Generation of TrkA/TrkB Chimeric Receptor Constructs Reveals Molecular Mechanisms Underlying BDNF-Induced Dendritic Outgrowth in Hippocampal Neurons

Abstract

Neurotrophins (NTs) regulate neuronal survival, differentiation, and synaptic plasticity through tropomyosin receptor kinases (Trks). The molecular mechanisms underlying these functions, however, have remained incompletely understood. In the present study, we first showed that brain-derived neurotrophic factor (BDNF) increased both the number of primary dendrites and dendritic complexity in cultured hippocampal neurons. Since hippocampal neurons predominantly express the BDNF receptor TrkB, but not the nerve growth factor (NGF) receptor Trk, we generated DNA constructs encoding the extracellular domain of TrkA fused with the transmembrane and intracellular domain of TrkB and introduced these constructs into cultured hippocampal neurons. To visualize the dendrites, the TrkA/TrkB fusion proteins were bicistronically expressed with green fluorescence protein (GFP). Interestingly, the GFP-labeled neurons grew dendrites and activated the TrkA/TrkB receptors in response to NGF, but not BDNF. We next generated a series of TrkA/TrkB receptors with mutations at tyrosine residues in the TrkB kinase domain, and sought to identify the signaling pathway required for NT-induced dendrite outgrowth. Sholl analyses demonstrated that TrkB signaling through Shc, but not through PLC-γ, plays a crucial role in NT-elicited dendritic outgrowth in hippocampal neurons.

Introduction

Neurons are highly morphologically differentiated cells with axons and dendrites, which interact via synapses to form neuronal circuits and exert synaptic transmission. The structural complexity of these circuits is regulated both by cell-intrinsic and cell-extrinsic programs (McAllister 2002; Dijkhuizen and Ghosh 2005a). Cell-extrinsic mechanisms play a prominent role in vertebrates and involve the secretion of diffusible growth factors. The neurotrophins (NTs) are a well-studied growth factor family, including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), NT-3, and NT-4/5. NTs regulate neurite outgrowth, neuronal survival, and synaptic transmission in vitro and in vivo (Bibel and Barde 2000; Poo 2001).

To exert their biological actions in neurons, NTs initially bind to NT receptors. These high-affinity receptors have been identified as members of the tyrosine kinase receptor family, Trks, and include the NGF-activating receptor TrkA, the BDNF and NT-4-activating receptor TrkB, and the NT-3-activating receptor TrkC (Reichardt 2006). NTs also interact with an additional, distinct receptor, named p75 NT receptor (p75^NTR), which has been characterized as a low-affinity receptor. All NTs bind to p75^NTR with a similar affinity (Chao 2003). Upon binding to NTs, Trk receptors rapidly activate their tyrosine kinases and trigger multiple intracellular signaling pathways in neurons (Huang and Reichardt 2001). The cytoplasmic domains of Trk receptors contain several tyrosine residues. In vertebrates, Trk receptors contain 10 conserved tyrosine residues in their cytoplasmic domains; of these, Y670, Y674, and Y675 (in the human TrkA sequence) are located within the auto-regulatory loop of the tyrosine kinase domain. Binding to NTs leads to rapid phosphorylation of these tyrosine residues and activation of downstream signal transducers (Reichardt 2006).

Do these tyrosine residues exert distinct roles in the diverse biological functions of NTs? Substantial research has demonstrated that Y490 and Y785 are crucial residues for NT-related, Trk receptor-dependent axon outgrowth and synaptic plasticity (Atwal et al. 2000; Minichiello et al. 2002). Phospho-Y490 provides a recruitment site for both Shc and Frs2, which links to Ras, PI3-kinase, and other pathways. Phospho-Y785 recruits the enzyme PLC-γ1, and the activation of this enzyme results in Ca²⁺ and protein kinase C mobilization (Huang and Reichardt 2003). Recent reports have demonstrated the existence of many other adaptor proteins, which could mediate novel NT/Trk signaling pathways via Y490 and Y785 (Huang and Reichardt 2003), raising the possibility that Trk receptor-mediated signaling could exert distinct biological actions among different subpopulations of neurons.

Cell lines, primary neurons, and transgenic mouse lines expressing mutant Trk receptors have been used extensively to elucidate the molecular mechanisms underlying signaling pathways downstream of Trk receptors. In the present study, we generated a construct expressing a TrkA/TrkB chimeric receptor, in which the extracellular domain of one Trk receptor was fused with the intracellular domain of another Trk receptor. This strategy allowed us to rule out redundant signal transduction through multiple Trk receptors and enabled the enhanced elucidation of molecular mechanisms downstream of Trk receptors, since TrkB is a high-affinity receptor for both BDNF and NT-4/5 and low-affinity receptor for NT-3. In addition, we examined whether NGF could exert neurotrophic actions in hippocampal neurons in place of BDNF, NT-3, and NT-4/5, since hippocampal neurons predominantly express the TrkB receptor (for BDNF), but not the TrkA receptor (for NGF) (Barbacid 1995). Here, using these TrkA/TrkB chimeric receptor constructs, we sought to identify tyrosine residues crucial for NGF-dependent dendritic outgrowth in cultured hippocampal neurons. Interestingly, we found that the TrkA/TrkB chimeric receptors activated Trk kinase activity and promoted dendritic outgrowth in cultured hippocampal neurons in response to NGF. To our knowledge, this is the first demonstration that NGF elicits growth of primary dendrites and increases dendritic complexity in cultured hippocampal neurons in response to the introduction of TrkA/TrkB fusion receptors.

Materials and Methods

Antibodies and Chemicals

Recombinant mature BDNF was kindly provided by Dainippon Sumitomo Pharmaceuticals (Osaka, Japan). NGF (2.5S) was prepared from male mouse submandibular glands as described by Bocchini and Angeletti (1969), with some modifications by Suda et al. (1978). Anti-pan-Trk purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); anti-phospho-Trk (Y490) from Cell Signaling Technology (Danvers, MA, USA); antibody against the entire extracellular (EC) domain of TrkA receptor from Millipore (Billerica, MA, USA); and anti-microtube-associated protein 2 (MAP2) from Sigma (St. Louis, MO, USA). Wistar ST rats were purchased from NIPPON SLC (Hamamatsu, Japan).

Cell Culture

Dissociated cultures of hippocampal neurons were prepared using embryonic day-20 rats (E20, Wistar ST) as previously described (Egan et al. 2003). This procedure was strictly in accord with the protocols approved by the Institutional Animal Care and Use Committee of AIST, Japan. After 2 days of growth in medium composed of 5% fetal bovine serum (ICN Biomedicals Inc., Aliso Viejo, CA, USA), 5% horse serum (Gibco, Carlsbad, CA, USA), and 90% DMEM (Sigma), the media were changed to Neurobasal Medium (Gibco) containing 2% B27 supplement (Gibco) and 0.5 mM l-glutamine (Sigma) for BDNF (Figs. 1, 2) and NGF (Fig. 7). For the dendrite outgrowth assay, polyethyleneimine-coated glass-bottomed chambers (surface area, 1.5 cm², Matsunami Glass, Ind., Ltd., Osaka, Japan) were used, and 12-well culture plates (Costar, Cambridge, MA, USA) were used for Western blots (Fig. 6). Cell density of hippocampal neurons was 2.5 × 10⁵ cells/cm². COS7 cells were maintained in medium composed of 5% fetal bovine serum, 5% horse serum, and 90% DMEM for DNA transfection experiments.

Fig. 1.

Effect of BDNF on dendrite growth in cultured hippocampal neurons. a BDNF elicits growth of hippocampal dendrites (arrows). Two-day cultured hippocampal neurons were either untreated or treated with 200 ng/ml of BDNF for 3 days and then immunostained using anti-MAP2 antibody. Fluorescence images of the stained neurons were taken using confocal microscopy. Scale bar, 20 μm. b, c Quantitative analyses of dendritic growth. The number of primary dendrites extending from the cell body (left, marked in red) was plotted in b and summarized in c. Primary dendrites were counted using Sholl analysis, described in the “Materials and Methods” section. n = 20 independent neurons from three independent culture dishes. ***Significantly different from control, as determined by t test; *P < 0.001. These results are representative of at least three independent experiments. Graph-depicted results compare results for experimental and control groups, and are expressed as means ± SEM

Fig. 2.

Effect of BDNF on dendritic complexity. a Sholl analysis. To quantitatively assess the extent of dendritic complexity, the number of dendrites intersecting with each concentric ring (black circles) was counted. b–d Fluorescence images of MAP2-labeled hippocampal neurons (Fig. 1) were taken and the number of dendrites intersecting with rings at 15 and 25 μm from the center of the cell body was determined. *Significantly different from control as determined by t test; ***P < 0.05. n = 20 independent neurons in each group. In c and d, the numbers of primary dendrites intersecting with circles of the indicated radii were plotted in b, c and summarized in d

Fig. 7.

Tyrosine residues are required for NGF-elicited dendritic complexity. Sindbis virus infection was performed on 4-day cultured hippocampal neurons. Twenty-four hours later, medium was changed to neurobasal medium containing 2% B27 supplement and 0.5 mM l-glutamine for 12 h. Neurons overexpressing each of the four TrkA/TrkB fusion protein variants, along with GFP, were treated with NGF (100 ng/ml) for 3 days and fixed for imaging. a Sample images of hippocampal neurons expressing the indicated construct. GFP-labeled dendritic branches were imaged using a confocal microscope. b Summary of quantitative analysis of dendritic growth. Dendritic complexity was quantitated as described in Fig. 2. *Significant difference from A/B-wild group as determined by t test, *P < 0.05. n = 20 independent neurons in each group. Results are representative of at least three independent experiments. Scale bar, 20 μm

Fig. 6.

NGF-induced activation of TrkA/TrkB fusion receptors in cultured hippocampal neurons. The indicated construct was overexpressed using a Sindbis virus expression system as described in Fig. 5. Two days after virus infection, cells were cultured in serum-free Neurobasal medium for 12 h and then treated with NGF (100 ng/ml) or BDNF (100 ng/ml) for 5 min. Cell lysates were collected for immunoblotting with the indicated antibodies. The activation and expression of TrkA/TrkB chimeric receptors were studied using antibodies specific for phospho-Tyr490 (upper arrow) and the EC domain of TrkA receptor (lower arrow), respectively. Bars on the left indicate the location of molecular size markers indicating 175 kDa (upper) and 83 kDa (lower)

DNA Construction, Sindbis Virus Generation, and Transfection

Rat TrkA cDNA was generously provided by Prof. E. M. Shooter (Stanford University, Stanford, CA, USA). Rat TrkB cDNAs with point mutations to delete ATP binding sites and the binding sites for Shc and PLCγ in their tyrosine kinase domains were generated by PCR-based mutagenesis, as described (Atwal et al. 2000). All these mutations were checked by sequencing. To generate TrkA/TrkB chimeric receptor cDNAs, DNA fragments encoding the extracellular (EC) domain of TrkA receptor (Met at codon 1 to Arg at codon 408), and the transmembrane (TM) and intracellular (IC) domains of TrkB receptor (Valine at codon 409 to Glycine at codon 821) were constructed using PCR and ligated using an overlap extension procedure. For the PCR step, the following oligonucleotides were used: GTGGACACTAACAGCACATCTAGA, CACCTGTGATTGTCGTGTAGATCTGATC, and TCTAGAGTTGCTGACCAAACC. All of the constructs were confirmed by DNA sequencing.

To express the TrkA/TrkB chimeric receptors in COS7 cells, the cDNA fragments were subcloned into Not I and EcoR I sites of pBudCE4 expression vectors (Invitrogen, Carlsbad, CA, USA). To visualize the cells expressing the TrkA/TrkB chimeric receptors, a GFP cDNA fragment was excised from a pEGFP-N1 vector (Clontech, Mountain View, CA, USA) and ligated into HindIII and XbaI sites in the pBudCE4 vector. In the resulting construct, a human elongation factor 1 alpha promoter controls the expression of the TrkA/TrkB chimeric receptors and a CMV promoter controls the expression of GFP. COS7 cells were grown in culture dishes (Nunc, Roskilde, Denmark, surface area, 21.5 cm²) 1–2 days before transfection. The plasmids were then transfected using Transfast transfection reagent (Promega, Madison, WI, USA) according to the manufacturer’s protocol. After a 2-h incubation at 37°C, the cells were incubated in fresh medium composed of 5% fetal bovine serum, 5% horse serum, and 90% DMEM. For western blot analysis, COS7 cells were maintained in DMEM for 2 h and then treated with NGF for 5 min.

To express the TrkA/TrkB chimeric receptors in cultured hippocampal neurons, the cDNAs encoding the TrkA/TrkB fusion proteins (Fig. 3a) were subcloned into the Sindbis vector pSinEGdsp (Okada et al. 2001), which allows the bicistronic expression of GFP and the indicated chimeric protein. Sindbis virus was generated according to the manufacturer’s manual (Invitrogen), and infection was carried out according to the method of Egan et al. (2003) (Egan et al. 2003). Virus infection was performed at 4 days in vitro. The infection was monitored by GFP fluorescence and the titer was approximately 0.5% in most of the experiments. For western blot analysis, neurons were grown in Neurobasal medium for 12 h before NGF application. For the dendrite outgrowth assay, primary neurons were exposed to NGF in neurobasal Medium containing 2% B27 supplement and 0.5 mM l-glutamine for the indicated days after virus infection.

Fig. 3.

Bicistronic expression vector used to coexpress a series of TrkA/TrkB chimeric receptors (TrkA/TrkB fusion proteins) and GFP. a TrkA/TrkB chimeric receptors (A/B-wild, A/B-Shc (−), A/B-PLC (−), and A/B-KN) fuse the extracellular domain (EC) of TrkA with the transmembrane (TM) and intracellular (IC) domains of TrkB. Y504F, Y805F, and K560N are the mutations in the binding sites for these adaptor proteins. The K560N mutation gives rise to a kinase-negative receptor (A/B-KN). b Structure of the bicistronic expression vector (pBudCE4/GFP) for co-expression of GFP and TrkA/TrkB chimeric receptors. A CMV promoter was used to drive GFP expression and an EF1-alpha promoter was used to drive TrkA/TrkB chimeric receptor expression

Western Blot Analysis

Western blot analysis was performed as described previously (Suzuki et al. 2004) with some modifications. Briefly, cultured cells were washed three times with ice-cold TBS buffer containing 20 mM Tris–HCl (pH 7.4), 150 mM NaCl, and quickly lysed in a buffer containing 1% SDS, 10 mM Tris–HCl (pH 7.4), 5 mM EDTA, 2 mM Na₃VO₄, 10 mM NaF, 10 mM Na₄P₂O₄, and 1 mM phenylmethanesulfonyl fluoride (PMSF). Lysates were boiled for 3 min at 100°C, and then sonicated. The lysates (10 μg) were resolved by electrophoresis on SDS-polyacrylamide gels. Proteins were then transferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA) in transfer buffer consisting of 100 mM Tris–HCl (pH 7.4), 192 mM glycine, and 20% (v/v) methanol. The membranes were blocked with 5% (w/v) Skim Milk (Dainippon Sumitomo Pharmaceuticals) containing T-TBS (0.2% (w/v) Tween-20 (Sigma), 20 mM Tris–HCl (pH 8.0), and 150 mM NaCl) for 30 min, and incubated with the indicated antibodies for 1–2 h. After washing with T-TBS, membranes were incubated with peroxidase-coupled secondary antibody at room temperature for 1 h. ImmunoStar Reagents (Wako, Osaka, Japan) were used to visualize the signal.

Immunocytochemistry

Hippocampal neurons were fixed with 4% paraformaldehyde at room temperature for 20 min, rinsed three times with PBS, and blocked with 3% BSA in PBS (PBSB) for 30 min. For MAP2-staining, cells were permeabilized with 0.2% Triton X-100 in PBS for 2 min, then mixed with the primary antibody in PBSB for 90 min, followed by incubation with fluorescent dye-conjugated secondary antibodies for 30 min. For TrkA staining, cells were not permeabilized, and were stained with antibodies specific for the EC domain of the TrkA receptor.

Quantitative Analysis of Dendritic Outgrowth and Complexity

For the experiments depicted in Figs. 1 and 2, neurons were immunostained with MAP2 antibody. Stacked images of the stained neurons were acquired by a Bio-Rad (Hercules, CA, USA) confocal unit (RTS2000) with 2 s exposure time using a Nikon (Tokyo, Japan) 64 × 1.4 NA objective (Kojima et al. 2001). To determine the number of primary dendrites, MAP2-positive branches of at least 10 μm length were selected and the number was counted as described previously (Dijkhuizen and Ghosh 2005b; Suzuki et al. 2004). For Sholl analysis (Figs. 2, 7), MAP2-positive and GFP-labeled neurons were selected randomly and the images were captured. After tracing neurons, concentric rings were drawn at 15 and 25 μm from the center of the cell body, intersections between dendrites and the drawn rings were marked, and the number of these intersections was counted as originally described (Sholl and Uttley 1953). In their entirety, all experiments were performed in a blind manner. The fields used for analysis of the stained cells were chosen randomly.

Statistical Analysis

Data are presented as the means ± SEM. Student’s t test was used for statistical analysis in Figs. 1, 2, and 7.

Results

BDNF Elicits the Growth of Primary Dendrites in Hippocampal Neurons

We recently demonstrated that a 3-day exposure to BDNF (200 ng/ml) led to robust outgrowth of MAP2-positive primary dendrites in cultured cortical neurons (Suzuki et al. 2007). In the present study, to examine the effect of BDNF on the growth of primary dendrites in hippocampal neurons, we prepared cultured hippocampal neurons from E20 rat brains. Three-day exposure to BDNF (200 ng/ml) led to robust growth of MAP2-positive primary dendrites (Fig. 1a, arrows). We then quantified the number of primary dendrites extending from each cell body (Suzuki et al. 2004; Ji et al. 2005). Quantitative analysis revealed that BDNF (200 ng/ml, 3 days) increased the number of primary dendrites by approximately twofold (***P < 0.001) (Fig. 1b, c). This effect of BDNF was dose-dependent (data not shown). We further tested the effect of BDNF on dendritic complexity using Sholl analysis (Sholl and Uttley 1953) (Fig. 2a). Compared with control cells, BDNF-treated hippocampal neurons pronouncedly increased the number of MAP2-positive dendrites at 15 and 25 μm distances from the cell body (Fig. 2b, c). Quantitative analysis revealed that BDNF significantly increased the dendritic complexity of hippocampal neurons (Fig. 2d, 1.3 (±0.28)-fold and 1.5 (±0.35)-fold at 15 and 25 μm, respectively, compared with control cultures; significance was assessed by t test ***P < 0.001). The cell density of cultured neurons used here was 2.5 × 10⁵ cells/cm² and did not affect the number of MAP2-positive neurons in either control or BDNF-treated cultures (Suzuki et al. 2004). Together, these results suggest that BDNF increases both the number of dendrites extending from the cell body and dendritic complexity in hippocampal neurons.

Generation and Characterization of Chimeric Receptor Constructs Encoding TrkA Fused with TrkB

How does BDNF elicit dendritic outgrowth and complexity in hippocampal neurons? In the present study, we sought to identify tyrosine residues implicated in BDNF-induced dendritic outgrowth in hippocampal neurons. Previous reports utilized either (a) cell lines overexpressing the TrkB receptor with tyrosine residue mutations in the intracellular domain, or (b) genetically engineered mice with wild-type TrkB replaced by mutant receptors (reviewed by Reichardt 2006). Since hippocampal neurons predominantly express TrkB receptor (for BDNF), but not TrkA receptor (for NGF) (Barbacid 1995), we generated TrkA/TrkB chimeric receptors, which fuse the extracellular (EC) domain of TrkA receptor to the transmembrane (TM) and intracellular (IC) domains of TrkB receptor (Fig. 3a). A series of TrkA/TrkB chimeric receptor constructs were generated in this study. The first such construct encoded a wild-type TrkB receptor kinase domain (A/B-wild). For the second construct, since the juxtamembrane and carboxyl-terminal domains of TrkB provide binding sites for Shc and PLC-γ, respectively, we generated chimeric receptors with mutations at the binding sites for these adaptor proteins (A/B-Shc (−) and A/B-PLC (−)). For the third construct, as a negative control, kinase-dead TrkA/TrkB receptor was used (A/B-KN), which carries aspartic acid instead of lysine in the ATP-binding site in the TrkB kinase domain (Reichardt 2006).

To investigate the expression and localization of these TrkA/TrkB fusion constructs, we introduced the constructs into COS7 cells. To monitor expression in the cells, a green fluorescence protein (GFP)-encoding DNA fragment was introduced into the vectors using a bicistronic expression system (pBudCE4/GFP) (Fig. 3b). Two days after transfection, the COS7 cells were partially GFP-positive (Fig. 4a), suggesting that the bright cells expressed the TrkA/TrkB chimera. Next, to examine whether NGF application (100 ng/ml, 5 min) activated the TrkA/TrkB fusion receptors, we performed a Western blot analysis using an anti-phospho-Trk antibody (pY490) recognizing the phosphorylated form of the tyrosine residue at the Shc binding site (Binder et al. 1999; Suzuki et al. 2004). Immunoblotting results demonstrated that NGF treatment led to a robust tyrosine phosphorylation of the TrkA/TrkB chimeric receptor in COS7 cells (Fig. 4b; A/B-Wild). Interestingly, however, amino acid mutations either at the Shc binding site or the ATP binding site abolished the specific band (Fig. 4b; A/B-Shc (−) and A/B-KN). Amino acid substitution at the PLC-γ binding site did not affect tyrosine phosphorylation at the Shc binding site (Fig. 4b; A/B-PLC-γ (−)). When BDNF (100 ng/ml, 5 min) was applied to the transfected cells, the phosphorylated band was not detected (data not shown). The putative molecular weight of the TrkA/TrkB chimera (EC domain of TrkA + TM and IC domains of TrkB) was mostly consistent with that of a previous report (Sommerfeld et al. 2000). In re-probing experiments using antibodies against pan-Trk receptors, we detected protein bands with this putative molecular weight in COS7 cells transfected with the plasmid encoding the TrkA/TrkB chimera receptors, but not in controls (Fig. 4c). Together, these results suggested that the TrkA/TrkB fusion proteins from our construct can be expressed in mammalian cells and are activated by NGF.

Fig. 4.

Overexpression of TrkA/TrkB fusion receptors in COS7 cells. a Phase contrast and fluorescence images of COS7 cells overexpressing TrkA/TrkB chimeric receptors, taken 2 days after transfection. The presence of GFP-positive cells in the culture (GFP) indicates that overexpression of TrkA/TrkB was successful. As a control, transfection of pBudCE4/GFP vector (Fig. 3b) was done. Scale bar, 100 μm (b, c) Expression and NGF-dependent activation of TrkA/TrkB fusion receptors. In b, 2 days after transfection, COS7 cells were cultured neurobasal medium containing 2% B27 supplement and 0.5 mM l-glutamine for 12 h and then exposed to NGF (100 ng/ml) for 5 min. The lysates (10 μg) collected from the COS7 cells expressing the indicated construct were subjected to electrophoresis on SDS-PAGE and immuno-blotting analysis was done with anti-phospho-Trk antibody recognizing the phosphorylated form of the tyrosine residue at the Shc binding site. Note that A/B-Wild and A/B-PLC-γ (−), but not A/B-Shc (−) and A/B-KN, were activated by NGF exposure. In c, cell lysates (10 μg) were further analyzed by immuno-blotting with pan-Trk antibody. The arrow in b and c indicates the band corresponding to phospho- and total TrkA/TrkB chimeric receptors, respectively

Expression of TrkA/TrkB Chimeric Receptors in Cultured Hippocampal Neurons

To elucidate the mechanisms underlying NT-elicited dendrite outgrowth, we next expressed a series of TrkA/TrkB chimeric receptors in cultured hippocampal neurons. To visualize the dendritic branches, the TrkA/TrkB fusion protein was bicistronically expressed with GFP (Fig. 5, GFP), using the Sindbis virus expression vector of Okada et al. (2001). To avoid potential complications related to overexpression, the virus titer was normalized to approximately 0.5% (Egan et al. 2003).

Fig. 5.

Distribution of TrkA/TrkB chimeric receptors on the cell surface. Using a Sindbis virus bicistronic expression system, the indicated TrkA/TrkB chimeric receptor variants were co-expressed with GFP in hippocampal neurons grown in culture for 4 days. Three days later, cells were fixed for staining with antibody specific for the EC domain of the TrkA receptor. To examine the localization of the TrkA/TrkB receptors on the cell surface, cells were not permeabilized. Microscopic images were taken as described in “Materials and Methods” section. Note that all TrkA/TrkB chimeric receptors were expressed on the cell surface. Scale bar, 20 μm

Next, to examine whether TrkA/TrkB receptors were localized on the cell surface, the virus-infected neurons were immunostained using antibodies against the EC domain of the TrkA receptor (Clary and Reichardt 1994) (Fig. 5, TrkA). Since immunohistochemistry was done without permeabilization, TrkA immunoreactivity indicated the presence of TrkA/TrkB receptors on the cell surface (Fig. 5, arrows). The hippocampal neurons expressing TrkA/TrkB receptors appeared to extend GFP-positive neurites in a similar manner to control neurons overexpressing GFP only (Fig. 5, control).

Furthermore, to investigate the activation of TrkA/TrkB fusion receptors by NGF, we performed western blot analysis using an anti-phospho-Trk antibody (pY490) (Fig. 6, IB: pY490). A 5-min treatment with 100 ng/ml NGF activated A/B-Wild and A/B-PLC-γ (−), but not A/B-KN and A/B-Shc (−) (Fig. 6, +NGF). In non-transfected cells, the band representing phosphorylated Trk receptor was not detectable (Fig. 6, IB: pY490, none, +NGF and −NGF), suggesting that the activation of A/B-Wild and A/B-PLC-γ (−) occurs in an NGF-dependent manner. We confirmed the expression of a series of TrkA/TrkB fusion receptors in a re-probing experiment using antibodies against TrkA receptor (Fig. 6, IB: TrkA). These results suggest that bicistronic expression of TrkA/TrkB chimeric receptors and GFP can allow the exploration of signaling mechanisms involved in NT-dependent dendritic outgrowth.

Analysis of NT-Elicited Dendritic Outgrowth Using TrkA/TrkB Chimeric Receptors

We next studied NGF-dependent dendritic outgrowth of hippocampal neurons bicistronically expressing TrkA/TrkB receptor and GFP. After treatment for 3 days with NGF (100 ng/ml), we captured the images of GFP-positive dendrites. Figure 7a shows representative microscopic images of the GFP-positive hippocampal neurons. Interestingly, the neurons expressing A/B-Wild or A/B-PLC-γ (−) appeared to increase the number of their dendrites while the cells expressing A/B-KN or A/B-Shc (−) did not dramatically exhibit NGF-induced differentiation. We thus performed Sholl analysis to quantitate the number of GFP-positive dendrites at the intersections of 15 and 25 μm from the center of the soma, as in Fig. 2b, c. Interestingly, NGF-induced increases in the dendritic complexity of hippocampal neurons expressing A/B-Wild and A/B-PLC-γ (−) were significantly higher than those in the cells expressing A/B-KN and A/B-Shc (−) (Fig. 7b, significance determined by t test; *P < 0.05, compared with A/B-Wild). Taken together with the results from western blotting (Fig. 6, IB: TrkA), these morphological data suggest that the activation of the Trk receptor kinase domain, and in particular, the phosphorylation of the tyrosine residue at the Shc binding site, is important for NT-dependent dendritic outgrowth and differentiation of hippocampal neurons.

Discussion

A remarkable feature of neuronal cells is their ability to undergo structural differentiation. However, the mechanisms underlying the development of axons and dendrites remain incompletely understood. A family of extrinsic signaling molecules, NTs, regulates morphological differentiation, and there is accumulating evidence demonstrating that NTs also participate in the regulation of neurite outgrowth, neuronal survival, and synaptic transmission in vitro and in vivo (Bibel and Barde 2000; Dijkhuizen and Ghosh 2005a; McAllister 2002; Poo 2001).

The aim of the present study was to examine the effect of BDNF on dendritic extension in hippocampal neurons and the effect of NGF on dendritic outgrowth in neurons expressing a series of DNA constructs encoding the TrkA extracellular domain fused with the transmembrane and intracellular domain of TrkB (TrkA/TrkB chimeric receptors). Several findings resulted from the present study. First, we showed that BDNF treatment (100 ng/ml, 3 days) increased the number of primary dendrites extending from the cell body. Interestingly, quantitative Sholl analysis revealed that BDNF significantly augmented dendritic complexity at 3 days after BDNF application. Since there was no significant difference in the number of MAP2-positive cells between control and BDNF-treated groups (data not shown), we believe that a substantial role for BDNF, according to our results in cultured hippocampal neurons, is to promote dendrite outgrowth in hippocampal neurons.

Second, to elucidate the signaling mechanism underlying BDNF-induced dendritic outgrowth, we considered that hippocampal neurons predominantly express TrkB receptor, the receptor for BDNF, but not TrkA receptor, the receptor for NGF. We generated a construct encoding TrkA/TrkB receptors, which fused the extracellular domain of the TrkA receptor to the transmembrane and intracellular domains of the TrkB receptor. Interestingly, the hippocampal neurons expressing those constructs showed a robust phosphorylation of the introduced receptors in response to NGF. The intracellular domain of the TrkB receptor includes several tyrosine residues, and some of these become phosphorylated to activate downstream pathways through adaptor proteins (Poo 2001; Reichardt 2006). It has been demonstrated that the activation of Ras and MAPK, thorough an adaptor protein, Shc, is crucial for NT-dependent cell growth and differentiation (Reichardt 2006). An important role of the PLC-γ pathway in NT/Trk signaling is the regulation of synaptic plasticity by BDNF (Matsumoto et al. 2001; Minichiello et al. 2002). We generated constructs encoding TrkA/TrkB chimeras with mutations in the binding sites for two adaptor proteins, Shc and PLC-γ, and in an ATP-binding site that is essential for tyrosine kinase activation. Western blot analysis using anti-phospho-Trk antibody (pY490) demonstrated that NGF was able to activate the TrkA/TrkB chimeras mutated at the PLC-γ binding site, but not those mutated at the Shc- and ATP-binding sites.

Over the past few decades, several articles have been devoted to the study of NT-dependent biological actions using various mutant Trk receptors, with replacement of tyrosine by phenylalanine at the presumed phosphorylation site, in vivo and in vitro (Atwal et al. 2000; Loeb et al. 1994; Obermeier et al. 1994). A number of those studies measured axon outgrowth; however, little is known about the stimulation of dendritic outgrowth by NTs. A unique point of the present study was that we sought to identify signaling pathways implicated in BDNF-promoted dendritic outgrowth using TrkA/TrkB chimeric receptors. Although there was one previous study in which TrkA/TrkB fusion receptors were constructed, it is irrelevant to our main line of inquiry (Sommerfeld et al. 2000). Recently, it was reported that NGF could decrease in the number of primary dendrites and an increase in dendrite length of cultured hippocampal neurons in the culture conditions leading to activation of HES1/5 and through p75^NTR (Salama-Cohen et al. 2005). Although we could not perfectly rule out the possibility that, in the present study, NGF/p75^NTR signaling is implicated in the regulation of the dendrite number of hippocampal neurons, significant difference in the dendritic number among hippocampal neurons over-expressing TrkA/TrkB fusion receptors (Fig. 7) could suggest that, at least in this report, the dendrite number is controlled by NGF signaling through TrkA/TrkB fusion receptors rather than p75^NTR. Another remarkable point of this study is that we sought to visualize the shape of branched neurons using GFP, which was bicistronically expressed with the TrkA/TrkB fusion protein. This strategy led us to the important finding that BDNF/TrkB signaling, through the adaptor protein Shc, is a crucial pathway for BDNF-dependent dendrite outgrowth in hippocampal neurons. On the other hand, our quantitative morphological analysis of GFP-labeled neurons demonstrated that a different signaling pathway, through PLC-γ activation, was not relevant to this neurotrophic event. The pathway downstream of Shc includes Ras and MAPK, which are involved in cell growth and cell differentiation, and PI3K and Akt, which are involved in cell viability (Atwal et al. 2000; Reichardt 2006). Trk/Shc signaling through the adaptor proteins Grb2 and SOS leads to the activation of Ras, which in turn interacts with Raf and then activates the downstream signal MEK/MAPK. Activated Ras also interacts with PI3K and then activates the downstream signal Akt (reviewed by Reichardt 2006). How these pathways contribute to dendritic outgrowth in neurons is an important issue to be addressed in the future.