Age-Dependent Decline of Nogo-A Protein in the Mouse Cerebrum

Abstract

Nogo-A, a myelin-associated neurite growth inhibitory protein, is implicated in synaptic plasticity. It binds to its receptor namely the Nogo-66 receptor1 (NgR1) and regulates filamentous (F) actin dynamics via small GTPases of the Rho family, RhoA kinase (ROCK), LimK and cofilin. These proteins are associated with the structural plasticity, one of the components of synaptic plasticity, which is known to decline with normal aging. So, the level of Nogo-A and its receptor NgR1 are likely to vary during normal brain aging. However, it is not clearly understood how the levels of Nogo-A and its receptor NgR1 change in the cerebrum during aging. Several studies show an age- and gender-dependent decline in synaptic plasticity. Therefore, the present study was planned to analyze the relative changes in the mRNA and protein levels of Nogo-A and NgR1 in both male and female mice cerebrum during normal aging. Western blot analysis has shown decrease in Nogo-A protein level during aging in both male and female mice cerebrum. This was further confirmed by immunofluorescence analysis. RT-PCR analysis of Nogo-A mRNA showed no significant difference in the above-mentioned groups. This was also supported by in situ hybridization. NgR1 protein and its mRNA expression levels showed no significant alteration with aging in the cerebrum of both male and female mice. Taken together, we speculate that the downregulation of Nogo-A protein might have a role in the altered synaptic plasticity during aging.

Electronic supplementary material

The online version of this article (doi:10.1007/s10571-014-0088-z) contains supplementary material, which is available to authorized users.

Introduction

Nogo-A, a transmembrane protein, is one of the most potent neurite growth inhibitors of the adult central nervous system (CNS) (Schwab 2004; Cafferty and Strittmatter 2006; Yiu and He 2006). It is 1,163 amino acids in length and contains two main inhibitory regions for the neurite growth (Grandpre et al. 2000; Prinjha et al. 2000; Oertle et al. 2003). The 66-amino acid region in the C-terminal domain (Nogo66) binds to its receptor, NgR1 (Fournier et al. 2001; Barton et al. 2003; He et al. 2003).

Initially, Nogo-A was identified as a myelin-associated protein expressed in mature oligodendrocytes (Caroni and Schwab 1988; Chen et al. 2000). Later other studies showed its involvement in brain development. During development, Nogo-A influences migration and neurite outgrowth of cortical neurons (Mingorance-Le Meur et al. 2007), conducts corticospinal axons growing along the spinal cord (Schwab and Schnell 1991), and regulates the progressive restriction of plasticity (Kapfhammer and Schwab 1994; Gianola et al. 2003; McGee et al. 2005). A number of studies have identified links between Nogo-A and several pathological states of the CNS including Alzheimer’s disease (Montani et al. 2009), schizophrenia (Novak et al. 2002), multiple sclerosis (Reindl et al. 2003; Jurewicz et al. 2007) and epilepsy (Meier et al. 2003).

Nogo-A is involved in stabilizing the dendritic architecture of hippocampal neurons (Zagrebelsky et al. 2010). This is evident by the presence of Nogo-A in the highly plastic areas of mature CNS (Kapfhammer and Schwab 1994), like pyramidal neurons of the hippocampus, and the olfactory bulb (Huber et al. 2002; Mingorance et al. 2004). In mature CNS, both the known receptors for Nogo-A, NgR1 and the paired Ig-like receptor B (PirB) (Syken et al. 2006), modulate activity-dependent synaptic plasticity. Furthermore, NgR1 has been shown to regulate activity-dependent synaptic strength in hippocampal CA1 neurons (Lee et al. 2008).

During the normal aging process, animals experience gradual cognitive decline. Particularly, learning, memory and executive functions that depend on different parts of cerebrum, medial temporal lobe and prefrontal cortex, show considerable age-related decline. It is possible that Nogo-A/NgR1 signalling is also altered in aging brain. Levels of Nogo-A and NgR1 in normal aging are likely to vary because these are the major proteins associated with regulation of structural plasticity (Matsuzaki et al. 2004; Lee et al. 2008) which declines with normal aging. It has been demonstrated that Nogo-A mRNA levels decrease consistently in hippocampal areas in aged rats, suggesting that Nogo-A signalling system undergoes age-related changes. Besides the anatomical differences, male and female brain shows differences in decline of memory during normal aging (Raisman and Field 1971). Berchtold et al. (2008) have shown that the male brain undergoes more global gene change than the female brain during aging which in turn suggest that the brain undergoes sexually dimorphic responses during aging. Furthermore, there is no report regarding sex specific expression of Nogo-A and NgR1. The cerebrum is the largest part of brain and is involved in learning, memory, intellectual ability and other important functions (Mountcastle 1997) which change with age. In light of the above reports, we have studied the expression of these genes in both male and female mice cerebrum which includes entire cerebral cortex as well as subcortical structures including the hippocampus, basal ganglia and olfactory bulb, during normal aging. Our experimental results show that the expression of Nogo-A protein decreases with aging in both the sexes, but the level of NgR1 shows no significant change with age. Age-dependent downregulation of Nogo-A protein in cerebrum might be associated with age-dependent decrease in synaptic plasticity.

Materials and Methods

Materials

Restriction enzymes, dNTPs, NTPs, random hexanucleotides, enhanced chemiluminescence (ECL) reagents, Taq polymerase, RNase inhibitor and Reverse transcriptase enzymes were purchased from the New England Biolabs (USA); TRI reagent, monoclonal anti-β-actin-peroxidase (A3854) from Sigma–Aldrich (USA); rabbit anti-NgR1 antibody (sc-25659) from Santa Cruz (USA); peroxidise-conjugated secondary antibodies from Bangalore Genei (India); anti-Digoxigenin (DIG)-peroxidase and DIG labeling kit from Roche Applied Science (Germany); Vectashield mountant with DAPI dye from Vector Laboratories Inc. (USA); and polyvinyl difluoride (PVDF) membrane from Millipore (Germany). Rabbit anti-Nogo-A antibody was a generous gift from Dr. Kazumasa Yokoyama, Institute of Medical Science, University of Tokyo. All other biochemicals were purchased from Merck (Germany).

Animals

Swiss albino strain mice were maintained at 12 h light and dark schedule with ad libitum standard mice feed and drinking water in the animal house of Department of Zoology, Banaras Hindu University, Varanasi at ambient temperature. Young (8 ± 1 weeks), adult (52 ± 2 weeks), and old (80 ± 5 weeks) male and female mice were used for the experiments. The procedure for use and handling of animals has been approved by the Institutional Animal Ethical Committee.

Western Blotting

For preparing extract for western blotting, cerebrum from the above-mentioned mice was homogenized in buffer containing 50 mM Tris–HCl, pH 8.0, 150 mM NaCl, 0.1 % SDS, 1.0 % NP-40, 0.5 % sodium deoxycholate, 1 mM PMSF and 1 mM EDTA. The homogenate was first centrifuged at 4 °C at 2,500×g for 15 min and supernatant was collected and stored at −70 °C until further use for western blotting. The protein was estimated by Bradford method (1976). Fifteen microgram of protein was resolved by 7 % SDS-PAGE and 10 % SDS-PAGE for Nogo-A and NgR1, respectively, and electroblotted onto PVDF membrane by wet transfer method for 14 h. Then the blot was stained with ponceau-S for checking the transfer efficiency. For Nogo-A western blotting, the blot was blocked with 5 % non-fat milk in PBS for 2 h at room temperature and then incubated with primary antibody (rabbit anti-Nogo-A, 1:12,000 dilution). Thereafter, the blot was washed in PBS (three times, 5 min each) and incubated in secondary antibody (anti-rabbit HRPO conjugated, 1:4,000 dilution) for 2 h at room temperature. Finally, it was washed in PBS (three times, 5 min each). For NgR1 western blotting, the blot was blocked overnight with 5 % non-fat milk in PBS at 4 °C and then incubated with primary antibody (rabbit anti-NgR1, 1:1,000 dilution). Thereafter, the blot was washed in PBST (three times, 5 min each) and incubated in secondary antibody (anti-rabbit HRPO conjugated, 1:2,000 dilution) for 2 h at room temperature.

Finally, it was washed in PBST (four times, 10 min each). Both the blots were detected by ECL method. The same blot was reprobed with β-actin (1:25,000 dilution) for loading control. The signals were scanned by AlphaImager system and analyzed by Alpha-EaseFC software (Alpha Innotech Corp, USA).

Immunofluorescence

The mouse brain of three ages was dissected out and fixed in 4 % paraformaldehyde at 4 °C for 24 h. Thereafter, the tissue was immersed in 30 % sucrose solution and embedded in OCT solution. Horizontal sections of 8 µm were mounted on poly-l-lysine-coated slides and stored at −70 °C. Cryocut sections were washed in PBS and incubated with 10 % goat serum in PBS with 0.1 % Tween-20 at room temperature for 3 h to block the nonspecific sites. Then anti-Nogo-A (1:100) antibody and anti-NgR1 antibody (1:50) were added and incubation was continued overnight at 4 °C, followed by washing in PBS. No primary antibody was added in negative control slides. Further, these sections were incubated with FITC conjugated goat anti-Rabbit IgG (1:1,000) for 3 h at room temperature and washed thrice in PBS. Finally, sections were mounted in Vectashield mountant containing DAPI and detected under a fluorescence microscope using DAPI and FITC filter as described by Gautam et al. (2013).

Semi Quantitative Reverse-Transcription Polymerase Chain Reaction (RT-PCR)

Total RNA was isolated from the cerebrum of young, adult and old mice using TRI reagent kit. It was estimated by taking absorbance at 260 nm and purity was checked by A260/A280 ratio. Total RNA from different groups was resolved on 1 % agarose containing ethidium bromide and the integrity of RNA was checked by staining of 18S and 28S rRNA.

For RT-PCR study, cDNA was synthesized from the total RNA extracted from the cerebrum of young, adult, and old mice. The following primer pairs were used:

• Nogo-A

• Forward primer—FP: 5′ACATTAAGAAGACTGGAGTGGTGTTTGGT3′

• Reverse primer—RP: 5′AAATCATCAACTAAGAAGAGACGCCTCAAT3′

• NgR1

• Forward primer FP 5′-CTGGAGGGTAGCAACACCAT-3′,

• Reverse primer RP 5′-TGCAGCCACAGGATAGTGAG-3′

• GAPDH

• Forward primer—5′ GTCTCCTGCGACT TCAGC-3′,

• Reverse primer—5′ TCATTGTCATACCAGGAAATGAGC-3′

PCR condition includes 3 min of initial denaturation at 94 °C, 30 cycles (94 °C for 30 s, 61 °C for 30 s, 72 °C for 30 s), final extension at 72 °C for 10 min for Nogo-A; 3 min of initial denaturation at 94 °C, 29 cycles (94 °C for 30 s, 57 °C for 30 s, 72 °C for 30 s), final extension at 72 °C for 10 min for NgR1; 5 min of initial denaturation at 94 °C, 26 cycles (94 °C for 30 s, 52 °C for 30 s, 72 °C for 30 s), final extension at 72 °C for 3 min for GAPDH. The PCR products were resolved on 2 % agarose gel. The signals were scanned by AlphaImager system and analyzed by Alpha-EaseFC software (Alpha Innotech Corp, USA).

In Situ Hybridization

The mouse brain of three ages was dissected out and fixed in 4 % paraformaldehyde at 4 °C for 24 h. Thereafter, the tissue was immersed in 30 % sucrose solution and embedded in optimum cutting temperature solution. Horizontal sections of 8 µm were mounted on poly-l-lysine-coated slides and stored at −70 °C. The tissue sections were incubated at 37 °C for 15 min, hybridized with DIG labeled cDNA probe at 37 °C overnight. The cDNA probes were labeled by PCR using DIG-11-dUTP, Nogo-A and NgR1specific primers. After purification of probes by ethanol precipitation, they were estimated by serial dilution and 1:100, 1:50 dilution was chosen for Nogo-A and NgR1, respectively, as the optimum probe concentration. Similar dilution of unlabeled probe was used for negative control. Following hybridization, the tissue sections were washed in 1× SSC at 48 °C, blocked in 10 % goat serum and incubated with horse-radish peroxidase conjugated anti-DIG antibody (dilution 1:1,000). Slides were examined under the microscope and signal was analyzed as described by Kumar and Thakur (2012).

Statistical Analysis

Each experiment was repeated three times (n = 3 × 3 mice/group). For RT-PCR, the signal intensity of Nogo-A and NgR1 message was analyzed after normalization against the signal intensity of internal control, GAPDH. The data are presented as a histogram with the mean (±SEM) of three values calculated as relative density values (RDV) of Nogo-A/GAPDH and NgR1/GAPDH. For western blotting, the signal intensity of Nogo-A and NgR1 was analyzed after normalization against the signal intensity of β-actin. The data are presented as a histogram with the mean (±SEM) of three values calculated as RDV of Nogo-A/β-actin, NgR1/β-actin. For immunofluorescence and in situ hybridization, intensities (IDV/Area) of greyscale images captured by Leica DM 2000 microscope were measured using Alpha-EaseFC software. The signal intensity of negative control sections was subtracted from positive experimental sets for final plotting of graph. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test through SPSS for Windows (standard version 16.0). p values <0.05 were considered significant. Values were reported as mean ± SEM.

Results and Discussion

Western blot results showed higher expression levels of Nogo-A protein in young mouse cerebrum as compared to adult and old in both sexes (Fig. 1a). RT-PCR results showed no major difference in the expression levels (Fig. 2a). As the pattern of expression of Nogo-A protein and mRNA from young, adult and old remains similar in both the sexes; we further confirmed the results by immunofluorescence and in situ hybridization in young, adult, and old female mice cerebrum. Immunofluorescence showed a decline in Nogo-A protein in aging like western blot analysis (Fig. 1b and 1a). Further, in situ hybridization showed no significant alteration of Nogo-A mRNA during aging (Fig. 2b). No age-related alteration was found in both NgR1 protein and mRNA levels (Figs. 3a and 4a) in both male and female mice cerebrum during aging. These results were further confirmed by immunofluorescence and in situ hybridization in young, adult, and old female mice cerebrum. Immunofluorescence analysis revealed no significant alteration of NgR1 protein during aging like western blotting (Fig. 3b and 3a). Further, in situ hybridization showed no significant alteration of NgR1 mRNA during aging (Fig. 4b).

Fig. 1.

a Western blot analysis of Nogo-A in different ages of male and female mice cerebrum. Signal intensity for Nogo-A was normalized against signal intensity for β-actin. The data are presented as a histogram with the mean (±SEM) of three values calculated as RDV of Nogo-A/β-actin. b Immunofluorescence analysis of Nogo-A in different ages of female mice cerebrum. Photomicrographs are captured at ×400 magnification and scale bar represents 50 μm. Data are calculated as the net value of densitometries/area of each positive signal in mice group after subtraction of the corresponding values from negative control. Histogram representing mean ± SEM from three independent experiments on Y-axis and different groups on X-axis. Asterisks denote significant differences (p < 0.05) between the groups

Fig. 2.

a RT-PCR analysis of Nogo-A mRNA in different ages of male and female mice cerebrum. Signal intensity for Nogo-A was normalized against signal intensity for GAPDH. The data are presented as a histogram with the mean (±SEM) of three values calculated as RDV of Nogo-A/GAPDH. b In situ analysis of Nogo-A mRNA in different ages of female mice cerebrum. Photomicrographs are captured at ×400 magnification and scale bar represents 50 μm. Data are calculated as the net value of densitometries/area of each positive signal in mice group after subtraction of the corresponding values from negative control. Histogram represents mean ± SEM from three independent experiments on Y-axis and different groups on X-axis

Fig. 3.

a Western blot analysis of NgR1 in different ages of male and female mice cerebrum. Signal intensity for NgR1 was normalized against signal intensity for β-actin. The data are presented as a histogram with the mean (±SEM) of three values calculated as RDV of NgR1/β-actin. b Immunofluorescence analysis of NgR1 in different ages of female mice cerebrum. Photomicrographs are captured at ×400 magnification and scale bar represents 50 μm. Data are calculated as the net value of densitometries/area of each positive signal in mice group after subtraction of the corresponding values from negative control. Histogram represents mean ± SEM from three independent experiments on Y-axis and different groups on X-axis

Fig. 4.

a RT-PCR analysis of NgR1 mRNA in different ages of male and female mice cerebrum. Signal intensity for NgR1 was normalized against signal intensity for GAPDH. The data are presented as a histogram with the mean (±SEM) of three values calculated as RDV of NgR1/GAPDH. b In situ analysis of NgR1 mRNA in different ages of female mice cerebrum. Photomicrographs are captured at ×400 magnification and scale bar represents 50 μm. Data are calculated as the net value of densitometries/area of each positive signal in mice group after subtraction of the corresponding values from negative control. Histogram represents mean ± SEM from three independent experiments on Y-axis and different groups on X-axis

This study shows an age-dependent change in Nogo-A protein level in mouse brain cerebrum. Nogo-A protein expression was found to be higher in young mouse cerebrum as compared to other two ages which suggests its possible role in the brain development. This result is supported by the studies of Mingorance-Le Meur et al. (2007), where they have shown that Nogo-A influences migration and neurite outgrowth of cortical neurons. Previous reports have shown similar results on the effect of age on Nogo-A level. For example, immunoblotting analyses have shown to decrease in expression of Nogo-A protein in developing telencephalon from embryo on day 16 to adult stages (Gil et al. 2010). Similar finding is also reported by Mingorance et al. (2004) where they have shown decrease in expression of Nogo-A from the day of birth (postnatal day 0) to adult stage in developing hippocampus. Nogo-A mRNA showed no age specific variation in the cerebrum. Nogo-A protein and mRNA expression showed disparity in expression with aging. Wauthier et al. (2004) reported disparity in the protein and mRNA levels of CYP2E1 during aging. One study from our laboratory have shown discrepancy between expression level of norbin mRNA and protein in female mice cerebral cortex during aging (Mani et al. 2001). This may be due to slower rate of protein synthesis during brain aging. Age-associated changes in protein synthesis are regulated both at the transcriptional and pre-translational levels in terms of the availability of individual mRNA species for translation, and at the translational and posttranslational levels in terms of alterations in the components of the protein synthetic machinery and the pattern of post-synthetic modifications that determine the activity, specificity, and stability of a protein (Rattan 1996).

Recent studies have shown that Nogo-A/NgR1 signalling has important role to play during the process of learning and memory. NgR1 gene expression is effectively down regulated in hippocampus and cerebral cortex of rat brain by both drug-induced increase of neuronal activity and running behavior (Josephson et al. 2003). Also, Karlen et al. (2009) demonstrated that mice with inducible overexpression of NgR1 in forebrain neurons have normal long-term potentiation and normal 24 h memory, but severely impaired month long memory in both passive avoidance and swim maze tests.

This suggests that this signalling is down regulated at the time of memory consolidation. This is further confirmed by recent studies. Vanguilder et al. (2011) and Vanguilder et al. (2012) have shown that NgR1 is upregulated specifically in aged cognitively impaired, but not age-matched cognitively normal, rats. Moreover, a recent work in same laboratory showed increased hippocampal NgR1 signalling in aged rats with deficits of spatial cognition (Vanguilder Starkey et al. 2013). So taken together, Nogo-A protein decline and unaltered NgR1 protein level in aging cerebrum may have important functional significance. It is demonstrated by various studies that Nogo-A/NgR1 signalling pathway has important role in cognitive function. This signalling pathway has inverse relationship with hippocampal spine density, efficacy of activity-dependent synaptic plasticity, and spatial learning and memory (Zagrebelsky et al. 2005; Lee et al. 2008; Karlen et al. 2009; Raiker et al. 2010; Delekate et al. 2011). Vanguilder et al. (2011), Vanguilder et al. (2012) and Vanguilder Starkey et al. (2013) have reported that multiple components of this pathway, including ligands, NgR1 co-receptors, RhoA are upregulated at the protein level specifically in cognitively impaired, but not age-matched cognitively intact aged rats. LOTUS and LGI1 are recently identified endogenous NgR1 antagonists that compete with binding of its ligands (e.g., Nogo-A) for NgR1 binding, while ADAM22 interacts with NgR1 to facilitate LGI1/NgR1 binding (Thomas et al. 2010). Expression levels of the following proteins namely, LOTUS, LGI1, and ADAM22 decrease in different regions of hippocampus in cognitively impaired aged rats. These proteins are also downregulated in age-matched cognitively intact aged rats, but this occurred to a lesser extent (Vanguilder Starkey et al. 2013). In our studies, we have observed a decline in the expression of Nogo-A protein and no change in the expression of NgR1 in aging mouse cerebrum. As mentioned above, expression levels of NgR1 antagonists LOTUS, LGI1 and ADAM22 decrease during aging. We suggest that during brain aging Nogo-A/NgR1 pathway may be regulated by decrease in the expression of Nogo-A protein. Therefore, based on the above-mentioned reports and our data, it can be inferred that Nogo-A and NgR1 may have important role in regulating synaptic plasticity. Nogo-A/NgR1 signalling downregulation is one physiological component of the plastic changes needed for long-term learning. It is hypothesized that a simultaneous presence of high levels of Nogo-A and its receptor in neurons confers a locked state to hippocampal and cortical microcircuitry and that one or both of these proteins must be effectively and temporarily downregulated to permit plastic structural changes (Trifunovski et al. 2006). Further, McGee et al. (2005) demonstrated that adult NgR1 knockout mice lack maturation-dependent restriction of ocular dominance plasticity in the visual cortex. But during aging as this regulatory mechanism is somewhat weak, either Nogo-A or NgR1 level should go down. The downregulation of Nogo-A might instead reflect an active compensatory mechanism of the aging brain, perhaps to maintain a degree of plasticity in the face of less efficient NgR1 downregulation in response to learning tasks. While decreased Nogo-A level lowers the threshold for plasticity of the aging brain, the synaptic microcircuitry may at the same time become both less modifiable by activity and less stable (Trifunovski et al. 2006).

Reports from a number of laboratories (Lee et al. 2008; Zagrebelsky et al. 2010) have shown that the possible mechanism for the action of Nogo-A and NgR1 in regulating synaptic plasticity is through its influence on synaptic cytoskeleton, mainly on actin which is known to play important role in synaptic plasticity. Actin is the major cytoskeletal component in dendritic spines and provides the structural basis for spine formation, maturation, modification, and elimination during synaptic development, plasticity (Hotulainen and Hoogenraad 2010). NogoA is known to mediate its regulatory effect on F-actin dynamics via small GTPases of the Rho family (Hsieh et al. 2006; Montani et al. 2009; Nash et al. 2009; Deng et al. 2010) ROCK, LimK and cofilin (Montani et al. 2009; Nash et al. 2009) which are important regulators of F-actin dynamics (Montani et al. 2009). It suggests that Nogo-A and its receptors are important for upholding synaptic circuitry and regulating synaptic plasticity. Thus, the decline in expression of Nogo-A protein during aging may be correlated with change in synaptic plasticity.

Taken together, these results show that the expression of Nogo-A protein occurs in age-dependent manner while that of NgR1 remains unaltered with brain aging. The present findings indicate that Nogo-A and NgR1 may play an important role in age-dependent alteration in synaptic plasticity. Such function can be demonstrated by further investigations.

Electronic supplementary material

Below is the link to the electronic supplementary material.