Abstract
Pain perception is influenced by sex and aging, with previous studies indicating the involvement of aromatase, the estradiol synthase enzyme, in regulating pain perception. Previous research has established the presence of aromatase in dorsal root ganglia sensory neurons and its role in modulating pain perception. The present study aims to explore the implications of aging and sex on the expression of aromatase and estrogen receptors in the trigeminal ganglion. The study examined mRNA levels of aromatase, ERs, and the androgen receptor (AR) in the trigeminal ganglion of 3-month-old and 27-month-old male and female mice, as well as 3-month-old mice from the four-core genotype (FCG) transgenic model. The latter facilitates the assessment of gonadal hormone and sex chromosome implications for sex-specific traits. Aromatase localization in the ganglion was further assessed through immunohistochemistry. Aromatase immunoreactivity was observed for the first time in sensory neurons within the trigeminal ganglion. Trigeminal ganglion gene expressions were detected for aromatase, ERs, and AR in both sexes. Aromatase, ERβ, and GPER gene expressions were higher in young males versus young females. Analyses of the FCG model indicated that sex differences depended solely on gonadal sex. The aging process induced an enhancement in the expression of aromatase, ERs, and AR genes across both sexes, culminating in a reversal of the previously observed gender-based differences. the potential impact of estrogen synthesis and signaling in the trigeminal ganglion on age and sex differences warrants consideration, particularly in relation to trigeminal sensory functions and pain perception.
Graphical abstract
Age and gonadal sex influence ERs, AR, and ARO levels in the trigeminal ganglion. Although somatosensory perception shows a decline in the elderly, the incidence of trigeminal neuralgia intensifies in aged adults and is predominantly prevalent in women relative to men. The increased expression of aromatase and estrogen receptors in aged female animals suggests that the modulatory influence that neuroestradiol exerts over the trigeminal somatosensory input, inclusive of pain, undergoes changes in elderly male and female individuals in a sex-specific manner.
Keywords: Aging, Sex differences, Aromatase, Estrogen receptors, Androgen receptor, Trigeminal ganglion
Introduction
Although somatosensory perception shows a decline in older people [1], trigeminal neuralgia is more frequent in older adults [2, 3], in line with the higher prevalence of other chronic pain conditions in the elderly [4, 5].
In addition to cultural, cognitive, and psychosocial influences, biological sex is one of the factors that affect pain perception [5, 6]. Thus, chronic pain conditions [5], including trigeminal neuralgia [3, 7], are more common in women than men. However, the role of gonadal hormones in the generation of these sex differences is unclear [5].
Sex-related differences in pain perception have also been investigated in animal models, with studies generally reporting that female rodents exhibit increased sensitivity to noxious stimuli compared to males. Estradiol, depending on concentration and pain modality, may alleviate or potentiate hyperalgesia [8–10]. Estradiol actions on pain regulation are mediated through estrogen receptor (ER)α, ERβ and G protein-coupled ER (GPER, GPR30), which are expressed in nervous system structures involved in nociception [9, 11–14].
Estrogenic actions in the pain-processing neuronal circuits are in part driven by hormonal estradiol released by peripheral steroidogenic organs, such as the ovary. However, estradiol is also a neural-derived paracrine factor, or neuroestradiol, which is synthesized locally in the pain circuits in both sexes from circulating or local androgens by the enzyme aromatase or estrogen synthase [15–17].
Consistent with the pain symptoms often experienced by breast cancer patients treated with aromatase inhibitors [18], spinal or systemic administration of these molecules in rodents increases nociception and induces allodynia [19–21]. This evidence, combined with increased aromatase expression in the dorsal horn of the spinal cord under pain conditions [20] and the localization of aromatase and ERs in specific signaling domains involved in nociceptive regulatory signaling [22], suggests that neuroestradiol may activate antinociceptive mechanisms, possibly complementing nociceptive modulation exerted by systemic estradiol.
In this study, we first examined whether aromatase is expressed in the primary sensory neurons of the mouse trigeminal ganglion. Then, given the reported effects of aging and sex on pain perception in humans, we analyzed the expression of aromatase and ERs in the trigeminal ganglion of adult and older animals of both sexes. Furthermore, we used the Four Core Genotype (FCG) mouse model [23] to determine whether gonadal sex, sex chromosome complement, or a combination of both factors cause the observed sex differences.
Methods
Animals
Male and female CD1 wild-type and Four Core Genotype (FCG) mice from our in-house colony were maintained on a 12:12 hour light-dark cycle with ad libitum access to food and water. Mating involved placing a male in a cage with two females for one week. Pregnant females were individually housed in plastic maternity cages containing wood shavings as nesting material. The FCG transgenic model was generated by deleting the testis-determining gene Sry from the Y chromosome and inserting a Sry transgene into autosome 3 in male CD1 mice (FCG XYm mice). By mating FCG XYm mice with CD1 wild-type females, the resulting offspring included XX and XY mice with testes, as well as XX and XY mice with ovaries. This allowed for the comparison of XX and XY mice with the same type of gonad to assess the phenotypic effects of sex chromosome complement in cells and tissues. Genotyping of FCG mice was performed using RT-PCR to detect Sry and Ssty (located on the Y chromosome) gene transcripts. FCG model mice [24] were obtained from the Cajal Institute colony, which originated from animals donated by Dr. A.P. Arnold.
Experimental procedure
Three-month-old CD1 wild-type male and female mice, along with FCG mice and 27-month-old male and female wild-type mice, were used in the study. Four animals per experimental group were decapitated, and their trigeminal ganglia were dissected under a magnifying glass. The samples were then rapidly frozen in dry ice and stored at -80°C until further processing. Three-month-old wild-type and FCG females were sacrificed during the diestrus 2 phase. The determination of the estrous cycle phase was performed by analyzing vaginal smears [25].
Immunofluorescence
The detection of aromatase presence was executed through immunofluorescence performed on glass slide-mounted sections, adhering to the subsequent steps. Trigeminal ganglia, sliced at 15 μm, were directly placed on a glass slide in four adjacent series and preserved at room temperature until the immunofluorescence procedure was conducted. All steps were carried out at room temperature. Initially, sections underwent a 30-minute wash in PBS 0.1 M, pH 7.3–7.4, and nonspecific binding sites were obstructed by a 2-hour incubation in blocking solution (PBS 0.1 M, pH 7.3–7.4, 2% Triton X-100 (Merck, Darmstadt, Germany), and 10% normal donkey serum). Subsequently, sections were incubated overnight with the primary anti-aromatase antibody (diluted 1:1000 in blocking solution, in-house production, described and validated by [26]. The following day, sections were washed for 30 minutes in PBS 0.002 M, pH 7.3–7.4, and then incubated with the Alexa anti-rabbit 488 secondary antibody (Thermo Fisher Scientific, 1:200) for 2 hours. Lastly, sections were rinsed for 30 minutes in PBS 0.002 M, pH 7.3–7.4, and covered utilizing fluoromount DAPI. A Leica TCS SP5 Spectral confocal system (Leica Microsystems AG, Wetzlar, Germany) facilitated the observation of sections and the acquisition of microphotographs. Confocal images were collected using the z-stack function at a resolution of 1024 x 1024 pixels, employing 10X and 40X oil immersion objectives.
Quantitative real-time polymerase chain reaction (PCR)
Total RNA was extracted from isolated tissues utilizing TRIzol reagent, adhering to the manufacturer's guidelines (Thermo Fisher Scientific) to quantitate Cyp19a1, which encodes the enzyme aromatase; Esr1, encoding for estrogen receptor (ER)α; Esr2, encoding for ERβ; Gper1, encoding for G-protein coupled ER (GPER); Ar, encoding for androgen receptor (AR); and Rpl13a, selected as the control housekeeping gene. The first cDNA strand was synthesized employing 1 μg of extracted RNA through reverse transcription within a final volume of 15 μL, using the RevertAid H Minus first-strand cDNA synthesis kit (M.B.I. Fermentas) following the manufacturer's guidelines. Upon reverse transcription, cDNA was diluted to 1:10 for Cyp19a1, Esr1, Esr2, and Ar, and 1:100 for housekeeping gene quantification. Subsequently, 5 μL per sample were amplified through real-time PCR in 20 μL. Cyp19a1 amplification was executed with Taqman master mix and specific primers (Mm00484049_m1 Cyp19a1). The quantification of Esr1, Esr2, Gper1, Ar, and Rpl13a was undertaken using the SYBR Green master mix (Applied Biosystems), as previously delineated [27, 28] with the primers detailed in Table 1.
Table 1.
Primers sequences. Sequences of the forward and revers primers used for Esr1, Esr2, Gper1, and Ar mRNA levels analysis by qPCR
Gene | Primer forward | Primer reverse |
---|---|---|
Esr1 | 5’-GATCCCACCATGCACAGTGA-3' | 5’-GGAGCATCTACAGGAACACAGGTA-3' |
Esr2 | 5’-CCTGGTCTGGGTGATTTCGA-3' | 5’-ACTGATGTGCCTGACATGAGAAAG-3' |
Gper1 | 5’- TGCTGCCATCCAGATTCAAG -3' | 5’- GGGAACGTAGGCTATGGAAAGAA-3' |
Ar | 5’-TCTACTTTGCACCTGACTTGGTTT-3' | 5’-ACTCTTGAGACAGGTGCCTCATC-3' |
Rpl13a | 5’-TACCAGAAAGTTTGCTTACCTGGG-3' | 5’-TGCCTGTTTCCGTAACCTCAAG-3' |
All samples were processed in duplicate utilizing an ABI Prism 7500 sequence detector (Applied Biosystems), adhering to conventional Applied Biosystems cycling parameters (40 cycles of 95 °C for 15 s, and 60 °C for 1 min). Following each PCR reaction, dissociation curve analysis was executed to ascertain the presence of a singular product and the absence of primer dimers. The Ct was ascertained and normalized to the housekeeping gene Rpl13a, employing the ΔΔCT method to determine relative expression levels. Statistical analyses were conducted using ΔΔCT threshold cycle values.
Statistical Analysis
Statistical significance was evaluated using various methods: unpaired two-tailed t-test was used for examining differences between young adult and aged groups and two-way analysis of variance (ANOVA) for analyzing interactions between the independent variables "genotype" and "gonads" in FCG animals, as well as "sex" and "age" in young adult and aged female and male animals. Subsequently, for those variables/interactions for which ANOVA p values were statistically significant, the statistical significance of the effects of each independent variable and their interactions was tested by Fisher's post hoc comparisons if no interaction between independent variables was found or simple comparisons in the case of significant interaction. Simple linear regression analysis was employed to determine potential relationships between two distinct variables, with the calculation of the coefficient of determination (R2) and Spearman's correlation coefficient (r) values. Correlation analysis was employed to determine potential relationships between distinct variables, with the calculation of the coefficient of determination (R2), and data were plotted using the function ‘ggcorrplot’ Rstudio package, ggcorrplot (v0.1.4.1). Statistical analyses were executed utilizing R “stats” package (v4.3.1) [29] in the RStudio platform. Significance levels were denoted as follows: *, P < 0.05; **, P < 0.01; ***, P < 0.001. A level of P < 0.05 was deemed statistically significant. To evaluate the equality of variances, Levene's test was used. Data in the figures are presented as mean ± SEM.
Results
Aromatase is expressed in the trigeminal ganglion in a sex-dependent manner and aging modifies its expression, inverting sex differences
Aromatase immunoreactivity was identified in primary sensory neurons within the ophthalmic, maxillary, and mandibular subdivisions of the trigeminal ganglion. Immunofluorescence employing the aromatase antibody was exclusively observed in the soma of primary sensory neurons, with satellite glial cells displaying no immunoreactivity (Fig. 1). The absence of immunoreactivity was noted when the primary antibody was omitted (data not shown). Immunoreactivity was exhibited in small, medium, and large primary sensory neurons with a similar staining intensity. This immunoreactivity was confined to the cytoplasm, while cell nuclei remained negative.
Fig. 1.
Aromatase expression in the mouse trigeminal ganglion. Representative examples of aromatase immunofluorescence in the mouse trigeminal ganglion and quantification of gene expression in young adult and aged male and female mice. A, aromatase marker in the three portions of the trigeminal ganglion. B, Trigeminal ganglion cell nuclei labeled with DAPI. C, Merge. D, Magnification showing aromatase labeling exclusively in the soma of primary sensory neurons, with satellite glial cells not immunoreactive. E, Expression of aromatase. Male animals (n=4) and female animals (n=4). Data are represented as individual values ± SEM. The red line shows mean values. **, *** Significant differences (**p<0.01; ***p<0.001). Scale bar, 100 μm
Quantification of the Cyp19a1 gene expression was performed in the trigeminal ganglion of young adult and aged male and female mice. Two-way ANOVA revealed a significant effect of age [F(1,12)=117.4; P<0.0001], of gonadal sex [F(1,12)=7.829; P=0.0161], and the interaction between age and gonadal sex [F(1,12)=22.02; P=0.0005]. Fisher’s multiple comparison tests are presented in Fig. 1.E. Specifically, older animals (27 months of age) exhibited increased Cyp19a1 expression compared to young adult animals (P<0.0001), with older females demonstrating higher expression than older males (P<0.01). Cyp19a1 expression was higher in older females compared to young adult females (P<0.0001) and older males (P=0.0011), and higher in older males compared to young adult males (P<0.0001) (Fig. 1.E).
As a result of the changes in Cyp19a1 expression with aging, sex differences were inverted in older animals compared to younger ones. Consequently, Cyp19a1 expression was higher in young males than in young females (Fig. 2A); however, in older animals, Cyp19a1 expression was elevated in females (Fig. 1.E).
Fig. 2.
Aging modifies the expression of Cyp19a1 in the trigeminal ganglion. Effect of aging on the aromatase expression in the trigeminal ganglion of aged male and female mice. Comparisons of Cyp19a1 expression levels in young adult and aged male and female animals. Young adult males (n=4), young adult females (n=4), older males (n=4), and older females (n=4). Data are represented as individual values ± SEM. The red line shows mean values. *, *** Significant differences (**p<0.01; ***p<0.001)
Aging modifies the expression of Esr1, Esr2, Gper1 and Ar in the trigeminal ganglion
Older mice exhibited a significantly higher expression of genes encoding for ERs in the trigeminal ganglion compared to young animals (Fig. 2A-C and E-G). Male animals displayed increased expression of Esr1 [t=12.07, df=6; P<0.0001], Esr2 [t=19.31, df=6; P<0.0001], and Gper1 [t=20.30, df=6; P<0.0001]. Similar results were obtained for female animals, with higher expression levels of Esr1 [t=15.93, df=6; P<0.0001], Esr2 [t=19.82, df=6; P<0.0001], and Gper1 [t=29.14, df=6; P<0.0001] higher in aged animals compared to adult animals.
In contrast to the effects on genes encoding for ERs, aging resulted in a significant decrease in the expression of Ar (Fig. 2D and H). Both male [t=3.469, df=6; P<0.0133] and female [t=9.585, df=6; P<0.0001] animals exhibited reduced expression of Ar.
Aging reverses sex differences in the expression of Esr1, Esr2, Gper1, and Ar in the trigeminal ganglion
Due to the aforementioned changes with aging, the sex differences in the expression levels of Esr1, Esr2, Gper1, and Ar were assessed in the trigeminal ganglion of young adults and aged male and female mice. Two-way ANOVA revealed a significant effect of age on the expression of Esr1 [F(1,12)=373.410; P<0.0001], Esr2 [F(1,12)=745.06; P<0.0001], Gper1 [F(1,12)=1462.41; P<0.0001] and Ar [F(1,12)=75.13; P<0.0001]. Furthermore, gonadal sex displayed a significant effect on Esr1 [F(1,12)=15.263; P=0.002], Esr2 [F(1,12)=15.33; P=0.002], Gper1 [F(1,12)=47.05; P<0.0001] and Ar [F(1,12)=107.07; P<0.0001]. Interaction effects between aging and gonadal sex were detected for Esr2 [F(1,12)=26.00; p=0.0002], Gper1 [F(1,12)=68.19; P<0.0001] and Ar [F(1,12)=10.12; P= 0.007], whereas no interaction was found for Esr1 [F(1,12)=0.163; P= 0.693]. Fisher’s multiple comparison tests are shown in Fig. 3.
Fig. 3.
Aging modifies the sex differences in the expression of Esr1, Esr2, Gper1, and Ar in the trigeminal ganglion. Sex differences in estrogen and androgen receptors’ expression in the trigeminal ganglion of young adult and aged male and female mice. A, Esr1 (ERα) mRNA levels. B, Esr2 (ERβ) mRNA levels. C, Gper1 (GPER) mRNA levels. D, Ar (AR) mRNA levels in young adult aged male and female animals. Aged male animals (n=4) and aged female animals (n=4). Data are represented as values distribution ± SEM, the red line shows mean values. *, **, *** Significant differences (*p<0.05; **p<0.01; ***p<0.001)
In aged animals, the expression levels of Esr1, Esr2, and Gper1 were markedly increased, with females demonstrating the highest values. This pattern reverses the trend observed in younger subjects, where males exhibited elevated levels. Conversely, Ar expression levels experienced a substantial decline in aging mice, a trend more consistently apparent in female subjects.
FCG model reveals that sex differences depend on gonadal sex and are not determined by sex chromosome complement
The FCG model enables the determination of whether the origin of sex differences in a specific trait depends on either gonadal sex, sex chromosome complement, or a combination of both factors. This model produces four types of animals: XX and XY mice with testes, and XX and XY mice with ovaries. Comparisons between animals possessing the same type of gonad allow the assessment of sex chromosome influence, while evaluations involving animals with the same sex chromosome complement facilitate the assessment of the influence of gonadal endowment.
Analysis of androgen and estrogen receptor expression and aromatase in FGC animals revealed a significant effect of gonadal endowment (Fig. 4). Animals with testes demonstrated higher expression of Cyp19a1, Esr2, and Gper1 than those with ovaries (Fig. 4A, C and D), while animals with ovaries exhibited higher expression levels of Esr1 and Ar than those with testes (Fig. 4B and E), regardless of sex chromosome complement.
Fig. 4.
Sex differences in the expression of Cyp19a1, Esr1, Esr2, Gper1, and Ar depend on gonadal sex and not on sex chromosome complement. Analysis of the influence of gonadal sex and chromosomal complement in the expression of estrogen and androgen receptors in the trigeminal ganglion using the FCG model. A, Cyp19a1 (Aromatase). B, Esr1 (ERα) mRNA levels. C, Esr2 (ERβ) mRNA levels. D, Gper1 (GPER) mRNA levels. E, Ar (AR) mRNA levels in FCG animals. XY males (n=4), XY females (n=4), XX males (n=4), and XX females (n=4). Data are represented as individual values ± SEM. The red line shows mean values. *, **, *** Significant differences (*p<0.05; **p<0.01; ***p<0.001)
Two-way ANOVA revealed a significant effect of gonads on the expression of Cyp19a1 [F(1,12)=40.80; P<0.0001], Esr1 [F(1,12)=116.2; P<0.0001], Esr2 [F(1,12)=86.99; P<0.0001], Gper1 [F(1,12)=34.89; P=0.0001] and Ar [F(1,12)=79.92; P<0.0001]. Additionally, sex chromosome complement displayed a significant effect on Ar expression [F(1,12)=16.53; P=0.0019], but not on Cyp19a1 [F(1,12)=1.310; P=0.2791], Esr1 [F(1,12)=0.3385; P=0.5714], Esr2 [F(1,12)=0.03360; P=0.8582], or Gper1 [F(1,12)=0.6596; P=0.4356] expression.
No interaction effects between gonadal sex and sex chromosome complement were detected for Cyp19a1 [F(1,12)=0.06679; P=0.8013], Esr1 [F(1,12)=1.276; P=0.2808], Esr2 [F(1,12)=4.543; P=0.0589], Gper1 [F(1,12)=1.023; P=0.3356] and Ar [F(1,12)=1.205; P=0.9973]. Fisher’s multiple comparison tests are shown in Fig. 4.
Significant positive correlation found between Cyp19a1 expression and Esr1, Esr2, and Gper1 expression in trigeminal ganglion
To investigate whether individual variations in the expression of the gene encoding the enzyme involved in estradiol synthesis (Cyp19a1 were associated with variations in the expression of genes encoding proteins participating in estradiol signaling, we examined the correlation between individual values of Cyp19a1 expression and those of Esr1, Esr2, and Gper1 in animals from all experimental groups (see Fig. 5).
Fig. 5.
Cyp19a1 expression significantly and positively correlated with the expression of Esr1, Esr2, and Gper1 in the trigeminal ganglion. Correlation of the levels of aromatase and estrogen and androgen receptors’ expression. A, Correlation with Ers1 (ERα); B, Correlation with Ers2 (ERβ); C, Correlation with Gper1 (GPER); D, Correlation with Ar (AR)
As illustrated in Fig. 5, significant positive correlations were observed between Cyp19a1 expression values and Esr1 [Fig. 5A; r=0.95; R2=0.970; p=0.0001], Esr2 [Fig. 5B; r=0.98; R2= 0.9085; p=0.0007] and Gper1 [Fig. 5C; r=0.98; R2=0.8875; p<0.0004] expression values. Conversely, a non-significant correlation was demonstrated between Cyp19a1 expression values and Ar [Fig. 5D; r=-0.73; R2=0.1962; p=0.0995] expression values.
Significant positive correlation found between Age and Esr1, Esr2, Gper1, and Cyp19a1 expression in the trigeminal ganglion of both male and female animals
To investigate whether individual variations in the expression of the gene encoding the enzyme involved in estradiol synthesis (Cyp19a1) and estradiol and androgen receptor signaling were associated with variations in age, we examined with Spearman's rank correlation coefficient (ρ) the correlation between individual values of Cyp19a1, Esr1, Esr2, Gper1 and Ar expression at different age in male (Fig. 6A) and female (Fig. 6B) animals, respectively.
Fig. 6.
Age significantly and positively correlated with the expression of Esr1, Esr2, and Gper1 in the trigeminal ganglion. Correlation of individual values of Cyp19a1, Esr1, Esr2, Gper1, and Ar expression at different ages. A, Correlation in male animals; B, Correlation in female animals
As illustrated in Fig. 6A, male animals showed significant positive correlations between age and Cyp19a1 [ρ=0.84, P=0.001], Esr1 [ρ=0.84, P=0.001], Esr2 [ρ=0.84, P=0.001], and Gper1 [ρ=0.84, P=0.001] expression and no correlation with Ar values [ρ=-0,12, P=0.72]. Similarly, female animals showed significant positive correlations between age and Cyp19a1 [ρ=0.84, P=0.001], Esr1 [ρ=0.84, P=0.001], Esr2 [ρ=0.84, P=0.001], and Gper1 [ρ=0.84, P=0.001] but significant negative correlation with Ar values [ρ=-0.84, P=0.001] (Fig. 6B).
Discussion
Prior research has demonstrated that inhibiting aromatase increases excitability in small and medium-diameter dorsal root ganglion primary sensory neurons of male rats, suggesting a role for aromatase activity in pain perception regulation [21]. Aromatase immunoreactivity has indeed been identified in primary sensory neurons, although not in satellite cells of the dorsal root ganglia [30]. A similar pattern of aromatase immunoreactivity was observed in the trigeminal ganglion in the current study. However, aromatase immunoreactivity was detected in sensory neurons irrespective of diameter, implying that neuroestradiol could be involved in modulating all sensory modalities of the trigeminal nerve, rather than exclusively pain transmission. In line with previous reports on the expression of ERs in the sensory ganglia of rodents [8, 10, 14], our study detected the expression of Esr1, Esr2, and Gper1, genes encoding ERs, in the trigeminal ganglion. This suggests that neuroestradiol, produced by aromatase-positive trigeminal sensory neurons, may directly act on ERs expressed in the ganglion.
We also investigated the expression of Ar in the trigeminal ganglion, as aromatase indirectly affects AR signaling by reducing testosterone levels. The detection of Ar in the trigeminal ganglion supports previous findings in adult rats [31–33].
The elevated expression of Cyp19a1 observed in males in our study implies that testosterone conversion to estradiol is enhanced in this sex. Since estradiol is known to decrease pain perception through actions on primary sensory neurons [8–10], sex differences in aromatase expression may contribute to the observed sex differences in trigeminal neuralgia [34, 35] by increasing neuroestradiol production in male ganglia.
Moreover, observed sex differences in the expression of Esr1 (higher in females), Esr2, and Gper1 (both higher in males) could potentially create disparities in estrogen signaling in primary sensory neurons, thereby contributing to sex differences in pain perception. In contrast, testosterone, by acting on ARs [35], leads to a decrease in pain perception. Furthermore, AR binding sites have been identified in the promoter of cannabinoid type 1 (CB1) receptors [31], which play a role in modulating analgesia within the trigeminal ganglion [31, 36]. Thus, the higher Ar expression detected in the female trigeminal ganglion could also contribute to sex differences in trigeminal pain transmission.
Sex differences in aromatase expression have been observed in various regions of the nervous system and are influenced by perinatal sex hormone levels [37]. Moreover, the sex chromosome complement has been implicated in generating sex differences in some brain structures, such as the anterior amygdala and the stria terminalis [28] in some brain structures, such as the anterior amygdala and the stria terminalis. In order to investigate the mechanisms driving sex differences in Cyp19a1 in the trigeminal ganglion, we utilized the four-core genotype (FCG) model, allowing for the assessment of the effects of ovarian hormones, sex chromosome complement, or their interaction in determining mouse traits [23].
Our findings indicate that sex differences in Cyp19a1 expression within the mouse trigeminal ganglion are solely dependent on sex hormones, with the presence of testes resulting in higher expression levels. This suggests that elevated androgen levels in males, acting on AR or ERβ [28] lead to higher aromatase expression in the male trigeminal ganglion.
Our research also uncovers sex differences in the expression of genes involved in estrogenic and androgenic signaling within the trigeminal ganglion. Employing the FCG model, we observed that the presence of the XY chromosome complement enhances Ar expression in both phenotypically male and female animals, in comparison to those with the XX complement. In contrast, the sex chromosome complement did not impact Esr1, Esr2, and Gper1 expression levels, the genes encoding ERs. Furthermore, we discovered that, despite the effect of sex chromosome complement on Ar expression, sex differences in the expression of genes involved in androgen and estrogen signaling were exclusively determined by the gonadal sex.
Sex differences in the nervous system that depend on gonadal sex may be affected by fluctuations in sex hormone levels during an individual's lifespan, including aging. This may be the case for sex differences in pain perception [38], which tend to demonstrate higher pain sensitivity in women. Pain threshold increases with age [39] and aging-related changes that may contribute to a decline in pain perception have been detected in somatosensory neurons of the trigeminal ganglion [40]. In line with previous findings on changes in ER and AR expression in various regions of the nervous system of older animals [41–43], we observed increased expression of genes encoding ERs and decreased expression of the gene encoding AR in aged animals of both sexes. This suggests that aging alters the actions of ovarian and testicular hormones on trigeminal ganglion function.
Aging not only affects the expression of AR and ERs in the nervous system but also impacts aromatase expression. Indeed, changes in aromatase expression have been reported in specific brain regions of older individuals, such as the cerebral cortex and the hippocampus, where an increase in aromatase availability or immunoreactivity has been identified [42, 44]. Our results suggest that this may also be the case for the trigeminal ganglion, where we found that Cyp19a1 expression increases with age in both sexes.
Regression and correlation analyses of individual data from all animals included in the current study indicate a possible coregulation of the expression of the enzyme involved in estradiol synthesis and the expression of ERs in the trigeminal ganglion, as demonstrated in other systems [45]. This may explain the parallel increase in the expression of Cyp19a1, Esr1, Esr2, and Gper1 in the trigeminal ganglion of older animals.
Given that neuroestradiol, acting on ERs [22], decreases nociception, the increased expression of Cyp19a1, Esr1, Esr2, and Gper1 in aged animals may potentiate estrogenic signaling, reducing pain transmission by sensory neurons. However, it must be noted that the decrease in Ar in older animals could have the opposite effect, increasing pain perception [34, 35] Fanton et al., 2017. Additionally, another consequence of the changes in the expression of Cyp19a1 and the genes coding for ERs and AR in the trigeminal ganglion with age is that the direction of sex differences in expression patterns observed in young animals becomes inverted in older animals. The functional implications of this inversion for sex differences in pain perception have yet to be determined.
Future research should involve translational studies to confirm if the observed patterns in mice also occur in humans. Investigating the expression of aromatase, estrogen receptors (ERs), and androgen receptors (ARs) in human trigeminal ganglia and correlating these findings with clinical pain conditions can provide valuable insights into the relevance of these molecular changes in human pain perception and may represent possible therapeutic interventions targeting aromatase and estrogen receptors for trigeminal pain management.
Study Limitations: Primarily, this research is limited by the use of animal models, specifically mice, to study complex biological processes. Although the genetic homology between humans and mice provides a valuable framework for understanding mechanisms under controlled experimental settings, the intrinsic anatomical and physiological differences between the species could potentially limit the extrapolation of the findings to humans. In clinical contexts, trigeminal neuralgia is more frequently observed in older adults and presents a gender bias, being more prevalent in women, which is mirrored in our study's findings in mice. While this underscores the potential role of neuroestradiol pathways in the modulation of pain, further studies are needed to confirm their relevance and translate these insights into the human context.
Conclusions
In conclusion, we here demonstrate that aromatase, the enzyme involved in the synthesis of neuroestradiol, is expressed in primary sensory neurons at the very entrance of the trigeminal sensory pathway and that this expression is altered in older individuals. The existence of sex chromosome-independent sex differences in the expression of aromatase and of the genes encoding ERs indicate that neuroestradiol synthesis and signaling in the trigeminal ganglion is affected by gonads. Furthermore, the observed changes with aging in aromatase and ER expression suggest that the modulation exerted by neuroestradiol on the trigeminal somatosensory input, including pain, is altered in older male and female individuals in a sex-specific manner.
Acknowledgments
We heartily thank Prof Ángel Nuñez (Autonoma University of Madrid) for kindly providing us with the trigeminal ganglia of the aged animals.
Author contributions
DG designed and supervised the experiments; AB, NGN, DPB, JECP, CVAL, DGa, PN, and NL performed the experiments; DG, MA, and LMGS prepared the figures for publication; DG, MA, and LMGS wrote the first draft of the manuscript; all authors read and approved the manuscript.
Funding
Open Access funding provided thanks to the CRUE-CSIC agreement with Springer Nature. This work was supported by the Universidad Autónoma de Madrid – Comunidad Autónoma de Madrid, Programa de estímulo a la investigación de jóvenes doctores [grant number: SI3-PJI-2021-00508], Agencia Estatal de Investigación, Spain, and Fondo Europeo de Desarrollo Regional (FEDER) [grant number: PID2020-115019RB-I00; PID2021-125039NB-I00], Centro de Investigación Biomédica en Red Fragilidad y Envejecimiento Saludable (CIBERFES), Instituto de Salud Carlos III, Madrid.
Data availability
Data are available on request from the authors. The data that support the findings of this study are available from the corresponding author upon reasonable request.
Declarations
Ethics approval and consent to participate
All experiments were designed according to the "Guidelines for the Use of Animals in Neuroscience Research" by the Society for Neuroscience and following the European Union legislation (Council Directives 86/609/EEC and 2010/63/UE), and the Spanish Government Directive (RD 1201/2005). Experimental procedures were approved by our Institutional Bioethical Committees (Comité de Ética de Experimentación Animal del Instituto Cajal and Comité de Ética de Experimentación Animal de la Universidad Autonoma de Madrid) and by the Consejería del Medio Ambiente y Territorio (Comunidad de Madrid, PROEX 059.5/21 and PROEX 096.7/22). Special care was taken to minimize animal suffering and to reduce the number of animals used to the minimum necessary.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Álvaro Bautista-Abad and Nuria García-Magro contributed equally to this work.
Contributor Information
Maria-Angeles Arevalo, Email: arevalo@cajal.csic.es.
Daniela Grassi, Email: daniela.grassi@uam.es.
References
- 1.McIntyre S, Nagi SS, McGlone F, Olausson H. The Effects of Ageing on Tactile Function in Humans. Neuroscience. 2021;464:53–8. 10.1016/j.neuroscience.2021.02.015. [DOI] [PubMed] [Google Scholar]
- 2.Giovannini S, Coraci D, Brau F, Galluzzo V, Loreti C, Caliandro P, Padua L, Maccauro G, Biscotti L, Bernabei R. Neuropathic Pain in the Elderly. Diagnostics (Basel). 2021;11(4):613. 10.3390/diagnostics11040613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Svedung Wettervik T, Snel D, Kristiansson P, Ericson H, Abu HS. Incidence of trigeminal neuralgia: A population-based study in Central Sweden. Eur J Pain. 2023;27(5):580–7. 10.1002/ejp.2081. [DOI] [PubMed] [Google Scholar]
- 4.Stompór M, Grodzicki T, Stompór T, Wordliczek J, Dubiel M, Kurowska I. Prevalence of Chronic Pain, Particularly with Neuropathic Component, and Its Effect on Overall Functioning of Elderly Patients. Med Sci Monit. 2019;25:2695–701. 10.12659/MSM.911260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Singh SP, Guindon J, Mody PH, Ashworth G, Kopel J, Chilakapati S, Adogwa O, Neugebauer V, Burton MD. Pain and aging: A unique challenge in neuroinflammation and behavior. Mol Pain. 2023;19:17448069231203090. 10.1177/17448069231203090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Presto P, Mazzitelli M, Junell R, Griffin Z, Neugebauer V. Sex differences in pain along the neuraxis. Neuropharmacology. 2022;210:109030. 10.1016/j.neuropharm.2022.109030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.De Toledo IP, Conti Réus J, Fernandes M, Porporatti AL, Peres MA, Takaschima A, Linhares MN, Guerra E, De Luca Canto G. Prevalence of trigeminal neuralgia: A systematic review. J Am Dent Assoc. 2016;147(7):570–576.e2. 10.1016/j.adaj.2016.02.014. [DOI] [PubMed] [Google Scholar]
- 8.Bi RY, Meng Z, Zhang P, Wang XD, Ding Y, Gan YH. Estradiol upregulates voltage-gated sodium channel 1.7 in trigeminal ganglion contributing to hyperalgesia of inflamed TMJ. PLoS One. 2017;12(6):e0178589. 10.1371/journal.pone.0178589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Chen Q, Zhang W, Sadana N, Chen X. Estrogen receptors in pain modulation: cellular signaling. Biol Sex Differ. 2021;12(1):22. 10.1186/s13293-021-00364-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kaur S, Hickman TM, Lopez-Ramirez A, McDonald H, Lockhart LM, Darwish O, Averitt DL. Estrogen modulation of the pronociceptive effects of serotonin on female rat trigeminal sensory neurons is timing dependent and dosage dependent and requires estrogen receptor alpha. Pain. 2022;163(8):e899–916. 10.1097/j.pain.0000000000002604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Bereiter DA, Cioffi JL, Bereiter DF. Oestrogen receptor-immunoreactive neurons in the trigeminal sensory system of male and cycling female rats. Arch Oral Biol. 2005;50(11):971–9. 10.1016/j.archoralbio.2005.03.010. [DOI] [PubMed] [Google Scholar]
- 12.Puri V, Cui L, Liverman CS, Roby KF, Klein RM, Welch KM, Berman NE. Ovarian steroids regulate neuropeptides in the trigeminal ganglion. Neuropeptides. 2005;39(4):409–17. 10.1016/j.npep.2005.04.002. [DOI] [PubMed] [Google Scholar]
- 13.Liverman CS, Brown JW, Sandhir R, McCarson KE, Berman NE. Role of the oestrogen receptors GPR30 and ERalpha in peripheral sensitization: relevance to trigeminal pain disorders in women. Cephalalgia. 2009;29(7):729–41. 10.1111/j.1468-2982.2008.01789.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Warfvinge K, Krause DN, Maddahi A, Edvinsson JCA, Edvinsson L, Haanes KA. Estrogen receptors α, β and GPER in the CNS and trigeminal system - molecular and functional aspects. J Headache Pain. 2020;21(1):131. 10.1186/s10194-020-01197-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Evrard HC, Balthazart J. Rapid regulation of pain by estrogens synthesized in spinal dorsal horn neurons. J Neurosci. 2004;24(33):7225–9. 10.1523/JNEUROSCI.1638-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Tran M, Kuhn JA, Bráz JM, Basbaum AI. Neuronal aromatase expression in pain processing regions of the medullary and spinal cord dorsal horn. J Comp Neurol. 2017;525(16):3414–28. 10.1002/cne.24269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Storman EM, Liu NJ, Wessendorf MW, Gintzler AR. Physical Linkage of Estrogen Receptor α and Aromatase in Rat: Oligocrine and Endocrine Actions of CNS-Produced Estrogens. Endocrinology. 2018;159(7):2683–97. 10.1210/en.2018-00319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Laroche F, Coste J, Medkour T, Cottu PH, Pierga JY, Lotz JP, Beerblock K, Tournigand C, Declèves X, de Cremoux P, Bouhassira D, Perrot S. Classification of and risk factors for estrogen deprivation pain syndromes related to aromatase inhibitor treatments in women with breast cancer: a prospective multicenter cohort study. J Pain. 2014;15(3):293–303. 10.1016/j.jpain.2013.11.004. [DOI] [PubMed] [Google Scholar]
- 19.Fusi C, Materazzi S, Benemei S, Coppi E, Trevisan G, Marone IM, Minocci D, De Logu F, Tuccinardi T, Di Tommaso MR, Susini T, Moneti G, Pieraccini G, Geppetti P, Nassini R. Steroidal and non-steroidal third-generation aromatase inhibitors induce pain-like symptoms via TRPA1. Nat Commun. 2014;5:5736. 10.1038/ncomms6736. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Ghorbanpoor S, Garcia-Segura LM, Haeri-Rohani A, Khodagholi F, Jorjani M. Aromatase inhibition exacerbates pain and reactive gliosis in the dorsal horn of the spinal cord of female rats caused by spinothalamic tract injury. Endocrinology. 2014;155(11):4341–55. 10.1210/en.2014-1158. [DOI] [PubMed] [Google Scholar]
- 21.Robarge JD, Duarte DB, Shariati B, Wang R, Flockhart DA, Vasko MR. Aromatase inhibitors augment nociceptive behaviors in rats and enhance the excitability of sensory neurons. Exp Neurol. 2016;281:53–65. 10.1016/j.expneurol.2016.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Gintzler AR, Storman EM, Liu NJ. Estrogens as arbiters of sex-specific and reproductive cycle-dependent opioid analgesic mechanisms. Vitam Horm. 2019;111:227–46. 10.1016/bs.vh.2019.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Arnold AP. Four Core Genotypes and XY* mouse models: Update on impact on SABV research. Neurosci Biobehav Rev. 2020;119:1–8. 10.1016/j.neubiorev.2020.09.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Itoh Y, Mackie R, Kampf K, Domadia S, Brown JD, O'Neill R, Arnold AP. Four core genotypes mouse model: localization of the Sry transgene and bioassay for testicular hormone levels. BMC Res Notes. 2015;8:69. 10.1186/s13104-015-0986-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Llorente R, Marraudino M, Carrillo B, Bonaldo B, Simon-Areces J, Abellanas-Pérez P, Rivero-Aguilar M, Fernandez-Garcia JM, Pinos H, Garcia-Segura LM, Collado P, Grassi D. G Protein-Coupled Estrogen Receptor Immunoreactivity Fluctuates During the Estrous Cycle and Show Sex Differences in the Amygdala and Dorsal Hippocampus. Front Endocrinol (Lausanne). 2020;11:537. 10.3389/fendo.2020.00537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yague JG, Muñoz A, de Monasterio-Schrader P, Defelipe J, Garcia-Segura LM, Azcoitia I. Aromatase expression in the human temporal cortex. Neuroscience. 2006;138(2):389–401. 10.1016/j.neuroscience.2005.11.054. [DOI] [PubMed] [Google Scholar]
- 27.Ruiz-Palmero I, Hernando M, Garcia-Segura LM, Arevalo MA. G protein-coupled estrogen receptor is required for the neuritogenic mechanism of 17β-estradiol in developing hippocampal neurons. Mol Cell Endocrinol. 2013;372(1-2):105–15. 10.1016/j.mce.2013.03.018. [DOI] [PubMed] [Google Scholar]
- 28.Cisternas CD, Cabrera Zapata LE, Arevalo MA, Garcia-Segura LM, Cambiasso MJ. Regulation of aromatase expression in the anterior amygdala of the developing mouse brain depends on ERβ and sex chromosome complement. Sci Rep. 2017;7(1):5320. 10.1038/s41598-017-05658-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.R Core Team. R: a language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2021. https://www.R-project.org/. Accessed 15 Dec 2021.
- 30.Schaeffer V, Meyer L, Patte-Mensah C, Eckert A, Mensah-Nyagan AG. Sciatic nerve injury induces apoptosis of dorsal root ganglion satellite glial cells and selectively modifies neurosteroidogenesis in sensory neurons. Glia. 2010;58(2):169–80. 10.1002/glia.20910. [DOI] [PubMed] [Google Scholar]
- 31.Lee KS, Asgar J, Zhang Y, Chung MK, Ro JY. The role of androgen receptor in transcriptional modulation of cannabinoid receptor type 1 gene in rat trigeminal ganglia. Neuroscience. 2013;254:395–403. 10.1016/j.neuroscience.2013.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Lee KS, Zhang Y, Asgar J, Auh QS, Chung MK, Ro JY. Androgen receptor transcriptionally regulates μ-opioid receptor expression in rat trigeminal ganglia. Neuroscience. 2016;331:52–61. 10.1016/j.neuroscience.2016.06.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Young WJ, Chang C. Ontogeny and autoregulation of androgen receptor mRNA expression in the nervous system. Endocrine. 1998;9(1):79–88. 10.1385/ENDO:9:1:79. [DOI] [PubMed] [Google Scholar]
- 34.Fanton LE, Macedo CG, Torres-Chávez KE, Fischer L, Tambeli CH. Activational action of testosterone on androgen receptors protects males preventing temporomandibular joint pain. Pharmacol Biochem Behav. 2017;152:30–5. 10.1016/j.pbb.2016.07.005. [DOI] [PubMed] [Google Scholar]
- 35.Shaefer JR, Khawaja SN, Bavia PF. Sex, Gender, and Orofacial Pain. Dent Clin North Am. 2018;62(4):665–82. 10.1016/j.cden.2018.06.001. [DOI] [PubMed] [Google Scholar]
- 36.Li ZW, Zhang J, Ouyang CH, Li CY, Zhao FB, Liu YW, Ai YX, Hu WP. Potentiation by WIN 55,212-2 of GABA-activated currents in rat trigeminal ganglion neurones. Br J Pharmacol. 2009;158(8):1904–10. 10.1111/j.1476-5381.2009.00482.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Roselli CE, Klosterman SA. Sexual differentiation of aromatase activity in the rat brain: effects of perinatal steroid exposure. Endocrinology. 1998;139(7):3193–201. 10.1210/endo.139.7.6101. [DOI] [PubMed] [Google Scholar]
- 38.Athnaiel O, Cantillo S, Paredes S, Knezevic NN. The Role of Sex Hormones in Pain-Related Conditions. Int J Mol Sci. 2023;24(3):1866. 10.3390/ijms24031866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Lautenbacher S, Peters JH, Heesen M, Scheel J, Kunz M. Age changes in pain perception: A systematic-review and meta-analysis of age effects on pain and tolerance thresholds. Neurosci Biobehav Rev. 2017;75:104–13. 10.1016/j.neubiorev.2017.01.039. [DOI] [PubMed] [Google Scholar]
- 40.Oto T, Urata K, Hayashi Y, Hitomi S, Shibuta I, Iwata K, Iinuma T, Shinoda M. Age-Related Differences in Transient Receptor Potential Vanilloid 1 and 2 Expression Patterns in the Trigeminal Ganglion Neurons Contribute to Changes in the Palatal Mucosal Heat Pain Sensitivity. Tohoku J Exp Med. 2022;256(4):283–90. 10.1620/tjem.2022.J004. [DOI] [PubMed] [Google Scholar]
- 41.Wilson ME, Rosewell KL, Kashon ML, Shughrue PJ, Merchenthaler I, Wise PM. Age differentially influences estrogen receptor-alpha (ERalpha) and estrogen receptor-beta (ERbeta) gene expression in specific regions of the rat brain. Mech Ageing Dev. 2002;123(6):593–601. 10.1016/s0047-6374(01)00406-7. [DOI] [PubMed] [Google Scholar]
- 42.Ishunina TA, Fischer DF, Swaab DF. Estrogen receptor alpha and its splice variants in the hippocampus in aging and Alzheimer's disease. Neurobiol Aging. 2007;28(11):1670–81. 10.1016/j.neurobiolaging.2006.07.024. [DOI] [PubMed] [Google Scholar]
- 43.Wu D, Gore AC. Changes in androgen receptor, estrogen receptor alpha, and sexual behavior with aging and testosterone in male rats. Horm Behav. 2010;58(2):306–16. 10.1016/j.yhbeh.2010.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Biegon A. In vivo visualization of aromatase in animals and humans. Front Neuroendocrinol. 2016;40:42–51. 10.1016/j.yfrne.2015.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Yilmaz MB, Zhao H, Brooks DC, Fenkci IV, Imir-Yenicesu G, Attar E, Akbal E, Kaynak BA, Bulun SE. Estrogen receptor alpha (Esr1) regulates aromatase (Cyp19a1) expression in the mouse brain. Neuro Endocrinol Lett. 2015;36(2):178–82. [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data are available on request from the authors. The data that support the findings of this study are available from the corresponding author upon reasonable request.