Fine mapping and identification of the downy mildew resistance gene BoDMR2 in Cabbage (Brassica oleracea L. var. capitata)

Abstract

Background

Cabbage (Brassica oleracea L. var. capitata) is an important crop within the Brassica oleracea species and is extensively cultivated worldwide. In recent years, outbreaks of downy mildew caused by Hyaloperonospora parasitica have resulted in substantial losses in cabbage production. Despite this, there have been limited studies on genes associated with resistance to downy mildew in cabbage.

Results

This study identified sister lines exhibiting significant differences in disease resistance and susceptibility. Using bulked segregant analysis followed by sequencing (BSA-seq) and linkage analysis, the cabbage resistance locus BoDMR2 was accurately mapped to an approximately 300 kb interval on chromosome 7. Among the candidate genes identified, several single nucleotide polymorphisms (SNPs) and a 3-bp insertion were found within the conserved domain of the Bo7g117810 gene, encoding a leucine-rich repeat domain protein, in susceptible genotypes. Additionally, real-time quantitative polymerase chain reaction (RT‒qPCR) analysis revealed that the expression level of Bo7g117810 in resistant specimens was 2.5-fold higher than that in susceptible specimens. An insertion‒deletion (InDel) marker was designed based on the identified insertion in susceptible materials, facilitating the identification and selection of downy mildew-resistant cabbage cultivars.

Conclusions

This study identifies Bo7g117810 as a potential candidate gene associated with adult-stage resistance to downy mildew in cabbage, supported by observed differences in gene sequence and expression levels. Furthermore, the development of an InDel marker I1-3, based on its mutation, provides valuable resources for breeding resistant cabbage cultivars.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12870-024-05685-2.

Background

Cabbage (Brassica oleracea var. capitata L.) is a widely cultivated vegetable globally that is appreciated for its distinctive flavour and nutritional richness. Over the past several years, with the intensification of global climate change, various fungal diseases have become more severe, leading to significant losses in crop yields [1]. Downy mildew, caused by the invasion of Hyaloperonospora parasitica, is an obligate parasitic fungal disease that threatens the entire life cycle of cabbage. This disease has become increasingly prevalent in recent years, causing serious damage to global cabbage production [2]. Downy mildew is the fourth most common major disease in cabbage, following clubroot, wilt, and black rot. The application of pesticides for the control of downy mildew has led to substantial financial losses and environmental pollution. Utilizing resistant cultivars represents the most cost-effective and sustainable approach for managing this disease.

All-stage resistance (ASR) and adult plant resistance (APR) during plant growth are two of the most common and effective methods used to control diseases. In early research, researchers discovered that the APR and ASR of cabbage downy mildew vary among different races [3, 4]. However, APR is a key factor influencing the field yield of cabbage during the epidemic season of downy mildew. Therefore, research on APR to cabbage downy mildew has become particularly important.

To date, many brassica crop downy mildew resistance genes have been identified, such as BoDM1, Pp523, Ppa3 and Ppa207 for Brassica oleracea, and BrRHP1, BrDW, BrRLP48 and BrWAK1 for Brassica rapa [5–12]. Among them, Pp523 and BrRHP1 are APR genes, BrRLP48 and BrWAK1 are ASR genes, and BrDW is specifically responsible for resistance to downy mildew during the seedling stage. However, BoDM1, Pp523, Ppa3, and Pp207 are all downy mildew resistance genes in broccoli and cauliflower, and no resistance genes for downy mildew in cabbage, whether ASR or APR genes, have been reported. On the other hand, with the release of the draft genome of the cabbage downy mildew pathogen Hyaloperonospora parasitica, the exploration of effectors interacting with resistance genes has become feasible [13].

This study observed variations in downy mildew resistance among different sister lines at the adult stage. Based on these variations, fine mapping and candidate gene analysis were conducted to investigate adult plant resistance to downy mildew in cabbage. These results will contribute to unravelling the molecular mechanisms underlying cabbage resistance to downy mildew and will aid in the breeding of cabbage varieties with adult plant resistance to downy mildew.

Results

Phenotype of downy mildew resistance in sister lines

Two surveys were conducted at different times to assess the disease incidence among the sister lines.Although the infection phenotype of the sister lines in the second investigation was more severe than that observed in the first investigation, the sister lines W19, W20, and W28 exhibited an extremely resistant phenotype in both investigations, while W5 and W10 demonstrated an extremely susceptible phenotype in both investigations (Supplementary Table 2). The susceptible line W18 and the resistant line W19, adjacent to each other, exhibited obvious differences in resistance (Fig. 1). Therefore, W19, W20, and W28 were selected to construct the resistant pools, and W5 and W10 were selected as the susceptible pools for fine mapping of resistance genes against downy mildew using BSA-seq (Table 1).

Fig. 1.

Phenotypic differences between the cabbage sister lines W18 and W19. Under the same field conditions, the underside of W18 leaves showed numerous downy mildew lesions and spores, whereas the underside of W19 leaves had no lesions or spores

Table 1.

Phenotypes of the sister lines W5, W10, W19, W20, and W28, as assessed on December 15, 2021. HR = highly resistant; HS = highly susceptible

Sister lines	Resistant individuals	Susceptible individuals	resistance class
W5	0	43	HS2
W10	5	81	HS
W19	43	0	HR3
W20	43	0	HR
W28	86	0	HR

Fine-mapping of the downy mildew resistance gene BoDMR2

The sequencing of resistant (R)and susceptible (S) pools was conducted using pooled sequencing at a depth of 30×. After removing reads with adapters and low-quality reads from the raw sequencing data, 64,260,336 clean reads for the R pool, containing 19,222,565,408 bp were obtained. For the S pool, 64,417,798 reads, containing 19,246,208,216 bp were obtained. GC contents were 37.00% and 37.22%, respectively (Supplementary Table 5).High-quality SNPs from resistant and susceptible pools were utilized to detect markers linked to downy mildew resistance. Before performing the association analysis, SNPs were filtered according to the following criteria: first, SNP sites with multiple genotypes were filtered out; second, SNP sites with read support less than 4 were removed; third, SNP sites with consistent genotypes between pools were excluded. Ultimately, 1,639,003 high-quality and reliable SNP sites were obtained. The threshold for the fitted Euclidean distance (ED) value was calculated to be 0.45. Based on the association thresholds for SNP and InDel, a 4.0 Mb (from 44.36 Mb to 48.36 Mb) interval was ultimately detected on chromosome 7, according to the ‘TO1000’ reference genome (Supplementary Fig. 4). Two pairs of polymorphic InDel markers were designed based on the TO1000 reference genome, positioned distally on either side of the BSA-seq candidate interval between the two pools, to validate the accuracy of the BSA-seq region. After validation, markers near the candidate interval were found to be closely linked to downy mildew resistance in the sister lines. Therefore, 10 pairs of InDel markers were added to the mapping interval, with 5 pairs showing polymorphisms and clear bands between the resistant and susceptible pools. These five pairs of primers were used to preliminarily map the downy mildew resistance gene in the susceptible pool to a 1.63 Mb interval located at C7: 46.73 Mb − 48.36 Mb. Subsequently, the number of markers within the initially mapped interval was increased based on InDel variations.Using the entire population of susceptible sister lines, the mapping interval was refined, and BoDMR2 was precisely mapped to a region of approximately 310 kb between markers W8-3 and W7-22 (Table 2; Fig. 2).

Table 2.

The sequences of primers used for fine mapping

Primer name	Forward primer sequence (5’-3’)	Reverse primer sequence (5’-3’)
W7-11	ATTATTAGCTAAGGTTACTGGTGGC	CACCTTCACACAAAGCTAACAAGT
W8-4	CGCTGCTACTCTCTTTGTAACTAC	GAGCAGTAAGTTTGAGAGCAGAAG
W7-19	ATAAAATGTTTCCTTGCCGACAG	ATAGTTAGTTTTGCAGTGGGAACAC
W7-20	AGTAATTCGTTTTGCTTATGGTTTG	ATTCCCCACTATTCTGAGTTGAAGT
W7-21	ACAACATGCATTACTCAGAACTCAA	TCTGTGTCTATGTGAAAGGAGTTTG
W8-3	AAGTGAGAGAGGCTTATCTACGAG	AAATCAATCTAAAGCCGGAACAAG
W7-22	TATTTGGTAAGTCTTGAGCTTGGG	CTGACTATGCCGCTAAATCATCAC
W8-5	CTTCACTTAAGTTGCGATGAGTCT	ATGTGACACAAAGATAGAAGCGTG
W7-10	AGACGTGAAAATAAGTTGGCTAGTT	GAAAGTCGTCGGAAGTTCTGA

Fig. 2.

Gene fine mapping of BoDMR2. W20-1 is an individual plant from the R pool; gray represents the haplotype consistent with the resistant individual. W10-1 is an individual plant from the susceptible pool; white represents the haplotype consistent with the susceptible individual. W10-1 and other W10-numbered individual plants are derived from derived from selfing the same mother plant. W5-8 and other W5-numbered individual plants are derived from derived from selfing the same mother plant. C7 represents the localization of BoDMR2 on chromosome 7. Different rows represent different individual plants, all of which are susceptible plants used for mapping, while different columns represent different markers

Analysis of the BoDMR2 candidate gene

Functional annotations were performed on the genes within the candidate interval based on the cabbage TO1000 reference genome and homologous gene annotations from Arabidopsis databases. A total of 62 genes were located within this interval, with two associated with disease resistance functions: Bo7g117390 and Bo7g117810, both containing a leucine-rich repeat (LRR) domain (Supplementary Table 3, Supplementary Fig. 1). These genes were identified as candidate genes. According to the reference genome sequence, primers were designed to amplify and sequence the coding regions and promoter sequences of the candidate genes (Supplementary Table 4).

The amplification results revealed that Bo7g117390 displayed no sequence discrepancies between resistant and susceptible sister lines, whereas the coding region of Bo7g117810 exhibited multiple SNPs and a 3 bp insertion mutation in susceptible individuals. Additionally, the susceptible material W10 showed two 4 bp deletions and a 7 bp insertion in its promoter region. Analysis of these sequence differences revealed that the 3 bp insertion in the coding region of W10 resulted in the insertion of an alanine at position 951 in Bo7g117810 (Fig. 3). Conserved domain analysis revealed that amino acids 1-1033 of Bo7g117810 belong to the PLN03210 superfamily, which is associated with resistance to Pseudomonas syringae [14] (Supplementary Fig. 1). It is therefore hypothesized that the 3-bp insertion in Bo7g117810 in the susceptible sister lines may be critical for susceptibility to downy mildew infection.

Fig. 3.

Sequence differences in the Bo7g117810 gene between resistant and susceptible individuals. There are numerous SNP variations and a 3 bp InDel in the conserved domain between resistant and susceptible individuals

RT‒qPCR analysis

RT-qPCR analysis was conducted to examine the expression patterns of Bo7g117390 and Bo7g117810 in adult resistant and susceptible sister lines, based on candidate gene predictions and sequence analysis. The results showed no significant difference in the expression of Bo7g117390 between the resistant and susceptible sister lines. In contrast, the expression level of Bo7g117810 was significantly higher in the resistant sister lines compared to the susceptible ones. (Supplementary Fig. 2, Fig. 4). It is speculated that insertion and SNP mutations in the conserved domain and the significantly reduced expression of Bo7g117810 in the susceptible sister lines impair its function, thereby increasing susceptibility to downy mildew infection.

Fig. 4.

Relative expression of Bo7g117810 in R and S individuals of sister lines. W5 represents a susceptible individual, while W20 represents a resistant individual. The T-test was used for statistical analysis ** presented significant difference (p < 0.01)

Phylogenetic analysis

To analyze the evolutionary relationship of Bo7g117810 and its homologous genes, a BLASTP search was performed against the NCBI protein database using the full protein sequence of Bo7g117810 across various species. The results revealed that the Bo7g117810 is conserved exclusively within cruciferous crops. Based on these findings, a phylogenetic tree was constructed (Fig. 5). The phylogenetic tree is primarily divided into five branches, with Brassica napus showing the highest homology to Bo7g117810 followed by Brassica cretica, Raphanus sativus, and Brassica rapa.

Fig. 5.

Phylogenetic analysis of Bo7g117810 and its homologous genes

Development and application of markers co-segregating with response to Hyaloperonospora Parasitica

A Cosegregating marker, I1-3, was developed based on a 3-bp insertion mutation in the coding region of BoDMR2 found in the susceptible line. This marker was subsequently utilized for the analysis of resistant and susceptible pools and sister line materials (Table 3). The results demonstrated that marker I1-3 amplified a 92 bp fragment in W5 and an 89 bp fragment in W19. Furthermore, marker I1-3 was employed for genotyping sister lines, revealing a perfect match between the marker and the resistance phenotype to downy mildew across all sister lines, achieving a 100% concordance rate. Additionally, marker I1-3 was used to screen 148 inbred lines, leading to the identification of 23 lines harboring the downy mildew resistance locus and 125 lines harboring the susceptibility locus (Supplementary Fig. 3).

Table 3.

Primer sequences for marker I1-3

Primer name	Forward primer sequence (5’-3’)	Reverse primer sequence (5’-3’)
I1-3	GCAAAGGATAGCATCACTTCATATG	GTTTATGTAAAAGTGAGGAATGTGAC

Discussion

This study identified Bo7g117810 as a candidate resistance gene in cabbage through the analysis of field resistance phenotypes in genetically homogeneous sister lines. In addition to the 3-bp insertion, which is located within a conserved domain and is speculated to play a functional role in downy mildew resistance, multiple SNPs were also identified within Bo7g117810. These SNPs are situated within conserved domains, and some result in non-synonymous amino acid changes. Such changes could impact the protein’s structure and function, potentially affecting its role in disease resistance. The presence of these SNPs in functionally significant regions supports the hypothesis that they could contribute to the observed resistance phenotype.

Further experimental validation, such as functional assays or structural modeling, is needed to elucidate the exact impact of these SNPs on the protein’s function and their contribution to downy mildew resistance. This will provide a more comprehensive understanding of how these genetic variations contribute to the resistance observed in the sister lines.

The utilization of high-throughput sequencing has facilitated the expedited and streamlined mapping of candidate genes associated with a phenotype [15]. Homology analysis revealed that Bo7g117810 is a homolog of the SADR1 gene in Arabidopsis thaliana, which encodes a TIR-domain-containing intracellular immune receptor [16]. In Arabidopsis, SADR1 is required for the activation of defense signaling pathways triggered by certain pattern recognition receptors (PRRs) upon pathogen infection. Sequence and expression analyses of Bo7g117810 in the resistant and susceptible sister lines further support its involvement in disease resistance. The susceptible lines, which carry a mutation in Bo7g117810, showed reduced expression of this gene, correlating with their higher susceptibility to downy mildew. These findings suggest that the mutation in Bo7g117810 compromises the plant’s ability to mount an effective immune response, thus rendering the susceptible lines more vulnerable to downy mildew.

While the study strongly suggests that Bo7g117810 plays a role in downy mildew resistance, further functional validation is required. Attempts to use transgenic approaches, including overexpression and CRISPR/Cas9 gene editing, were hindered by technical difficulties related to cabbage genotypes, preventing successful transformation. Alternative strategies, such as employing different transformation systems or leveraging natural variation in other germplasm resources, are currently being explored to verify the function of Bo7g117810 more conclusively.

This research identifies Bo7g117810 as a promising candidate gene for improving resistance to downy mildew in cabbage. However, understanding the full extent of its role requires additional studies, particularly in identifying interacting proteins or effectors from the downy mildew pathogen, Hyaloperonospora parasitica. Further research should focus on exploring the molecular interactions between Bo7g117810 and the pathogen, as well as identifying downstream signaling pathways involved in the plant’s immune response.

In summary, this study provides strong indication that Bo7g117810 is involved in the resistance of cabbage to downy mildew. Given the significant impact of downy mildew on cabbage production, the identification of this gene opens new avenues for breeding resistant cultivars. The resistance source investigated in this study, putatively conferred by Bo7g117810, highlights the importance of future work. This work, aimed at functional validation and understanding the molecular mechanisms underlying the resistance conferred by Bo7g117810, will be critical for the effective application of this knowledge in cabbage breeding programs.

Conclusion

In this study, BSA-seq was employed on sister line populations with significant differences in adult-stage disease resistance to locate the cabbage adult-stage resistance gene against downy mildew on chromosome 7, within an approximately 300 kb interval flanked by the W8-3 and W7-22 markers. Within this interval, 62 genes were identified. Through sequence and RT‒qPCR analyses, BoDMR2, a candidate gene containing an LRR domain associated with downy mildew resistance, was identified. Based on sequence variations in BoDMR2, a cosegregating molecular marker, I1-3, was developed, which can be used to assist in screening potential disease-resistant breeding resources.

Materials and methods

Plant materials

The cabbage sister lines used in this study, derived from the self-incompatible line 0445-1-1-2 after 16 generations of selfing, were provided by the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. The lines were planted in 2021 at the Chinese Academy of Agricultural Sciences and subjected to conventional cultivation practices. The 148 inbred lines used in the study are superior inbred lines autonomously preserved by our research group, encompassing materials such as winter cabbage, spring cabbage, autumn cabbage, and wild cabbage. Phenotype investigation and resistance assessment.

After the onset of the disease in the field, investigations were conducted twice, two weeks apart. Disease assessments were made based on the area of leaf lesions and the presence of sporulation on the leaf undersides, with reference to a standardized disease severity grading criteria (Table 4) [17].

Table 4.

Adult cabbage downy mildew classification standard. Based on the presence or absence of lesions and spores on the underside of the leaves, six disease grades are classified, with grades 0–2 being resistant and grades 3–5 being susceptible

Class	Symptom
0	No host response and no sporulation
1	1 leaf with large necrotic spots or 2–3 leaves with small necrotic spots, with weak sporulation
2	1 leaf with large necrotic spots or 2–3 leaves with small necrotic spots, with heavy sporulation
3	2–3 leaves with large necrotic spots or 4–5 leaves with small necrotic spots, with weak sporulation
4	2–3 leaves with large necrotic spots or 4–5 leaves with small necrotic spots, with heavy sporulation
5	More than 5 leaves with large necrotic spots and heavy sporulation

Disease grades 0, 1, and 2 were classified as resistant, and grades 3, 4, and 5 were classified as susceptible [6]. Calculation of the Disease Index (DI): The DI was determined by the formula DI = (sum of the number of diseased plants multiplied by their corresponding disease grades) divided by (total number of plants surveyed multiplied by the highest disease grade), multiplied by 100%.

The population resistance level classifications were as follows: HR (High Resistance): 0 ≤ DI < 11.11; R (Resistant): 11.11 ≤ DI < 33.33; MR (Moderate Resistance): 33.33 ≤ DI < 55.56; S (Susceptible): 55.56 ≤ DI < 77.78; and HS (Highly Susceptible): DI greater than or equal to 77.78.

The data analysis was conducted using SAS software 9.4 (SAS Inc., Cary, N.C., USA). ANOVA (analysis of variance) was used for variance analysis, and differences between different survey times were compared using the Fisher least significant difference test (p ≤ 0.05).

Nucleic acid extraction and cDNA synthesis

Genomic DNA was extracted from fresh leaf tissue of individuals from the sister lines according to the CTAB method [18]. Total RNA was isolated from both healthy and diseased leaves of the sister lines using the RNAprep Pure Plant Kit (TIANGEN) according to the manufacturer’s instructions. A Pri-meScript™ RT Reagent Kit (Takara, Japan) was used to reverse transcribe cDNA from the extracted total. The DNA quality and concentration were detected via spectrophotometric analysis and agarose gel electrophoresis, and the diluted DNA and RNA were stored in a -20 °C freezer for freezing.

Whole-genome resequencing

Utilizing the resistance-susceptible contrast among sister lines, 30 extremely susceptible individuals were selected from both W5 and W10, and 30 extremely resistant individuals were selected from each of W19, W20, and W28. High-quality DNA was extracted from each selected individual, and equal amounts were pooled to construct pools for extreme susceptibility and extreme resistance. The sequencing of these two pools was performed through pooled sequencing with a sequencing depth of 30×. The sequencing and analysis were conducted at Beijing Biomarker Technologies Co., Ltd. During analysis, utilize SNP sites with genotype differences between two pools, tally the depth of each base across different pools, and calculate the Euclidean distance (ED) value for each site [19]. The ED value calculation formula is shown in Supplementary Fig. 6. Take the median + 3 standard deviations of all locus fit values as the association threshold for analysis, calculated to be 0.45. The region where the ED value exceeds 0.45 is considered the interval where candidate genes are located.

PCR amplification and electrophoresis

Primers were designed based on InDel to perform PCR amplification at this locus to determine whether there are differences between resistant and susceptible individuals. The amplification protocol is as follows: The 10-µL PCR mixture consisted of 2 µL of DNA template, 1 µL of 10× PCR buffer (Mg2 + included), 0.8 µL of dNTPs (2.5 mM each), 0.5 µL of forward primer (10 µM), 0.5 µL of reverse primer (10 µM), 0.2 µL of Taq DNA polymerase (5 U/µL), and 5.0 of µL ddH₂O.

The PCRs were performed in accordance with the following protocol: 95 °C for 5 min, followed by 32 cycles of 95 °C for 30 s, 58 °C for 30 s and 72 °C for 20 s; and then 72 °C for 5 min. The amplicons were stored in a refrigerator at 4 °C. The amplicons were separated by 8% polyacrylamide gel electrophoresis (160 V for 1.2 h), and the gel was stained with silver nitrate. Images were taken, and the amplified bands were visualized.

Fine mapping of BoDMR2

Using B. oleracea TO1000 as the reference genome, InDel markers were developed in the initial mapping interval and its vicinity through BSA-seq based on Euclidean Distance Algorithm (ED) [20]. ED algorithm is a method that utilizes sequencing data to identify markers with significant differences between pools, and thereby evaluates the regions associated with traits. In theory, besides the target trait-associated loci, all other loci between the two constructed pools in the BSA project are expected to be consistent. Therefore, the Euclidean distance (ED) values of non-target loci should tend toward 0. The larger the ED value, the greater the difference between the markers in the two pools. Variation sites with sequencing depths greater than 15 and InDel differences of 3 bp or more were selected. Based on the positions of the variant sites, sequences in their vicinity were extracted using TBtools software [21]. Primers were designed online using Primer3web considering primer Tm values, CG content, and amplification fragment size [22]. Suitable primers were chosen for subsequent fine mapping. Statistical analysis of the polyacrylamide gel electrophoresis results was performed, categorizing resistant individuals in sister lines as ‘a,’ susceptible individuals as ‘b,’ and heterozygous individuals as ‘h.’ The phenotypes and band types of each individual were recorded in an Excel spreadsheet, and a genetic map was constructed.

Candidate gene analysis

To identify the downy mildew resistance gene BoDMR2, the B. oleracea reference genome ‘TO1000’ was used for functional annotation, and functional analysis was conducted on the genes within the candidate region.Furthermore, BLASTP was used to align the genes within this region to the Arabidopsis genome, enabling further functional analysis of all genes in the candidate region. All genes related to disease resistance were designated candidate genes for BoDMR2. In addition, the predicted conserved domains were identified through NCBI’s CD search tools [23]. Primers were designed to amplify the coding sequences of these genes and the sequences of upstream promoter regions (-2k), sequence variations in candidate genes were analysed, and differential gene expression was assessed via RT‒qPCR.

RT‒qPCR analysis

The expression of BoDMR2 in the R and S sister lines was verified by RT‒qPCR. The primers used for RT‒qPCR are detailed in Supplementary Tables 1, and B. oleracea actin was utilized as an internal control. RT‒qPCR experiments were conducted utilizing a CFX96 Real-Time System (Bio-Rad) along with the SYBR Premix Ex TaqII Reagent Kit (Takara, Japan). For each experiment, there were three sets of biological and three sets of technical replicates. The relative expression levels of genes were determined using the 2^−ΔΔCt method [24].

Phylogenetic analysis

A BLASTP search was conducted using the full protein sequence of BoDMR2 in the National Center for Biotechnology Information (NCBI) database to identify genes homologous to BoDMR2. The protein sequences of CAF2032535 (Brassica napus), KAF3591138 (Brassica cretica), XP_018471328 (Raphanus sativus), KAJ4914380 (Raphanus sativus), ACP30607 (Brassica rapa), ACP30631 (Brassica rapa), CAD5330099 (Arabidopsis thaliana), AEE86625 (Arabidopsis thaliana), XP_022561190 (Brassica napus), XP_022561189 (Brassica napus), KAF2551881 (Brassica cretica), XP_010437371 (Camelina sativa), XP_019089677 (Camelina sativa), XP_019089676 (Camelina sativa), KAG2241963 (Brassica carinata), KAG2291273 (Brassica carinata), XP_023633916 (Capsella rubella), XP_023633917 (Capsella rubella), CAG7886187 (Brassica rapa) and BoDMR2 were utilized for phylogenetic analysis employing the neighbor-joining (NJ) method with 1,000 bootstrap replicates, which was conducted using MEGA 7.0 software [25]. Subsequently, aesthetic enhancements were applied through the ITOL website [26].

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

Y. Zhang conceived and designed the experiments; Y. Wu, B. Zhang performed the experiments and analyzed the data; Y. Wu and Y. Zhang wrote and revised the paper; and L. Yang, M. Zhuang, H. Lv, Y. Wang, J. Ji and X. Hou coordinated and designed the study. All authors have read and approved the final manuscript.

Funding

This work was supported by grants from Beijing Natural Science Foundation (6232037), the earmarked fund for the Modern Agro-Industry Technology Research System, China (CARS23), and the Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (CAAS-ASTIP-IVFCAAS). The work was performed in the State Key Laboratory of Vegetable Biobreeding, Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China. The funder was not involved in the design, data analysis, or writing associated with the study.

Data availability

All data generated or analyzed during this study are included in this published article and its supplementary information files. The raw sequencing data used during this study are available in the NCBI SRA database (Accession number: PRJNA1089858). The B. oleracea reference genome ‘TO1000’ used in this study can be found at the link: http://plants.ensembl.org/Brassica_oleracea/Info/Index. The A. thaliana genome can be found at the link: https://www.arabidopsis.org/index.jsp. The protein database of National Center for Biotechnology Information (NCBI) can be found at the link: https://www.ncbi.nlm.nih.gov/. All these databases are open to public access.

Declarations

Ethics approval and consent to participate

All the plant materials are from the Institute of Vegetables and Flowers, Chinese Academy of Agriculture Sciences (IVFCAAS, Beijing, China). The utilization of these plant materials in this study complies with the guidelines and legislation of China.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.