Small ncRNA Expression and Regulation Under Hypoxia in Neural Progenitor Cells

Abstract

Small non-coding RNA (ncRNA) plays critical roles in a large number of cellular processes, including neural development, cell survival and cell determination. Our previous work showed that low oxygen promoted the survival and proliferation of neural progenitor cells (NPCs) in vitro. In this study, we examine the expression and regulation of small ncRNAs in the hypoxia-driven proliferation of NPCs. The expression profiles of ncRNAs in NPCs under hypoxia were detected using microarray analysis. Results of significance analysis of microarrays (SAM) revealed that 15 small RNAs were up-regulated at least threefold and 11 were down-regulated under hypoxic conditions. The differentially expressed small ncRNAs were confirmed by quantitative RT-PCR, and miR-210 was observed to be highly expressed in NPCs under hypoxic conditions. Further study showed that hypoxia-inducible factor (HIF)-1α had a direct impact on the putative promoter regions of miR-210. From these results, we conclude that some small ncRNAs participate in the regulation of the proliferation of NPCs under hypoxia and that miR-210 is directly regulated by HIF-1α.

Introduction

Neural stem or progenitor cells (NPCs) exist widely in the developing and adult mammalian brain. Neural stem cells are self-renewing and can differentiate into neurons, astrocytes or oligodendrocytes in vitro (Reynolds et al. 1992; Gage 2000). The proliferation of NPCs in vitro may be regulated by various factors. Previous studies showed that a low oxygen environment promoted the proliferation of NPCs in vitro (Studer et al. 2000; Zhu et al. 2005). Therefore, hypoxia may be a useful tool for the expansion of NPCs in vitro. However, the molecular mechanisms responsible for hypoxia-driven proliferation of NPCs are not fully characterized. Clarification of this process may lead to novel strategies for NPC applications.

Multiple classes of ncRNAs are expressed and show function in the central and peripheral nervous systems (Mehler and Mattick 2006). In particular, the study of small regulatory RNAs has altered conventional thought concerning gene regulation. Many reports have suggested a role of miRNAs in neural development, differentiation and cell-type specificity (Krichevsky et al. 2003; Kim et al. 2004; Smirnova et al. 2005). In this study, to better understand the regulation of NPC proliferation, the expression of small ncRNAs in NPCs under hypoxic conditions was investigated.

Materials and Methods

Cell Isolation and Culture

Mesencephalic cells from embryonic day 13.5 (E13.5) Wistar rats were mechanically dissociated. The methods used for isolation and culture of NPCs were described previously (Zhao et al. 2008). HeLa cells were grown in DMEM containing 10% FBS and were incubated at 37°C in a humidified chamber supplemented with 5% CO₂.

Condition of Hypoxia

For decreased oxygen cultures, an incubator (Thermo model 3110, USA) that was adjustable for different oxygen concentrations was used. The incubator was flushed with air containing 5% CO₂ and balanced with N₂. The oxygen concentration inside the incubator was maintained at 3% and was monitored with a microelectrode (Animus Corp., USA). The time of hypoxia was calculated from the measurement indicating the desired oxygen concentration.

RNA Isolation and ncRNA Expression Analysis

Construction of the microarray and hybridization were performed by CapitalBio Corp and the microarray assay was performed as described previously (Sun et al. 2008).

Quantification of ncRNAs with Real-Time PCR

The experimental protocols used have been described previously (Liu et al. 2008).

Plasmid Constructs

The genomic region 2 kb immediately upstream of rat miR-210, miR-338 and miR-497 was amplified using the following primers (underlining indicates restriction sites inserted): 338, 5′-CGGGGTACCCCCTCCGAGGCACTGGGAGCTAAAC-3′ and 5′-CCGCTCGAGGGACGGCCTGGGCAGCGTCGGGGCT-3′; 497, 5′-CGGGGTACCAGGGCTGGTTTTAAAGATGCGGAGG-3′ and 5′-CCGCTCGAGGGCGGGAGCAGGACTGGGGTGTGTC-3′; 210, 5′-CGGGGTACCGCATCATATCCTGTTCCTGCCTCTA-3′ and 5′-CCCA AGCTTTGGGTGGGCAAGTAGAGGGTCCCCT-3′. The resulting fragments were cloned into the basic vector (Promega, USA).

Luciferase Activity Assay

HeLa cells were seeded in 96-well plates and transfected in triplicate with luciferase reporters (400 ng) and pRL-TK (4 ng, as a control for transfection efficiency and sample handling) and pEGFP-HIF vector (100 ng) or the empty vector. Cells were harvested at 48 h posttransfection and assayed with Dual Luciferase Assay (Promega, USA) according to the manufacturer’s instructions.

Chromatin Immunoprecipitation (ChIP) Assay

NPCs were exposed to hypoxia (3% O₂) for 72 h. The EZ ChIP™ chromatin immunoprecipitation kit (Upstate, USA) was used according to the manufacturer’s instructions. A 2 μg portion of control mouse IgG or antibody against HIF-1α was used for immunoprecipitation. The PCR primer for miR-210 promoter fragment amplification was as follows: 5′-GCCCAATCACAGGGAGAC-3′ and 5′-AGCCAGTGAACACGAGGG-3′ (for the predicted HIF binding sites located at position −419), or 5′-ATCTTTCAGGATCTACAGGGTC-3′ and 5′-AGTTTAGGCGGGTCAGTTA-3′ (for the predicted HIF consensus at −827). The PCR products were resolved on a 1.5% agarose gel and visualized by ethidium bromide staining.

Statistical Analysis

Statistical analysis was performed using the Student’s t test. A P value less than 0.05 was considered significant.

Results

Effect of Hypoxia on the ncRNA Expression Profile of NPCs

We isolated the E13.5d rat mesencephalon neural progenitor cells for microarray analysis and selected 3% oxygen, a concentration that can promote the NPCs proliferation effectively, as our experiment environment. Using a false discovery rate (FDR), lower than 5% and a fold change not lower than 1.5 as a cutoff level, we identified 15 up-regulated and 11 down-regulated small ncRNAs. Table 1 presents a summary of the differential ncRNAs induced by 3% O₂ for 72 h compared to normal conditions.

Table 1.

Differential ncRNAs induced by hypoxia

Rank	Name	Fold change	SAM analysis score	Location of putative HIF-1α binding sites
1	hsa-miR-210	86.29	20.40	−419,−827,−7631
2	snoRNA-LBME-U83B	7.91	12.35
3	hsa-miR-221	6.91	18.01
4	hsa-miR-34a	5.55	7.24
5	hsa-miR-376a	4.63	15.01
6	hsa-miR-301	5.03	12.52
7	hsa-miR-148a	4.07	6.13	−11581
8	hsa-miR-181d	4.04	7.25
9	hsa-miR-338	3.73	6.58	−54
10	mmu-miR-350	3.50	5.39
11	hsa-miR-29b	3.46	12.18	−19463
12	hsa-miR-497	3.40	6.67	−8191, −8109, −5618, −4889, −4170
13	hsa-miR-146b	3.21	7.58
14	mmu-miR-344	3.20	6.82
15	snoRNA-LBME-U14A	3.06	5.50
16	Rfam tRNA (gaauucucgccucacacgcgg)	0.12	−9.94
17	mmu-miR-290	0.13	−6.95
18	Nature PREDICTED_MIR88	0.14	−7.73
19	Cell_predict cand499	0.15	−6.37
20	NCRNA vault_RNA	0.15	−8.01
21	Nature PREDICTED_MIR189	0.18	−8.61
22	Rfam 5S_rRNA (uuucaguuugagggagaccgcg)	0.21	−6.87
23	Cell_predict cand978	0.22	−5.45
24	NCRNA hY1	0.27	−7.92
25	Rfam 5S_rRNA (ccucacuaguacuuggauggga)	0.29	−6.18
26	Rfam tRNA (gcguuggcaguucagugguaga)	0.31	−5.45

Next, we confirmed the microarray data using quantitative RT-PCR for some of the up-regulated miRNAs (Fig. 1a) and snoRNAs (Fig. 1b, c). The results strongly suggest that these small ncRNAs are hypoxia-regulated.

Fig. 1.

Quantification of ncRNA expression using real-time PCR. NPCs were exposed to 3% O₂ for 72 h and quantitative real-time PCR was performed to confirm the expression of some hypoxia up-regulated ncRNAs: a for miRNA, b for snoRNA-LBME-U83B and c for snoRNA-LBME-U14A. Endogenous U6 snRNA levels were used for normalization

Bioinformatic Analysis of the HIF-1α Regulated miRNAs

We demonstrated that hypoxia-inducible factor (HIF)-1α, a key molecule in the response to hypoxia, was critical in the promotion of the proliferation of NPCs (Zhao et al. 2008). We addressed whether HIF-1α has a direct impact on the putative promoter regions of these hypoxia-regulated miRNAs (HRMs). First, we performed an in silico search of upstream genomic sequences of the miRNAs up-regulated by hypoxia.

Since only a few miRNA promoters have been identified, a 10 kb upstream region of the 5′ end of the annotated miRNA was designated as a putative promoter sequence. Using MultiTF web tools, we identified 11 potential HIF-1α binding sites near five miRNAs or clusters (miR-210, miR-29b/29c, miR-148b, miR-338, and miR-497) that are conserved in human, mouse, rat and dog. Table 1 shows the location of the putative HIF-1α binding sites.

Expression of miR-210 Activated by Hypoxia is Induced Through HIF-1α

MiR-29 and miR-148 have homologies in the genome, which complicates the analysis of their expression. Therefore, we examined only the promoter activities of miR-210, miR-338 and miR-497 using the luciferase assay. We transfected the luciferase reporter plasmids into HeLa cells, and the cells were treated with 3% O₂ for 48 h. Our results showed that the relative luciferase activities after transfection with the reporter constructs increased significantly under hypoxia (Fig. 2a).

Fig. 2.

Regulation of hypoxia-regulated miRNAs. a Effect of hypoxia on luciferase activities. HeLa cells transfected with miR-210, 338 and 497 promoter reporter constructs were exposed to 3% O₂ for 48 h and the relative luciferase activities were analyzed. b Effect of HIF-1α on the luciferase activities. Relative luciferase activities of miR-210, 338 and 497 promoter reporter constructs were analyzed in HeLa cells after co-transfection with pEGFP-HIF or the empty vector under normoxia for 48 h. c Direct recruitment of HIF-1α on the miR-210 promoters under hypoxia. Chromatin was immunoprecipitated from NPCs using a HIF-1α antibody or an IgG control, and the enriched genomic fragment was amplified using primers spanning the candidate HREs located at positions −419(210A) and −827(210B)

Next, in order to detect the direct effect of HIF-1α on the up-regulation of miR-210, 338 and 497, the relative luciferase activities of miR-210, 338 and 497 promoter reporter constructs were analyzed in HeLa cells after co-transfection with pEGFP-HIF or the empty vector, pEGFP-N1, under normoxia for 48 h. The data showed that HIF-1α induced a robust activation of the miR-210 promoter–luciferase constructs, supporting a direct role of HIF-1α in miR-210 up-regulation. However, the miR-338 and miR-497 promoter–luciferase constructs did not change significantly after HIF-1α over-expression (Fig. 2b).

Additionally, we confirmed the dynamic recruitment of HIF-1α to the promoter of miR-210 using a ChIP assay. As shown in Fig. 2c, the HIF-1α antibody, but not the control IgG antibody, immunoprecipitated the miR-210 promoter fragments in hypoxic NPCs. No immunoprecipitated miR-338 and miR-497 promoter fragments were found to bind to the HIF-1α antibody (data not shown). This result suggests that HIF-1α bound to the putative promoter of miR-210 directly and activated the expression of this small regulatory RNA.

Discussion

In the present study, we examined the expression and regulation of ncRNAs during hypoxia-driven proliferation of NPCs. The data showed a number of ncRNAs that changed significantly when NPCs were treated with 3% O₂ for 72 h. MiR-210 was highly expressed in NPCs under hypoxia, and HIF-1α had a direct impact on the putative promoter regions of miR-210.

Several reports have also identified a variety of HRMs in different cells and tissues and several HRMs exhibit induction in response to HIF activation (Kulshreshtha et al. 2007; Crosby et al. 2009; Huang et al. 2009). Our work is the first report on HRMs in NPCs. The results differed from that of the other groups maybe due to the different cell type and different oxygen condition.

It has been reported that miR-210 expression increased in several cancer cell lines under hypoxia, and Huang et al. (2009) recently found that HIF-1 directly regulate its expression. Interestingly, in the present study, the up-regulation of miR-210 by the transfection of HIF-1 (Fig. 2a) is smaller than that by hypoxia (Fig. 2b). To our knowledge, the regulation of miR-210 expression under hypoxia is not the only one pathway to be participated, since hypoxic condition could influence a wide range of cell signaling transduction directly or indirectly (Zagórska and Dulak, 2004). The second reason may be due to the experimental methods. We used the pEGFP-HIF vector to over-express HIF-1α under normoxia, the HIF-1α expression level is lower than that under hypoxia induced, which result in up-regulation of miR-210 by the transfection of HIF-1 is smaller than that by hypoxia. In addition, stabilization of HIF-1α expressed by the vector was also influenced by oxygen-depended degraded pathway.

miR-210 is the most consistently and robustly induced miRNA under hypoxia and the research on it covering almost every aspect of hypoxia biology, such as apoptosis, angiogenesis, stem cell biology, cell cycle regulation, DNA damage repair, mitochondrial metabolism and tumor growth (Huang et al. 2010). We over-expressed miR-210 through lentiviral vector and did not find significant effect on NSCs proliferation (data not shown). Further identification of the genes targeted by miR-210 may provide insight for the expansion and application of neural stem cells.

Together, we found substantial differential expression of small non-coding RNAs in hypoxia-induced developing NPCs suggesting a pivotal role of these molecules in proper neuronal development. However, further studies are required to address this point.