (HVP). Identical amino acids are shadowed.
Although no true consensus sequence has been defined for NLS, most of the well-characterized simple signals appear to have common properties. Notably, they are localized at the surface of the protein and the core NLS is often a hexapeptide or heptapeptide with three to five positively charged amino acids flanked by a proline or a glycine at the N-terminal side, although it sometimes contains an internal proline (6). Amino acids 1 to 32 contained two short basic sequences (7-RLRSGR-12 and 24-RKRNRSP-30) that partly meet these criteria. As shown in Fig. 5, only the region encompassing amino acids 20 to 32, and especially the heptapeptide 24-RKRNRSP-30, could induce the nuclear translocation of β-galactosidase (mutant N4). Since a deletion that removed only amino acids 24 to 30 resulted in a protein that was cytoplasmic (mutant K17), it was concluded that LNA1 contained a unique simple N-terminal NLS. Moreover, sequence analysis indicated that LNA1 NLS closely resembles the NLS of EBNA1 in EBV and herpesvirus papio (Fig. 5C; also see Fig. 7) (1, 50).
FIG. 7.
Comparison of the CBS and NLS from HHV-8 LNA1, EBV, EBNΔ1, and herpesvirus papio (HVP) EBNA1. The CBS are shadowed, and the NLS are boxed. The PROSITE database with PROSITE SCAN (http://www.isrec.isb-sib.ch/software/PSTSCAN_form.html) was used to search for putative phosphorylation sites (3).
In the course of this study, it was observed that truncation mutants of LNA1 exhibited striking differences in their subnuclear localization. Notably, amino acids 1 to 32 conferred the ability of the fusion proteins to colocalize with the chromatin in interphase cells (mutant K9), as shown by Hoechst 33342 counter-staining. In contrast, a deletion that removed amino acids 1 to 32 from a nearly complete nuclear LNA1 (NLS-K15) induced the protein to form local foci that did not colocalize with chromatin. As illustrated by mutant 73B, this specific pattern appeared to be related to the presence of the C terminus of LNA1 (Fig. 4). Since LNA1-EGFP and EGFP-LNA1 were previously shown to associate both with dense chromatin and with non-chromatin-associated foci, these results suggested that both the C terminus and the N terminus might independently contribute to LNA1 subnuclear localization in interphase cells.
Mapping of the LNA1 domains involved in binding to mitotic chromosomes.
To obtain information concerning the molecular basis of LNA1 interaction with mitotic chromosomes, we attempted to map the LNA1 domain(s) responsible for binding to mitotic chromosomes by investigating the ability of EGFP-fused mutants of LNA1 to interact stably with human chromosomes during mitosis. Similar experiments previously conducted in our laboratory (30) led to the conclusion that this kind of interaction can be highly sensitive to experimental procedures. Therefore, in this study the interaction of LNA1 with mitotic chromosomes was investigated by a procedure that allows the direct observation of EGFP-fused proteins in living mitotic cells by low-light-level fluorescence microscopy. To assess the binding, more than 30 mitotic transfected cells which expressed either high or low levels of the fusion protein were analyzed for each construct, and each experiment was repeated at least three times. When detected, the binding to mitotic chromosomes was observed in all transfected cells, except for mutant K11 (see below).
LNA1 interacted with the mitotic chromosomes in HeLa cells whether EGFP was fused to its N or C terminus (Fig. 6). Importantly, LNA1 binding was observed in cells expressing either high or low levels of the fusion protein. As shown in Fig. 4, a main chromosome-binding site was mapped to the N terminus of LNA1, between amino acids 1 and 32. Indeed, mutant K9 bound mitotic chromosomes as efficiently as the full-length protein did, and a deletion that affected this region totally abrogated the binding (mutant K15). Since amino acids 1 to 32 had been found to carry the LNA1 NLS, the lack of binding for mutant K15 could be related to the cytoplasmic localization of this mutant. Consequently, we also evaluated the binding of K15 following insertion of the SV40 NLS. The resulting construct encoded a nuclear protein (NLS-K15) that was unable to bind to mitotic chromosomes (Fig. 6). Western blot experiments confirmed that NLS-K15 migrated with the expected molecular mass in SDS polyacrylamide gel electrophoresis, demonstrating that the lack of binding could not be attributable to a proteolytic cleavage of the fusion protein that would have released only free EGFP (Fig. 2). This result was consistent with the lack of binding observed with several N-terminally truncated, albeit nuclear, forms of LNA1 such as mutants 73B and NLS-K7 (Fig. 4 and 6).
FIG. 6.
Analysis of the interaction of EGFP-LNA1 and EGFP-LNA1 derivatives with mitotic chromosomes. HeLa cells were transiently transfected by constructs encoding EGFP and various derivatives of LNA1 fused to EGFP. Chromatin was stained with Hoechst 33342. The fluorescence of EGFP (green) and Hoechst 33342 (blue) was observed by low-light-level fluorescence microscopy 24 h after transfection. Both LNA1-EGFP and EGFP-LNA1 associated with mitotic chromosomes in living HeLa cells. Amino acids 5 to 22 were necessary and sufficient for the binding, since mutant K16 (amino acids 5 to 22) binds as efficiently as the full-length protein whereas no binding was observed for mutant NLS-K15 (amino acids 33 to 1036 fused to the SV40 T.NLS) nor mutant K12 (amino acids 14 to 32 [data not shown]), although the fusion proteins localized in the nuclei of interphase cells.
These experiments demonstrated that LNA1 contains a unique CBS localized between amino acids 1 and 32. Since this region also contains the LNA1 NLS, the possibility was raised that nuclear targeting and binding to mitotic chromosomes were functionally related. As indicated in Fig. 4, a mutant encoding EGFP fused to amino acids 1 to 15 (K11) accumulated in the nucleus, although it did not contain an NLS. However, association of K11 with mitotic chromosomes was observed in fewer than 1 of 30 mitotic transfected cells. In addition, binding was reproducibly weak, as indicated by the presence of large amounts of the fusion protein in the nucleoplasm of the cells (data not shown). In fact, the strong binding activity of mutant 73A (amino acids 4 to 323) and the absence of binding activity for mutant K12 (amino acids 14 to 32) suggested that part of the CBS may lie between amino acids 4 and 15 but that maximal binding activity required the presence of other residues localized between amino acids 16 and 32. In agreement with this, a mutant restricted to amino acids 5 to 22 was found to bind to the mitotic chromosomes as efficiently as the full-length protein (mutant K16). Taken together, these data demonstrated that the LNA1 CBS is close to but distinct from the NLS. Importantly, this binding site mapped to a region shown to be involved in the association of LNA1 with interphase chromatin.
It was initially supposed that nuclear localization during interphase is a preliminary condition for the proper association of LNA1 with the chromosomes during mitosis. To test this hypothesis, we analyzed the chromosome binding properties of two cytoplasmically truncated forms of LNA1, K7 and K15, that were fused to the LNA1 CBS. In most instances, no binding could be observed, although the fusion protein was detected in close proximity to mitotic chromosomes. Similar results were also obtained for K17 (data not shown). These results therefore confirmed that LNA1 nuclear localization is required for subsequent interaction with mitotic chromosomes, although the NLS itself does not take part in the interaction.
DISCUSSION
Recent work has shed new light on the molecular processes that ensure the long-term maintenance of viral episomes in dividing cells latently infected by bovine papillomavirus, EBV, and, more recently, HHV-8 (4, 12, 27, 28). It is now considered that a limited number of unrelated viral proteins, i.e., bovine papillomavirus E1 and E2, EBV EBNA1, and HHV-8 LNA1, could intimately link the replication of the viral genomes during the S phase to their segregation during the M phase (4, 7, 12, 45). More especially, an important function of E2 (and possibly E1), EBNA1, and LNA1 would consist of tethering the viral genomes to the cell chromosomes, thus (i) protecting the viral genomes from destruction at the end of mitosis and (ii) possibly controlling the partition of neoduplicated genomes between the daughter cells. Understanding the nature and possible regulation of the binding of these proteins to mitotic chromosomes is therefore crucial.
The aim of the present work was to identify LNA1 functional sites that are responsible for its nuclear and subnuclear localization. For this purpose, we combined the advantages of the fluorescence properties of EGFP in living cells with those provided by low-light-level fluorescence microscopy to identify LNA1 regions that are required for its nuclear localization, interaction with heterochromatin, and association with human chromosomes during mitosis.
A unique NLS mapped within amino acids 24 to 30. The LNA1 NLS is highly homologous to the NLS that have been identified in EBV and herpesvirus papio EBNA1. In particular, these sequences have a phosphorylation site for protein kinase A and a cdc2-type kinase in common (Fig. 7). Since phosphorylation of residues close to or within the NLS has been shown to modify the nuclear import of numerous cellular proteins, this suggests that LNA1 and EBNA1 nuclear transport may be regulated by a similar kinase(s), notably during the course of the cell cycle (6). Our results did not confirm the presence of an NLS in the C terminus of LNA1, as recently proposed (44, 48). Nonetheless, mutant 73B was concentrated in the nucleus, although its calculated molecular mass would predict that it could not freely enter. Two non-mutually exclusive hypotheses can be proposed. First, mutant 73B may be smaller than expected and thus would freely diffuse into the nucleus, where it would be retained by virtue of an interaction with a nuclear protein. In agreement with this assumption, it should be noted that the C terminus of LNA1 is responsible for specific interactions with at least two nuclear proteins, namely, p53 (16) and RING3 (37). Second, mutant 73B may contain a cryptic NLS that is unmasked only in the truncated protein. This is supported by sequence analysis predicting that the short heptapeptide 869-PGVRMRR-875 could function as an NLS (34).
Analyses conducted with mitotic cells confirmed that LNA1 binding to mitotic chromosomes did not require the presence of the viral genomes (4). Further experiments indicated that the LNA1 CBS mapped between amino acids 5 and 22, a region that is also responsible for LNA1 colocalization with interphase chromatin. This observation strongly suggests that interactions are mediated through the same cellular partner. Similar observations were made using the human B-cell line BJAB (T. Piolot and A. Dehee, unpublished data). We are currently investigating the possible interaction of this region with histone H1, a likely partner of LNA1 (12). Although LNA1 and EBNA1 CBS are localized in regions that are rich in basic amino acids, we could not identify significant sequence homologies (30). Similarly, we could not identify homologous domains in LNA1 from the closest relatives of HHV-8, including herpesvirus saimiri. Nevertheless, recent work by Hall et al. has shown that the N terminus of the herpesvirus saimiri ORF73 gene product contained two short basic regions that could target EGFP to the nucleus. Based on our results, it is tempting to speculate that one of these sequences functions as a NLS whereas the other acts as a CBS (20).
Fluorescence microscopy showed that both LNA1-EGFP and EGFP-LNA1 exhibited two distinct localization within the nucleus of living interphase cells. Whereas colocalization of the fluorescence with chromatin was observed in most cells, a punctuated aspect, which was reminiscent of the speckles described with the native protein, was also occasionally observed in the same cells. Deletion analysis strongly suggested that this nuclear sublocalization was due to the presence of a region between amino acids 816 and 1036, which is in agreement with previous work (44). Comparable observations have been made on the LNA1 homologue in herpesvirus saimiri (20). Whether this speckled staining is identical to that observed for the native protein has yet to be determined. In any case, this demonstrated that LNA1 could interact with different nuclear structures during interphase, which raised the question of a possible regulation of the LNA1 interaction with heterochromatin during interphase and mitosis.
Ballestas et al. have provided data indicating that subnuclear localization of LNA1 is altered in the presence of the viral genomes, which suggests that some functional domains may be uncovered and/or activated following LNA1 binding to viral DNA (4). LNA1 functional regulation may also be achieved by other means. Indeed, we noticed that EGFP-tagged LNA1 and derivatives were accompanied by one or several polypeptides of higher mobility in SDS-polyacrylamide gel electrophoresis. Although we are currently investigating the nature and origin of these polypeptides, preliminary results suggest that they may arise from specific and partial proteolysis of LNA1 in its N and C termini. Proteolytic cleavage in the N terminus would separate a region comprising the CBS from the rest of the protein, whereas specific cleavages in the C terminus would isolate the region responsible for the speckled aspect of LNA1. Whether similar events occur for the native protein in naturally infected cells and, if so, whether these processes are cell cycle regulated will be important subjects of future investigation. One may suggest that other posttranslational modifications could contribute to the regulation of LNA1 interaction with heterochromatin and/or mitotic chromosomes. For instance, phosphorylation plays an important role in the regulation of the viral genome copy number in cells latently infected by bovine papillomavirus (36). In this model, Penrose and McBride proved that the level of E2, which tethers the viral genomes to the cell chromosomes, is regulated by phosphorylation and subsequent proteolysis. LNA1 is known to be phosphorylated, but there is still very little information concerning the putative effects of phosphorylation on its function. Sequence analysis indicates that the LNA1 CBS and NLS contain several putative phosphorylation sites, notably for protein kinases C and A and for some cdc2-type kinases (Fig. 7). Phosphorylation at these residues that are flanked by one or several basic amino acids would introduce a negative charge and consequently may profoundly alter the biochemical properties of these domains. Importantly, putative phosphorylation sites are also present in the N terminus of LNA1 from herpesvirus saimiri, and, more surprisingly, in the main CBS of EBV and herpesvirus papio EBNA1 (Fig. 7). Taken together, these observations suggest that phosphorylation by cell cycle-regulated kinases may play an important role in regulating the LNA1 and possibly the EBNA1 interaction with chromatin.
ACKNOWLEDGMENTS
We are grateful to Corinne Dutreuil for sequencing; to Virginie Costes, Axelle Dehee, Gerard Geraud, and Myriam Barre for technical help; and to Jacques Coppey for stimulating discussions and helpful advice. We thank Nicole Tirelli and Ann Beaumont for carefully reading and correcting the manuscript.
Tristan Piolot is a recipient of a fellowship from the Ministère de la Recherche. Marc Tramier is a recipient of a fellowship from the European Community. This work was supported by DRED (UPRES EA 2391), by a grant from the Programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses et Parasitaires, and by the Association pour la Recherche contre le Cancer.
REFERENCES
- 1.Ambinder R F, Mullen M A, Chang Y N, Hayward G S, Hayward S D. Functional domains of Epstein-Barr virus nuclear antigen EBNA-1. J Virol. 1991;65:1466–1478. doi: 10.1128/jvi.65.3.1466-1478.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ambroziak J A, Blackbourn D J, Herndier B G, Glogau R G, Gullett J H, McDonald A R, Lennette E T, Levy J A. Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients. Science. 1995;268:582–583. doi: 10.1126/science.7725108. [DOI] [PubMed] [Google Scholar]
- 3.Bairoch A, Bucher P, Hofmann K. The PROSITE database, its status in 1997. Nucleic Acids Res. 1997;25:217–221. doi: 10.1093/nar/25.1.217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ballestas M E, Chatis P A, Kaye K M. Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science. 1999;284:641–644. doi: 10.1126/science.284.5414.641. [DOI] [PubMed] [Google Scholar]
- 5.Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999;27:573–580. doi: 10.1093/nar/27.2.573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Boulikas T. Nuclear localization signals (NLS) Crit Rev Eukaryot Gene Expr. 1993;3:193–227. [PubMed] [Google Scholar]
- 7.Calos M P. Stability without a centromere. Proc Natl Acad Sci USA. 1998;95:4084–4085. doi: 10.1073/pnas.95.8.4084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Cesarman E, Chang Y, Moore P S, Said J W, Knowles D M. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med. 1995;332:1186–1191. doi: 10.1056/NEJM199505043321802. [DOI] [PubMed] [Google Scholar]
- 9.Cesarman E, Moore P S, Rao P H, Inghirami G, Knowles D M, Chang Y. In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood. 1995;86:2708–2714. [PubMed] [Google Scholar]
- 10.Chang Y, Cesarman E, Pessin M S, Lee F, Culpepper J, Knowles D M, Moore P S. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science. 1994;266:1865–1869. doi: 10.1126/science.7997879. [DOI] [PubMed] [Google Scholar]
- 11.Coppey-Moisan M, Delic J, Magdelenat H, Coppey J. Principle of digital imaging microscopy. Methods Mol Biol. 1994;33:359–393. doi: 10.1385/0-89603-280-9:359. [DOI] [PubMed] [Google Scholar]
- 12.Cotter M A, Jr, Robertson E S. The latency-associated nuclear antigen tethers the Kaposi's sarcoma-associated herpesvirus genome to host chromosomes in body cavity-based lymphoma cells. Virology. 1999;264:254–264. doi: 10.1006/viro.1999.9999. [DOI] [PubMed] [Google Scholar]
- 13.Decker L L, Shankar P, Khan G, Freeman R B, Dezube B J, Lieberman J, Thorley-Lawson D A. The Kaposi sarcoma-associated herpesvirus (KSHV) is present as an intact latent genome in KS tissue but replicates in the peripheral blood mononuclear cells of KS patients. J Exp Med. 1996;184:283–288. doi: 10.1084/jem.184.1.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Dupin N, Diss T L, Kellam P, Tulliez M, Du M Q, Sicard D, Weiss R A, Isaacson P G, Boshoff C. HHV-8 is associated with a plasmablastic variant of castleman disease that is linked to HHV-8-positive plasmablastic lymphoma. Blood. 2000;95:1406–1412. [PubMed] [Google Scholar]
- 15.Dupin N, Grandadam M, Calvez V, Gorin I, Aubin J T, Havard S, Lamy F, Leibowitch M, Huraux J M, Escande J P, Agut H. Herpesvirus-like DNA sequences in patients with Mediterranean Kaposi's sarcoma. Lancet. 1995;345:761–762. doi: 10.1016/s0140-6736(95)90642-8. [DOI] [PubMed] [Google Scholar]
- 16.Friborg J, Jr, Kong W, Hottiger M O, Nabel G J. p53 inhibition by the LANA protein of KSHV protects against cell death. Nature. 1999;402:889–894. doi: 10.1038/47266. [DOI] [PubMed] [Google Scholar]
- 17.Gallagher S R. One dimensional SDS gel electrophoresis of proteins. In: Ausubel F M, Brent R, Kingston R E, Moore D D, Seidman J G, Smith J A, Struhl K, editors. Current protocols in molecular biology. New York, N.Y: John Wiley & Sons, Inc.; 1999. pp. 10.12A.11–10.12A.34. [Google Scholar]
- 18.Gao S J, Zhang Y J, Deng J H, Rabkin C S, Flore O, Jenson H B. Molecular polymorphism of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) latent nuclear antigen: evidence for a large repertoire of viral genotypes and dual infection with different viral genotypes. J Infect Dis. 1999;180:1466–1476. doi: 10.1086/315098. [DOI] [PubMed] [Google Scholar]
- 19.Glenn M, Rainbow L, Aurad F, Davison A, Schulz T F. Identification of a spliced gene from Kaposi's sarcoma-associated herpesvirus encoding a protein with similarities to latent membrane proteins 1 and 2A of Epstein-Barr virus. J Virol. 1999;73:6953–6963. doi: 10.1128/jvi.73.8.6953-6963.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hall K T, Giles M S, Goodwin D J, Calderwood M A, Markham A F, Whitehouse A. Characterization of the herpesvirus saimiri ORF73 gene product. J Gen Virol. 2000;81:2653–2658. doi: 10.1099/0022-1317-81-11-2653. [DOI] [PubMed] [Google Scholar]
- 21.Kalderon D, Roberts B L, Richardson W D, Smith A E. A short amino acid sequence able to specify nuclear location. Cell. 1984;39:499–509. doi: 10.1016/0092-8674(84)90457-4. [DOI] [PubMed] [Google Scholar]
- 22.Kedes D H, Lagunoff M, Renne R, Ganem D. Identification of the gene encoding the major latency-associated nuclear antigen of the Kaposi's sarcoma-associated herpesvirus. J Clin Investig. 1997;100:2606–2610. doi: 10.1172/JCI119804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kedes D H, Operskalski E, Busch M, Kohn R, Flood J, Ganem D. The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat Med. 1996;2:918–924. doi: 10.1038/nm0896-918. [DOI] [PubMed] [Google Scholar]
- 24.Kellam P, Boshoff C, Whitby D, Matthews S, Weiss R A, Talbot S J. Identification of a major latent nuclear antigen, LNA-1, in the human herpesvirus 8 genome. J Hum Virol. 1997;1:19–29. [PubMed] [Google Scholar]
- 25.Krithivas A, Young D B, Liao G, Greene D, Hayward S D. Human herpesvirus 8 LANA interacts with proteins of the mSin3 corepressor complex and negatively regulates Epstein-Barr virus gene expression in dually infected PEL Cells. J Virol. 2000;74:9637–9645. doi: 10.1128/jvi.74.20.9637-9645.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Lee M A, Diamond M E, Yates J L. Genetic evidence that EBNA-1 is needed for efficient, stable latent infection by Epstein-Barr virus. J Virol. 1999;73:2974–2982. doi: 10.1128/jvi.73.4.2974-2982.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lehman C W, Botchan M R. Segregation of viral plasmids depends on tethering to chromosomes and is regulated by phosphorylation. Proc Natl Acad Sci USA. 1998;95:4338–4343. doi: 10.1073/pnas.95.8.4338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Leight E R, Sugden B. EBNA-1: a protein pivotal to latent infection by Epstein-Barr virus. Rev Med Virol. 2000;10:83–100. doi: 10.1002/(sici)1099-1654(200003/04)10:2<83::aid-rmv262>3.0.co;2-t. [DOI] [PubMed] [Google Scholar]
- 29.Lupton S, Levine A J. Mapping genetic elements of Epstein-Barr virus that facilitate extrachromosomal persistence of Epstein-Barr virus-derived plasmids in human cells. Mol Cell Biol. 1985;5:2533–2542. doi: 10.1128/mcb.5.10.2533-2542.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Marechal V, Dehee A, Chikhi-Brachet R, Piolot T, Coppey-Moisan M, Nicolas J C. Mapping EBNA-1 domains involved in binding to metaphase chromosomes. J Virol. 1999;73:4385–4392. doi: 10.1128/jvi.73.5.4385-4392.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Moore P S, Chang Y. Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and without HIV infection. N Engl J Med. 1995;332:1181–1185. doi: 10.1056/NEJM199505043321801. [DOI] [PubMed] [Google Scholar]
- 32.Morand P, Buisson M, Collandre H, Chanzy B, Genoulaz O, Bourgeat M J, Pinel N, Leclercq P, Leroux D, Marechal V, Fritsch L, Ruigrok R, Seigneurin J M. Human herpesvirus 8 and Epstein-Barr virus in a cutaneous B-cell lymphoma and a malignant cell line established from the blood of an AIDS patient. Leuk Lymphoma. 1999;35:379–387. doi: 10.3109/10428199909145743. [DOI] [PubMed] [Google Scholar]
- 33.Nador R G, Cesarman E, Chadburn A, Dawson D B, Ansari M Q, Sald J, Knowles D M. Primary effusion lymphoma: a distinct clinicopathologic entity associated with the Kaposi's sarcoma-associated herpes virus. Blood. 1996;88:645–656. [PubMed] [Google Scholar]
- 34.Nakai K, Kanehisa M. A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics. 1992;14:897–911. doi: 10.1016/S0888-7543(05)80111-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Neipel F, Albrecht J C, Fleckenstein B. Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity? J Virol. 1997;71:4187–4192. doi: 10.1128/jvi.71.6.4187-4192.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Penrose K J, McBride A A. Proteasome-mediated degradation of the papillomavirus E2-TA protein is regulated by phosphorylation and can modulate viral genome copy number. J Virol. 2000;74:6031–6038. doi: 10.1128/jvi.74.13.6031-6038.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Platt G M, Simpson G R, Mittnacht S, Schulz T F. Latent nuclear antigen of Kaposi's sarcoma-associated herpesvirus interacts with RING3, a homolog of the Drosophila female sterile homeotic (fsh) gene. J Virol. 1999;73:9789–9795. doi: 10.1128/jvi.73.12.9789-9795.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Rainbow L, Platt G M, Simpson G R, Sarid R, Gao S J, Stoiber H, Herrington C S, Moore P S, Schulz T F. The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen. J Virol. 1997;71:5915–5921. doi: 10.1128/jvi.71.8.5915-5921.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Renne R, Lagunoff M, Zhong W, Ganem D. The size and conformation of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) DNA in infected cells and virions. J Virol. 1996;70:8151–8154. doi: 10.1128/jvi.70.11.8151-8154.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Renne R, Zhong W, Herndier B, McGrath M, Abbey N, Kedes D, Ganem D. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat Med. 1996;2:342–346. doi: 10.1038/nm0396-342. [DOI] [PubMed] [Google Scholar]
- 41.Russo J J, Bohenzky R A, Chien M C, Chen J, Yan M, Maddalena D, Parry J P, Peruzzi D, Edelman I S, Chang Y, Moore P S. Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8) Proc Natl Acad Sci USA. 1996;93:14862–14867. doi: 10.1073/pnas.93.25.14862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Schalling M, Ekman M, Kaaya E E, Linde A, Biberfeld P. A role for a new herpes virus (KSHV) in different forms of Kaposi's sarcoma. Nat Med. 1995;1:707–708. doi: 10.1038/nm0795-707. [DOI] [PubMed] [Google Scholar]
- 43.Schulz T F. Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8) J Gen Virol. 1998;79:1573–1591. doi: 10.1099/0022-1317-79-7-1573. [DOI] [PubMed] [Google Scholar]
- 44.Schwam D R, Luciano R L, Mahajan S S, Wong L, Wilson A C. Carboxy terminus of human herpesvirus 8 latency-associated nuclear antigen mediates dimerization, transcriptional repression, and targeting to nuclear bodies. J Virol. 2000;74:8532–8540. doi: 10.1128/jvi.74.18.8532-8540.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Skiadopoulos M H, McBride A A. Bovine papillomavirus type 1 genomes and the E2 transactivator protein are closely associated with mitotic chromatin. J Virol. 1998;72:2079–2088. doi: 10.1128/jvi.72.3.2079-2088.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Soulier J, Grollet L, Oksenhendler E, Cacoub P, Cazals-Hatem D, Babinet P, d'Agay M F, Clauvel J P, Raphael M, Degos L, et al. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood. 1995;86:1276–1280. [PubMed] [Google Scholar]
- 47.Szekely L, Chen F, Teramoto N, Ehlin-Henriksson B, Pokrovskaja K, Szeles A, Manneborg-Sandlund A, Lowbeer M, Lennette E T, Klein G. Restricted expression of Epstein-Barr virus (EBV)-encoded, growth transformation-associated antigens in an EBV- and human herpesvirus type 8-carrying body cavity lymphoma line. J Gen Virol. 1998;79:1445–1452. doi: 10.1099/0022-1317-79-6-1445. [DOI] [PubMed] [Google Scholar]
- 48.Szekely L, Kiss C, Mattsson K, Kashuba E, Pokrovskaja K, Juhasz A, Holmvall P, Klein G. Human herpesvirus-8-encoded LNA-1 accumulates in heterochromatin- associated nuclear bodies. J Gen Virol. 1999;80:2889–2900. doi: 10.1099/0022-1317-80-11-2889. [DOI] [PubMed] [Google Scholar]
- 49.Thompson J D, Higgins D G, Gibson T J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Yates J L, Camiolo S M, Ali S, Ying A. Comparison of the EBNA1 proteins of Epstein-Barr virus and herpesvirus papio in sequence and function. Virology. 1996;222:1–13. doi: 10.1006/viro.1996.0392. [DOI] [PubMed] [Google Scholar]
- 51.Zhang Y J, Deng J H, Rabkin C, Gao S J. Hot-spot variations of Kaposi's sarcoma-associated herpesvirus latent nuclear antigen and application in genotyping by PCR-RFLP. J Gen Virol. 2000;81:2049–2058. doi: 10.1099/0022-1317-81-8-2049. [DOI] [PubMed] [Google Scholar]







