Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Oct 1.
Published in final edited form as: Mol Immunol. 2024 Aug 27;174:47–56. doi: 10.1016/j.molimm.2024.08.003

Altered characteristics of regulatory T cells in target tissues of Sjögren’s syndrome in murine models

Jing Zhou a, Fernanda Aragão Felix a,1, Yuqiao Jiang a, Dongfang Li a, Myung-Chul Kim 2, Daesong Jang b,c, Seunghee Cha b,c, Qing Yu a,*
PMCID: PMC11500054  NIHMSID: NIHMS2021107  PMID: 39197397

Abstract

Sjӧgren’s syndrome (SS), also known as Sjögren’s disease, is a chronic autoimmune condition predominantly affecting the salivary and lacrimal glands. The disease is driven by an autoimmune response involving the activation and actions of major innate- and adaptive immune cell subsets. However, the specific characteristics and roles of regulatory T cells (Tregs) in SS remain elusive. This study seeks to clarify the main phenotypic and functional attributes of Tregs in the salivary glands and their draining lymph nodes in murine models of SS. Our flow cytometric analysis revealed that Tregs in the salivary gland-draining lymph nodes of female non-obese diabetic (NOD) mice, a spontaneous model of SS, exhibited a greater proportion of activated Tregs and fewer resting Tregs compared to Balb/c mice. Furthermore, Tregs from the salivary gland-draining lymph nodes of female C57BL/6.NOD-Aec1Aec2 (B6.NOD-Aec) mice, a model for primary SS, demonstrated significantly lower IL-10 production but markedly higher IFNγ- and IL-17 production than their C57BL/6 counterparts. Additionally, treatment of C57BL/6 Tregs with IL-7, a cytokine critical for SS pathogenesis, resulted in diminished IL-10 production and enhanced IFNγ and IL-17 production in these cells. Notably, the alterations in B6.NOD-Aec Tregs also included an increased expression of the immune-inhibitory molecule CTLA-4 compared to the C57BL/6 Tregs. Intriguingly, in vitro co-cultures of Tregs with conventional CD4 T cells and other key immune populations from lymph nodes indicated that Tregs from salivary gland-draining lymph nodes of both B6.NOD-Aec and C57BL/6 strains exhibited comparable and limited immunosuppressive effects on the proliferation and function of conventional CD4 T cells. The ability of B6.NOD-Aec Tregs to directly inflict damages to salivary gland epithelial tissues and contribute to SS pathologies through IFNγ and IL-17 that they produce warrants further investigations. In addition, enhancing the relatively weak immunosuppressive capacities of these Tregs may also serve as a viable strategy to alleviate the SS phenotype in the mouse models and potentially in patients.

Keywords: Sjögren’s disease, autoimmune exocrinopathy, salivary gland, immunosuppression, interleukin-7

1. Introduction

Sjӧgren’s syndrome (SS), also known as Sjögren’s disease, is a chronic autoimmune disorder that affects an estimated 4 million Americans and between 0.01 – 0.1% of the population globally (Fox, 2007). This disease is characterized by the leukocyte infiltration and damage of the salivary glands and lacrimal glands, and the presence of various serum autoantibodies, with xerostomia (dry mouth) and xerophthalmia (dry eyes) as the principal sypmtoms. Beyond these exocrine glands, SS also affects various other organs, causing systemic pathologies including interstitial lung disease, distal renal tubular acidosis, and B cell lymphoma, significantly compromising the oral and sytemic health of the patients (Fox, 2007; Segal et al., 2009; Voulgarelis and Tzioufas, 2010). Currently, there are no cures or effective biological therapies for SS (Mavragani and Moutsopoulos, 2007; Ramos-Casals et al., 2010). Autoreactive effector T helper (Th) cells are among the key cellular players driving SS pathogenesis, primarily by producing proinflammatory cytokines that elicit tissue inflammation, destruction, and dysfunction, while also promoting B-cell activation and autoantibody production (Katsifis et al., 2007; C. Q. Nguyen et al., 2007; Voulgarelis and Tzioufas, 2010).

A large body of research has demonstrated the crucia roles of various T cell subsets, including Th1, Th2, Th17 and T follicular helper cells, along with a wide array of associated cytokines, such as type I IFNs, IFNγ, IL-4, IL-17 and IL-7, in driving/promoting the development and persistence of SS pathologies (Brayer et al., 2001; Cha et al., 2004; Chiorini et al., 2009; Jin and Yu, 2013; Katsifis et al., 2007; B. H. Lee et al., 2009; X. Lin et al., 2015; C. Q. Nguyen et al., 2007; C. Q. Nguyen et al., 2011; Nikolov and Illei, 2009; Youinou and Pers, 2011). However, despite the significant advances in the SS research field in recent years, no cure or effective therapy has been established for this disease, highlighting the critical need for a deeper and better understanding of the immunopathogenic players and mechanisms in this complex and multifactorial autoimmune disease (Coca and Sanz, 2009; Cornec et al., 2012; Del Papa and Vitali, 2018; Ferro et al., 2017; Sada et al., 2015).

A significant knowledge gap in SS research is the inadequate understanding of the characteristics and functions of regulatory T cells (Tregs) in this autoimmune condition. There are limited numbers of existing studies, which have also yielded somewhat discrepant findings. Several studies show a reduced number and proportion of Tregs in the peripheral blood and salivary glands of SS patients (X. Li et al., 2007; Liu et al., 2008). Another report has found that peripheral blood Tregs from SS patients are hyporesponsiveness to IL-2, suggesting an impaired Treg cell activity which might contribute to the pathogenesis of this disease (Keindl et al., 2022). Furthermore, a recent study demonstrates a shift within the peripheral blood Tregs in SS patients from a resting to an activated state, implying a weakened overall immunosuppressive activity of these Tregs (J. C. Lin et al., 2023). Aligning with these findings, experimental depletion of Treg cells in female non-obese diabetic (NOD) mice, which spontaneously develop SS-like pathologies, did not impact the disease course and severity, suggesting a lack of effective immunosuppressive actions of these cells, at least in this murine model (Barr et al., 2018). In contrast, several other studies have reported that there are no significant differences in the amount and function of peripheral blood Tregs from SS patients compared to the healthy control subjects (Gottenberg et al., 2005). In some cases, the number of Tregs in the salivary glands of SS patients is actually increased and positively correlates with the disease severity (Christodoulou et al., 2008), suggesting that the role of Tregs in SS may be highly complex and varies depending on the disease stage and/or subtyp and underscoring the need for further clarification of the features and roles of Tregs in this disease setting.

The immunosuppressive function and the lineage stability of Tregs are often impaired by various proinflammatory cytokines/signals, such as IFNγ, IL-12 and IL-23, which are typically upregulated in the context of autoimmune or inflammatory diseases (Barbi et al., 2014; Long and Buckner, 2011) (Izcue et al., 2008; Kannan et al., 2019; Petermann et al., 2010). In addition, a few studies have shown that IL-7, a cytokine that promotes Th1 responses and critically contributes to SS immunopathogenesis, can modulate Treg homeostasis and function, with varying effects depending on the contexts and experimental systems employed (Heninger et al., 2012; Kim et al., 2012; Schmaler et al., 2015; Simonetta et al., 2012). While some reports indicate that IL-7 supports the homeostatic maintenance of Tregs (Kim et al., 2012; Schmaler et al., 2015; Simonetta et al., 2012), another study shows that IL-7 impairs the immunosuppressive function of human Tregs despite facilitating their expansion (Heninger et al., 2012).

Increased levels of IL-7 have been detected in the salivary glands and peripheral blood of both patients with SS and mouse models of the disease (Bikker et al., 2012a; Bikker et al., 2012b; Riviere et al., 2021). Our previous work has demonstrated that IL-7 promotes the development and onset of SS in the C57BL/6.NOD-Aec mouse strain (B6.NOD-Aec), a model of primary SS (Jin et al., 2013a; Jin et al., 2013b). Female B6.NOD-Aec mice develop autoimmune responses in salivary glands starting from the age of 16 weeks with the onset of clinical disease approximately at age 24 weeks (Cha et al., 2002; B. H. Lee et al., 2009; C. Nguyen et al., 2006), and our previous work shows that blocking IL-7 receptor in these mice impedes the development and onset of SS in these mice (Jin et al., 2013a). In addition, we have also shown that IL-7 receptor blockade also mitigates the salivary gland pathologies and improves salivary secretion in NOD mice with established (Zhou and Yu, 2018). Hence, elevated IL-7 in the SS condition contributes to both the emergence and the sustainment of this disease. Nevertheless, the specific effects of IL-7 on Tregs in the SS setting remain to be clarified.

In the present study, we sought to fill the aforementioned knowledge gaps concerning Treg in Sjögren’s disease, delineate the main phenotypic and functional characteristics of Tregs within the salivary glands and their draining lymph nodes in the B6.NOD-Aec model of SS, and examine the impact of IL-7 on these Tregs.

2. Material and methods

2.1. Mice

Female non-obese diabetic (NOD) mice (NOD/ShiLtJ strain), C57BL/6J (C57BL/6), and Balb/cJ (Balb/c) mice, age ranging from 8 – 13 weeks were purchased from the Jackson Laboratory (Bar Harbor, ME) and housed in the specific pathogen-free animal facility at the ADA Forsyth Institute. The C57BL/6.NOD-Aec1Aec2 (B6.NOD-Aec) and the C57BL/6 mice, female, aged around 24 weeks, used as controls for B6.NOD-Aec mice were bred and maintained in the same animal facility, either at the ADA Forsyth Institute or the University of Florida College of Dentistry. All the experimental procedures were approved by the Institutional Animal Care and Use Committee of the ADA Forsyth Institute and the University of Florida College of Dentistry, and compliant with the “Guide for the Care and Use of Laboratory Animals” of the National Institutes of Health and the ARRIVE guidelines.

2.2. Cytokines and Antibodies

Recombinant human IL-7 was purchased from PeproTech (Cranbury, NJ). For flow cytometry, fluorescence conjugated antibodies against CD45 (clone 30-F11), CD4 (GK1.5), CD8α (536–7), CD19 (1D3), CD44 (30-F11), CD62L (MEL-14), CTLA-4 (UC10–4B9), PD-L1 (10F.9G2), TIGIT (1G9), IFNγ (XMG1.2), IL-17 (TC11–18H10.1), IL-10 (JES5–2A5), TGFβ (TW7–16B4), CD16/32 (clone 93), Foxp3 (clone MF-14), Tim-3 (RMT3–23), VISTA (MH5A), IL-4 (11B11), Gata-3 (16E10A23), IL-7Rα/CD127 (A7R34) and KLRG1 (2F1/KLRG1) were purchased from BioLegend (San Diego, CA).

2.3. Antibody staining and flow cytometry

Cells were incubated with anti-CD16/32 antibody first, followed by incubation with a mixture of fluorescence-conjugated antibodies to cell surface molecules at 4 °C for 30 min. After that, the cells were fixed and permeabilized, and stained for intranuclear Foxp3 using the specific Foxp3 staining buffer set (BioLegend). In some analyses, the cells were pre-treated with PMA plus ionomycin for 4 hours with GolgiStop (BioLegend) added in the last 2 hours. The cells were subsequently subjected to staining for surface molecules, followed by fixation/permeabilization and staining for intracellular cytokines. After washing, the stained cells were analyzed with a FACSAria II Cell Sorter (BD, Franklin Lakes, NJ) or an Attune NxT flow cytometer (Invitrogen). The data collected were further analyzed using the FlowJo V10 software (FlowJo, Ashland, OR).

2.4. Isolation of Treg cells from mosue salivary gland-draining lymph nodes (SGLNs)

Single cells were prepared from SGLNs, which included the submandibular lymph nodes and the cervical lymph nodes, via mechanical grinding with the frosted glass slides and filtering through a nylon mesh. Tregs were subsequently isolated from the SGLN cells using mouse CD4+CD25+ regulatory T cell isolation kits (Miltenyi Biotec) following the manufacturer’s instructions.

2.5. In vitro culture of SGLN cells and purified Tregs and IL-7 treatment of the cells

SGLN single cells or purified Tregs from C57BL/6 mice aged around 24 weeks were enumerated and cultured in RPMI 1640 medium containing 10% fetal bovine serum, 1% penicillin-streptomycin, in the presence or absence of 5 ng/ml recominant human IL-7 (PeproTech). SGLN cells were cultured for 2 days and Tregs were cultured for 1 day before being harvested from the cultures for further assays/analyses.

2.6. In vitro Treg suppression assay

Conventional CD4 T cells (Tconv, defined as CD25− CD4 T cells) were isolated from SGLNs of 8-week-old female C57BL/6 mice using the Mouse CD4+ T Cell Isolation kit (Miltenyi) with the biotin-anti-CD25 antibody (BioLegend) added to the antibody cocktail, following the manufacturer’s protocol. The remaining Tconv-depleted SGLN cells were also collected, and treated with mytomicin C (Stemcell Technologies) to stop the cell division abilities, following the manufacturer’s instructions. The purified Tconv cells were then labeled with CFSE using the CFSE Cell Division Tracker kit (BioLegend) following the manufacturer’s instructions, and 1 × 105 CFSE-labeled from were mixed with Tregs isolated from SGLNs of either C57BL/6 or B6.NOD-Aec mice at various ratios, along with 2 × 105 mytomicin C-treated Tconv-depleted C57BL/6 SGLN cells as wellas 2 μg/ml soluble anti-CD3 antibody (BioXCell). The ‘No Treg’ control group was included. The cells were cultured at 37 °C under 5% CO2 for 3 days and harvested for the analysis of the CFSE dilution profile of the gated Tconv cells. The percent suppression was calculated based on the dilution of CFSE in Tconv cells cocultured with Tregs relative to that of Tconv cells in the ‘No Treg’ control group. A portion of the harvested cells were subjected to PMA and ionomycin stimulation, stained for surface makers and intraceullar cytokines, and analyzed for cytokine production by Tconv cells using flow cytometry and the ImageJ software.

2.7. Real-time RT-PCR

Total RNA from cells was isolated using the RNeasy Micro kit (Qiagen) or NucleoSpin RNA Mini kit (Macherey-Nagel), and transcribed into complementary DNA (cDNA) with M-MLV reverse transcriptase (Promega). Real-time PCR was performed using SYBR Green Master Mix (Qiagen) for 40 cycles with annealing and extension temperature at 60°C, on a LightCycler 480 Real-Time PCR System (Roche) or a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are: mouse β-actin forward, 5’-TGGATGACGATATCGCTGCG-3’, reverse, 5’-AGGGTCAGGATACCTCTCTT-3’; mouse IL-10 forward, 5’- GCTCTTACTGACTGGCATGAG’, reverse, 5’- CGCAGCTCTAGGAGCATGTG-3’; mouse IFNγ forward, 5’-GGATGCATTCATGAGTATTGC-3’, reverse, 5’-CCT TTTCCGCTTCCTGAG G-3’; mouse IL-17 forward, 5’-GCGCAAAAGTGAGCTCCAGA-3’, reverse, 5’-ACAGAGGGATATCTATCAGGG-3’, mouse TGFβ1 forward, 5’-GACGTCACTGGAGTTGTACG-3’, reverse, 5’-CTGTCACAAGAGCAGTGAGC-3’. Other primer sequences are available upon request. The gene expression level was normalized to that of β-actin.

2.8. Statistical Analysis

Statistical significance was determined by One-way ANOVA, two-tailed Student’s t-test, or Mann-Whitney U test where appropriate. P values smaller than 0.05 were considered statistically significant.

3. Theory/calculation

We hypothesize that Tregs in the salivary glands and the salivary gland-draining lymph nodes of mice afflicted with SS may exhibit abnormal features and defective immunosuppressive functions compared to those from the healthy C57BL/6 mice. To test this hypothesis, we will examine the differential expression of crucial cytokines and cell surface molecules that are critical for Treg activities between Tregs from SS mice and those from control mice. In addition, we will assess the immunosuppressive capacities of these Tregs through in vitro suppression assays.

4. Results

4.1. Differing features of Tregs in SS target tissues of NOD mice with newly onset SS compared to those in Balb/c mice

A previous study has indicated that Tregs in the NOD mouse strain, a model of SS, exhibit functional impairment (Barr et al., 2018). We consequently analyzed the Tregs in the target tissues of female NOD mice with newly established SS and compared their profiles to those from the age- and gender-matched Balb/c mice. We found that the proportion of total Tregs, resting Tregs (defined as CD44−CD62L+) and activated Tregs (defined as CD44+CD62L−) among the total submandibular gland (SMG) cells were all significantly increased in the NOD mice compared to the Balb/c mice (Figure 1A). We also assessed the ratio of Tregs to the Foxp3-negative conventional CD4 T (Tconv) cells, which was significantly increased in SMGs of the NOD mice (Figure 1A). In comparison, in the submandibular lymph nodes (SMLNs), while the overall percentages of Tregs were comparable between the two mouse strains, there was a significant reduction in the proportion of Tregs with a resting phenotype in the NOD mice, resulting in a higher ratio of activated Tregs to resting Tregs compared to the Balb/c mice (Figure 1B). Unlike our observation in the SMGs, the ratio of Tregs to Tconv cells in SMLNs was slightly reduced in the NOD mice (Figure 1B).

Figure 1. Differing features of Tregs in SS target tissues of NOD mice with newly onset SS compared to those in Balb/c mice.

Figure 1.

Open in a new tab

(A) Submandibular gland (SMG) cells from 13-week-old female NOD and Balb/c mice were stained for T cell activation markers, CD44 and CD62L, and analyzed by flow cytometry. Graphs show the percentages of total Tregs and activated and resting Tregs among SMG cells, as well as the ratio of Tregs to conventional CD4 T (Tconv) cells. (B) Cells from the submandibular lymph nodes (SMLNs) were analyzed similarly. Graphs show the percentages of total Tregs, and activated and resting Tregs among SMLN cells, as well as the ratio of activated Tregs to resting Tregs and the ratio of Tregs to Tconv cells. * P < 0.05; ** P < 0.01; *** P < 0.001.

4.2. Distinct cytokine profiles of Tregs in the target tissues of B6.NOD-Aec mice with newly onset SS compared to those in C57BL/6 mice

The data indicating aberrant features and functions of Tregs in NOD mice, including those generated by us and those reported in the literature, prompted us to further investigate Tregs in B6.NOD-Aec mice. This mouse strain is a model of primary SS, with female mice spontaneously developing the principal pathologies of primary SS at approximately 24 weeks of age (Cha et al., 2002; C. Nguyen et al., 2006). Tregs in the SMLNs of female B6.NOD-Aec mice aged around 24 weeks produced significantly lower levels of immune-regulatory cytokine IL-10 and markedly higher levels of proinflammatory cytokines IFNγ and IL-17, compared to their C57BL/6 counterparts, as determined by intracellular cytokine staining and flow cytometry (Figure 2A). Importantly, Tregs in the SMGs of B6.NOD-Aec mice exhibited a similar aberrant cytokine profile, including a reduced IL-10 production and an increased IFNγ and IL-17 production (Figure 2B). Meanwhile, the amount of Tregs in SMGs and SMLNs and the production of TGFβ by Tregs at these sites were comparable between B6.NOD-Aec mice and the C57BL/6 controls (Figure 2A–B). Intriguingly, the proportion of the Tregs that expressed T-bet or RORγt, the major transcription factors promoting IFNγ and IL-17 gene transcription, respectively, was not higher in B6.NOD-Aec mice than the C57BL/6 mice (Figure 2C). In fact, there was a statistically non-significant, trending decrease (Figure 2C). We also assessed the production of IL-4 and the expression of GATA-3, the key transcription factor for IL-4 gene expression, and found that the proportions of SMLN and SMG Tregs expressing either molecule were not significantly different between the two mouse strains (Figure 2D). Additionally, the ratio of Tregs to Tconv cells in both SMLNs and SMGs was comparable between the B6.NOD-Aec mice and the C57BL/6 control mice (Figure 2E), in contrast to the alterations seen in the NOD mice as compared to the Balb/c mice. Finally, the percentages of Ki67-expressing cells among the SMLN Tregs and SMG Tregs from the B6.NOD-Aec mice and the C57BL/6 control mice were also comparable without significant differences (Figure 2F).

Figure 2. Distinct cytokine profiles of Tregs in SS target tissues of B6.NOD-Aec mice with newly onset SS compared to those in wildtype C57BL/6 mice.

Figure 2.

Open in a new tab

(A) Assessment of immune infiltration of the SMGs in female B6.NOD-Aec mice aged around 24–30 weeks by flow cytometry. Left: Flow cytometric profile of Foxp3 and CD4 expression in the submandibular lymph node (SMLN) cells from C57BL/6 and B6.NOD-Aec mice; right: intracellular cytokine expression in the gated Treg populations. Bar graphs show the percentage of Tregs that expressed the cytokine (n = 8). (B) Percentages of SMG Tregs that expressed IL-10, IFNγ or IL-17 (n = 6–10). (C) Percentage of T-bet- or RORγt-expressing cells among SMLN Tregs, left, or among SMG Tregs, right (n = 5). (D) Percentage of IL-4- or GATA-3-expressing cells among the SMLN Tregs, left, and the SMG Tregs, right (n = 5). (E) The ratio of Tregs to Tconv cells in SMLNs, left, or in SMGs, right (n = 5). (F) Percentage of Ki67+ cells within SMLN Tregs, left, or within SMG Tregs, right (n = 5). * P < 0.05; ** P < 0.01; *** P < 0.001.

4.3. IL-7 treatment reduces IL-10 production and increases IFNγ- and IL-17 production in Tregs from wildtype C57BL/6 mice

The aberrant proinflammatory features of Tregs may partially stem from the proinflammatory signals within SS target tissues (Barbi et al., 2014; Long and Buckner, 2011). Our previous work has shown that IL-7 and Th1 cytokines, IFNγ and IL-12, are elevated in SMGs of B6.NOD-Aec mice (Jin et al., 2013a), consistent with findings in SS patients. Similarly, Th1 cytokines were also elevated in the SGLNs of B6.NOD-Aec mice, and blocking the IL-7 receptor abolished the elevation in Th1 cytokines and the development of SS (Jin et al., 2013a). Both IFNγ and IL-12 have well-documented abilities to impair the suppressive functions of Tregs (Dominguez-Villar et al., 2011; Feng et al., 2011; Overacre-Delgoffe et al., 2017; Tarique et al., 2017), but the specific effects of IL-7 on Tregs remain to be clarified (Heninger et al., 2012; Kim et al., 2012; Schmaler et al., 2015; Simonetta et al., 2012). To this end, we cultured SGLN cells from C57BL/6 mice in the presence or absence of recombinant IL-7 (5 ng/ml) for two days, and assessed the cytokine production by the Tregs. IL-7 treatment markedly reduced IL-10 production while increased IFNγ and IL-17 production in the Treg population (Figure 3A). Similarly, treatment of the purified CD25+ Tregs from the SGLNs of C57BL/6 mice with IL-7 also led to diminished IL-10 production after one day of culture (Figure 3B). Collectively, these data corroborate the aberrant cytokine profiles demonstrated by ex vivo analyses of B6.NOD-Aec Tregs and the control Tregs shown in Figure 1, illustrating the disruptive impact of proinflammatory cytokines on Treg characteristics.

Figure 3. IL-7 treatment downregulates IL-10 production and enhances IFNγ- and IL-17 production in Tregs from wildtype B6 mice.

Figure 3.

Open in a new tab

(A) SGLN cells from female C57BL/6 mice aged approximately 24 weeks were cultured with or without IL-7 (5 ng/ml) for 2 days. Graphs show the percentage of Tregs that were cytokine+ as determined by flow cytometry (n = 3). (B) Purified CD25+ Tregs from SGLNs of female C57BL/6 mice were cultured in the presence or absence of IL-7 for 24 h. IL-10 gene expression was assessed by real-time qPCR, presented relative to β-actin (n = 3). * P < 0.05; ** P < 0.01; *** P < 0.001.

4.4. SGLN Tregs from both B6.NOD-Aec mice and C57BL/6 mice display comparable and weak immunosuppressive activities in vitro

Following the observation of altered cytokine production in Tregs from SS-afflicted B6.NOD-Aec, we proceeded to determine their functional activities through in vitro Treg suppressive assays. CFSE-labeled conventional CD4 T cells (Tconv, defined as CD25− CD4 T cells) from SGLNs of C57BL/6 mice were mixed with Tregs from either C57BL/6 or B6.NOD-Aec mice at varying ratios, along with CD4 T cell-depleted SGLN cells, treated with mitomycin C, from C57BL/6 mice. The latter served dual purposes, to provide antigen-presenting cells and to mimic the in vivo immune environment with most of the immune cell components present.

The cultures were supplemented with soluble anti-CD3 antibody (2 μg/ml) to induce T cell activation. After three days of culture, the CFSE profile was analyzed, and the percentage of suppression was calculated by comparing the dilution of CFSE in Tconv cells relative to that in the ‘No Treg’ control group. Intriguingly, Tregs from C57BL/6 and B6.NOD-Aec mice exhibited a comparable and ineffective T cell-suppression, achieving only 5–10% suppression at the highest Treg: Tconv ratio (Figure 4A).

Figure 4. SGLN Tregs from B6.NOD-Aec mice and C57BL/6 mice display weak and comparable immunosuppressive activities in vitro.

Figure 4.

Open in a new tab

(A) 1 × 105 CFSE-labeled conventional CD4 T cells from SGLNs of C57BL/6 mice were mixed with Tregs from either C57BL/6 or B6.NOD-Aec mice at varying ratios, along with mitomycin C-treated C57BL/6 mouse SGLN cells depleted of CD4 T cells and the anti-CD3 antibody. CFSE profile was analyzed after 3 days of cultures by flow cytometry, and the percent suppression was calculated based on dilution of CFSE in Tconv cells relative to those in the ‘No Treg’ control group (n = 3 per experiment; total two independent experiments). (B) Cytokine production by Tconv cells (at Treg:Tconv ratio 1:8) was analyzed by flow cytometry. Graphs show the percentage of Tconv cells that were cytokine+ (n = 6).

We further examined whether there was any differences in cytokine production by Tconv cells when cocultured with the two groups of Tregs. Flow cytometry analysis revealed no differences in IFNγ and IL-17 production by Tconv cells cocultured with the two groups of Tregs across all Treg:Tconv ratios (Figure 4B, and data not shown). Therefore, despite a proinflammatory cytokine profile of B6.NOD-Aec Tregs, these cells demonstrated comparable immunosuppressive activities as their C57BL/6 counterparts in the conducted in vitro assays.

4.5. SGLN Tregs in B6.NOD-Aec mice express higher levels of CTLA-4 compared to those in C57BL/6 mice

To understand the lack of differences between the B6.NOD-Aec Tregs and their C57BL/6 counterparts, we examined the expression of several coinhibitory molecules, including cytotoxic T-lymphocyte–associated antigen 4 (CTLA-4), T cell immunoreceptor with immunoglobulin and ITIM domain (TIGIT), programmed death-ligand 1 (PD-L1), T cell immunoglobulin and mucin domain-containing protein 3 (Tim-3), V-domain Ig suppressor of T cell activation (VISTA) and inducible T-cell costimulator (ICOS), that are known to be important for Treg-mediated immunosuppression (Anderson et al., 2016; Das et al., 2017; Francisco et al., 2010; Gautron et al., 2014; Joller et al., 2014; D. Y. Li and Xiong, 2020; Lucca et al., 2019; Prakhar et al., 2021; Sasidharan Nair and Elkord, 2018; Tai et al., 2012; Wang et al., 2017). Tregs in SMLNs of B6.NOD-Aec mice showed similar expression levels multiple coinhibitory molecules, including TIGIT, PD-L1, Tim-3, VISTA and ICOS, compared to their C57BL/6 counterparts (Figure 5A). However, SMLN Treg B6.NOD-Aec mice displayed a markedly higher level of CTLA-4 expression (Figure 5A). In consistence, SMG Tregs in the B6.NOD-Aec mice also showed a trend of increase in the surface levels of CTLA-4 and similar levels of all other coinhibitory molecules, including TIGIT, PD-L1, Tim-3, VISTA and ICOS, compared to their C57BL/6 counterparts (Figure 5A). Finally, we examined the Tregs for the expression pattern of IL-7Rα/CD127 and KLRG1, two molecules frequently used in combination to determine the effector/memory status of various T cell populations (Herndler-Brandstetter et al., 2018; Huang and Belz, 2018). The results showed that the distribution of the four cell subsets, IL-7Rα−KLRG1+ (short-lived effector cells), IL-7Rα+KLRG1+ (double-positive effector cells), IL-7Rα+KLRG1− (memory precursor effector cells), and IL-7Rα−KLRG1−, within SMLN Tregs and SMG Tregs was similar between the two mouse strains (Figure 5B).

Figure 5. Expression of immune-coinhibitory molecules by SMLN Tregs from B6.NOD-Aec mice and their B6 counterparts.

Figure 5.

Open in a new tab

(A) Flow cytometric profile of expression of coinhibitory molecules, including CTLA-4, Tim-3, TIGIT, PD-L1, VISTA and ICOS, by Tregs from C57BL/6 mice and B6.NOD-Aec mice. Upper panels, SMLN Tregs; lower panels, SMG Tregs (n = 5–8). (B) Flow cytometric profile of expression of IL-7Rα (CD127) and KLRG1 by Tregs from the two mouse strains. Upper panels, SMLN Tregs; lower panels, SMG Tregs (n = 5). * P < 0.05; ** P < 0.01; *** P < 0.001.

4. Discussion

The characteristics and functional properties of Tregs and their roles in SS have not been fully elucidated. This study has identified significant and complex alterations in the properties of salivary gland Tregs and those in the SGLNs in two murine models of SS. Specifically, Tregs in the salivary tissues and their draining lymph nodes in the B6.NOD-Aec mouse strain, a model of primary SS, produced higher amount of IFNγ and IL-17, and lower levels of IL-10, compared to their wildtype counterparts. The aberrantly increased production of proinflammatory cytokines and impaired production of IL-10 by Tregs, coupled with a weakened immunosuppressive capacity, have been reported in various immune, autoimmune and inflammatory disorders. Proinflammatory cytokines and stimuli, such as IFNγ, IL-12 and IL-23, have been shown to induce/contribute to the abnormal changes in Treg properties and functions through multilayered mechanisms (Barbi et al., 2014; Izcue et al., 2008; Kannan et al., 2019; Long and Buckner, 2011; Petermann et al., 2010). In this study, we further revealed that IL-7, a cytokine elevated in the salivary glands of SS patients and B6.NOD-Aec mice, and critically required for SS pathogenesis, can directly act on Tregs to promote IFNγ- and IL-17 production while curbing IL-10 production. It is conceivable that the complex milieu of cytokines and proinflammatory stimuli in the SS target tissues contributes to the diverse molecular changes of Tregs, encompassing both upregulation and downregulation of elements of genes pivotal for the immunosuppressive functions of Tregs. The upregulation of CTLA-4 expression in SS-afflicted Tregs is a notable example of the former, possibly as a feedback mechanism to counteract the autoimmune inflammation (Prakhar et al., 2021; Tai et al., 2012). To gain a deeper understanding of the effects of IL-7 on Tregs, future investigations are needed to delineate how this cytokine influences various aspects of Tregs, including their immunosuppressive activity and the expression of different coinhibitory molecules, using both in vitro and in vivo study systems. A more comprehensive characterization of the molecular and functional features of Tregs in the SS disease setting is also warranted, including their production of immunosuppressive mediators, such as IL-35 and granzyme B, in addition to IL-10 and TGFβ.

An intriguing finding in this work is that the expression of T-bet or RORγt, the major transcription factors promoting IFNγ and IL-17 gene expression, respectively, was not increased in Tregs from B6.NOD-Aec mice concomitantly to the elevation in IFNγ and IL-17 expression, as compared to their C57BL/6 counterparts. In fact, there was a statistically non-significant, trending decrease. These results suggest that the enhanced IFNγ and IL-17 protein expression in SMLN and SMG Tregs from the B6.NOD-Aec model of SS are driven by mechanisms independent of T-bet and RORγt. The precise molecular basis for the altered cytokine production in these cells remains to be elucidated.

This study generates the intriguing finding that Tregs from SGLNs of C57BL/6 mice and the SS-afflicted B6.NOD-Aec mice both exhibit weak immunosuppressive activities. Importantly, a previous comparative analysis of Tregs from NOD, C57BL/6, and Balb/c mice has shown that Balb/c Tregs display the strongest, whereas NOD Tregs bear the weakest immunosuppressive effects among the three mouse strains (Godoy et al., 2020). Moreover, the study shows that while NOD Tregs possess distinct features compared to Balb/c Tregs, they do not differ significantly from C57BL/6 Tregs in the parameters evaluated (Godoy et al., 2020). The study suggests that these differences and similarities among Tregs across these mouse strains may contribute to the known differences in their susceptibilities to autoimmune inflammations, with C57BL/6 mice being more prone to such conditions than Balb/c mice (Godoy et al., 2020; Milovanovic et al., 2017). In addition, our finding prompts the consideration of whether Tregs from various organs/tissues possess differing immunosuppressive capacities under normal healthy conditions, with Tregs from SGLNs bearing relatively weak immune-regulatory activities. Further studies are necessary to evaluate this hypothesis by examining the immunosuppressive capacities of Tregs from different organs/tissues of C57BL/6 mice and comparing them to SGLN Tregs, with splenic and blood Tregs serving as positive controls.

The weak T cell-suppressive activities of both B6.NOD-Aec Tregs and the wildtype C57BL/6 Tregs from the SGLNs suggests that the defects in the immunosuppression by Tregs, at least those in the SGLNs, may contribute to the development of autoimmune responses under the conducive triggers in both mouse strains. Therefore, correcting/improving these deficiencies and boosting the immunosuppressive properties of these Tregs could potentially curtail effector T cell activities and autoimmune responses to prevent the development of the SS and also mitigate the established disease.

An interesting observation in this study is that the ratio of Tregs to Tconv cells in the SMGs of NOD mice is higher than that in the Balb/c mice, whereas this ratio remains unchanged in the SMGs of B6.NOD-Aec mouse strain as compared to its control, C57BL/6 strain. It has been shown that the relative proportion of Tregs among the CD4 T cell population, which parallels the Treg to Tconv ratio, in the minor salivary glands of SS patients varies with the disease stage/severity (Christodoulou et al., 2008). Specifically, there is a significant increase in Tregs in patients with advanced glandular lesions and no change in those with mild or moderate lesions (Christodoulou et al., 2008). Therefore, the differing alterations in Treg to Tconv ratios observed in these two mouse models of SS may reflect the heterogeneity of tissue pathologies seen in human patients and represented in different mouse models. In addition, while the activation status in the SMLN Tregs in the NOD mice shows a more activated phenotype compared to their Balb/c counterparts based on CD44 and CD62L expression, there is no significant difference in the activation status of SMLN Tregs between B6.NOD-Aec mice and their controls based on IL-7Rα and KLRG1 expression. This discrepancy may also reflect differences between the mouse models, representing the heterogeneity of this disease in human patients.

A expanding body of evidence is revealing the diverse actions of Tregs beyond T cell regulation and immunosuppression, in a tissue-, disease- and context-specific manner (Astarita et al., 2023; Campbell and Rudensky, 2020). Tregs are shown to interact with various types of non-immune cells across different tissues to facilitate or modulate processes such as tissue repair, stem cell maintenance, angiogenesis and glucose/lipid metabolism (Astarita et al., 2023; Campbell and Rudensky, 2020). Hence, the increased production of proinflammatory IFNγ and IL-17 by B6.NOD-Aec Tregs, as compared to wildtype C57BL/6 Tregs, may exert detrimental effects on salivary gland cells. Multiple studies, including our own, have demonstrated that IFNγ and IL-17 can direct act on salivary epithelial tissues to trigger apoptosis, tight junction impairment and salivary secretory dysfunction (Baker et al., 2008; X. Lin et al., 2015; C. Q. Nguyen et al., 2010; C. Q. Nguyen et al., 2011; Verstappen et al., 2018; Zhou et al., 2016; Zhou and Yu, 2018). Moreover, the altered levels of IFNγ, IL-17 and IL-10 may also influence the niche, self-renewal and regenerative activities of the salivary gland stem/progenitor cell populations, as evidenced by their roles in the stem cell compartment of other tissues (C. Lee et al., 2022; H. D. Nguyen et al., 2021; Omrani et al., 2023; Takashima et al., 2019). Therefore, future investigations are warranted to examine the effects of Tregs on their surrounding salivary epithelial cells, including salivary gland stem/progenitor cells, and their impacts on tissue repair and regeneration in SS, and to decipher the underlying cellular and molecular mechanisms, including but not limited to alteration in cytokine production.

5. Conclusions

This study has identified complex changes in the characteristics of salivary gland Tregs and those in the salivary gland-draining lymph nodes in two murine models of SS, especially noting an increased production of proinflammatory and salivary tissue-damaging cytokines, IFNγ and IL-17. These findings suggest that under the SS condition, Tregs may exert damaging effects on the surrounding salivary epithelial tissues and contributing to SS pathologies, a hypothesis that merits further studies. In addition, improving the weak immunosuppressive capabilities of Tregs in SS target tissues could offer a new avenue for alleviating this disease, which warrants comprehensive investigations.

Highlights.

  1. Tregs in SS murine models exhibit distinct features compared to those in control mice

  2. Tregs in target tissues of B6.NOD-Aec model of SS display aberrant cytokine profiles

  3. IL-7 treatment increases IFNγ and IL-17 production and reduces IL-10 output in Tregs

  4. B6.NOD-Aec Tregs and C57BL/6 Tregs show similarly weak suppressive functions in vitro

Acknowledgments

FAF received a Ph.D. scholarship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES -Process No. 88887.803395/2023-00), Brazil. We thank Dr. Jun-O Jin for the contribution during the initial phase of this study, and Ms. Victoria Zhou for assistance in some of the data analyses. We thank the staff of the animal facilities at the ADA Forsyth Institute and the University of Florida College of Dentistry for their excellent animal care.

This study was supported by grants from NIH/NIDCR (DE023838, DE023838, DE031058) and NIH/NIAID (AI181002) to QY, NIH/NIDCR (DE028033, DE030646) to JZ, and NIH/NIDCR (DE032707) and NIAMS (AR079693) to SC.

Footnotes

The authors have no competing financial interests.

Author statement

Declaration of Generative AI and AI-assisted technologies in the writing process: After drafting the manuscript, the authors used ChatGPT Scholar AI tool solely to improve the readability and language. The authors subsequently reviewed the content carefully, edited it as needed, and take full responsibility for the content of the publication.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Anderson AC, Joller N, Kuchroo VK, 2016. Lag-3, Tim-3, and TIGIT: Co-inhibitory Receptors with Specialized Functions in Immune Regulation. Immunity 44, 989–1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Astarita JL, Dominguez CX, Tan C, Guillen J, Pauli ML, Labastida R, Valle J, Kleinschek M, Lyons J, Zarrin AA, 2023. Treg specialization and functions beyond immune suppression. Clinical and experimental immunology 211, 176–183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baker OJ, Camden JM, Redman RS, Jones JE, Seye CI, Erb L, Weisman GA, 2008. Proinflammatory cytokines tumor necrosis factor-alpha and interferon-gamma alter tight junction structure and function in the rat parotid gland Par-C10 cell line. American journal of physiology. Cell physiology 295, C1191–1201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barbi J, Pardoll D, Pan F, 2014. Treg functional stability and its responsiveness to the microenvironment. Immunological reviews 259, 115–139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barr JY, Wang X, Kreiger PA, Lieberman SM, 2018. Salivary-gland-protective regulatory T-cell dysfunction underlies female-specific sialadenitis in the non-obese diabetic mouse model of Sjogren syndrome. Immunology 155, 225–237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bikker A, Kruize AA, Wenting M, Versnel MA, Bijlsma JW, Lafeber FP, van Roon JA, 2012a. Increased interleukin (IL)-7Ralpha expression in salivary glands of patients with primary Sjogren’s syndrome is restricted to T cells and correlates with IL-7 expression, lymphocyte numbers and activity. Ann Rheum Dis 71, 1027–1033. [DOI] [PubMed] [Google Scholar]
  7. Bikker A, Moret FM, Kruize AA, Bijlsma JW, Lafeber FP, van Roon JA, 2012b. IL-7 drives Th1 and Th17 cytokine production in patients with primary SS despite an increase in CD4 T cells lacking the IL-7Ralpha. Rheumatology (Oxford) 51, 996–1005. [DOI] [PubMed] [Google Scholar]
  8. Brayer JB, Cha S, Nagashima H, Yasunari U, Lindberg A, Diggs S, Martinez J, Goa J, Humphreys-Beher MG, Peck AB, 2001. IL-4-dependent effector phase in autoimmune exocrinopathy as defined by the NOD.IL-4-gene knockout mouse model of Sjogren’s syndrome. Scand J Immunol 54, 133–140. [DOI] [PubMed] [Google Scholar]
  9. Campbell C, Rudensky A, 2020. Roles of Regulatory T Cells in Tissue Pathophysiology and Metabolism. Cell Metab 31, 18–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cha S, Brayer J, Gao J, Brown V, Killedar S, Yasunari U, Peck AB, 2004. A dual role for interferon-gamma in the pathogenesis of Sjogren’s syndrome-like autoimmune exocrinopathy in the nonobese diabetic mouse. Scand J Immunol 60, 552–565. [DOI] [PubMed] [Google Scholar]
  11. Cha S, Nagashima H, Brown VB, Peck AB, Humphreys-Beher MG, 2002. Two NOD Idd-associated intervals contribute synergistically to the development of autoimmune exocrinopathy (Sjogren’s syndrome) on a healthy murine background. Arthritis Rheum 46, 1390–1398. [DOI] [PubMed] [Google Scholar]
  12. Chiorini JA, Cihakova D, Ouellette CE, Caturegli P, 2009. Sjogren syndrome: advances in the pathogenesis from animal models. J Autoimmun 33, 190–196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Christodoulou MI, Kapsogeorgou EK, Moutsopoulos NM, Moutsopoulos HM, 2008. Foxp3+ T-regulatory cells in Sjogren’s syndrome: correlation with the grade of the autoimmune lesion and certain adverse prognostic factors. The American journal of pathology 173, 1389–1396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Coca A, Sanz I, 2009. B cell depletion in lupus and Sjogren’s syndrome: an update. Curr Opin Rheumatol 21, 483–488. [DOI] [PubMed] [Google Scholar]
  15. Cornec D, Devauchelle-Pensec V, Tobon GJ, Pers JO, Jousse-Joulin S, Saraux A, 2012. B cells in Sjogren’s syndrome: from pathophysiology to diagnosis and treatment. J Autoimmun 39, 161–167. [DOI] [PubMed] [Google Scholar]
  16. Das M, Zhu C, Kuchroo VK, 2017. Tim-3 and its role in regulating anti-tumor immunity. Immunological reviews 276, 97–111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Del Papa N, Vitali C, 2018. Management of primary Sjogren’s syndrome: recent developments and new classification criteria. Therapeutic advances in musculoskeletal disease 10, 39–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Dominguez-Villar M, Baecher-Allan CM, Hafler DA, 2011. Identification of T helper type 1-like, Foxp3+ regulatory T cells in human autoimmune disease. Nat Med 17, 673–675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Feng T, Cao AT, Weaver CT, Elson CO, Cong Y, 2011. Interleukin-12 converts Foxp3+ regulatory T cells to interferon-gamma-producing Foxp3+ T cells that inhibit colitis. Gastroenterology 140, 2031–2043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ferro F, Marcucci E, Orlandi M, Baldini C, Bartoloni-Bocci E, 2017. One year in review 2017: primary Sjogren’s syndrome. Clinical and experimental rheumatology 35, 179–191. [PubMed] [Google Scholar]
  21. Fox PC, 2007. Autoimmune diseases and Sjogren’s syndrome: an autoimmune exocrinopathy. Ann N Y Acad Sci 1098, 15–21. [DOI] [PubMed] [Google Scholar]
  22. Francisco LM, Sage PT, Sharpe AH, 2010. The PD-1 pathway in tolerance and autoimmunity. Immunological reviews 236, 219–242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gautron AS, Dominguez-Villar M, de Marcken M, Hafler DA, 2014. Enhanced suppressor function of TIM-3+ FoxP3+ regulatory T cells. European journal of immunology 44, 2703–2711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Godoy GJ, Paira DA, Olivera C, Breser ML, Sanchez LR, Motrich RD, Rivero VE, 2020. Differences in T regulatory cells between mouse strains frequently used in immunological research: Treg cell quantities and subpopulations in NOD, B6 and BALB/c mice. Immunology letters 223, 17–25. [DOI] [PubMed] [Google Scholar]
  25. Gottenberg JE, Lavie F, Abbed K, Gasnault J, Le Nevot E, Delfraissy JF, Taoufik Y, Mariette X, 2005. CD4 CD25high regulatory T cells are not impaired in patients with primary Sjogren’s syndrome. J Autoimmun 24, 235–242. [DOI] [PubMed] [Google Scholar]
  26. Heninger AK, Theil A, Wilhelm C, Petzold C, Huebel N, Kretschmer K, Bonifacio E, Monti P, 2012. IL-7 abrogates suppressive activity of human CD4+CD25+FOXP3+ regulatory T cells and allows expansion of alloreactive and autoreactive T cells. J Immunol 189, 5649–5658. [DOI] [PubMed] [Google Scholar]
  27. Herndler-Brandstetter D, Ishigame H, Shinnakasu R, Plajer V, Stecher C, Zhao J, Lietzenmayer M, Kroehling L, Takumi A, Kometani K, Inoue T, Kluger Y, Kaech SM, Kurosaki T, Okada T, Flavell RA, 2018. KLRG1(+) Effector CD8(+) T Cells Lose KLRG1, Differentiate into All Memory T Cell Lineages, and Convey Enhanced Protective Immunity. Immunity 48, 716–729 e718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Huang Q, Belz GT, 2018. Bach2: An Instrument of Heterogeneity for Long-Term Protection. Immunity 48, 618–620. [DOI] [PubMed] [Google Scholar]
  29. Izcue A, Hue S, Buonocore S, Arancibia-Carcamo CV, Ahern PP, Iwakura Y, Maloy KJ, Powrie F, 2008. Interleukin-23 restrains regulatory T cell activity to drive T cell-dependent colitis. Immunity 28, 559–570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jin JO, Kawai T, Cha S, Yu Q, 2013a. Interleukin-7 enhances the Th1 response to promote the development of Sjogren’s syndrome-like autoimmune exocrinopathy in mice. Arthritis Rheum 65, 2132–2142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jin JO, Shinohara Y, Yu Q, 2013b. Innate immune signaling induces interleukin-7 production from salivary gland cells and accelerates the development of primary Sjogren’s syndrome in a mouse model. PloS one 8, e77605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jin JO, Yu Q, 2013. T Cell-Associated Cytokines in the Pathogenesis of Sjogren’s Syndrome. Journal of clinical & cellular immunology S! [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Joller N, Lozano E, Burkett PR, Patel B, Xiao S, Zhu C, Xia J, Tan TG, Sefik E, Yajnik V, Sharpe AH, Quintana FJ, Mathis D, Benoist C, Hafler DA, Kuchroo VK, 2014. Treg cells expressing the coinhibitory molecule TIGIT selectively inhibit proinflammatory Th1 and Th17 cell responses. Immunity 40, 569–581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kannan AK, Su Z, Gauvin DM, Paulsboe SE, Duggan R, Lasko LM, Honore P, Kort ME, McGaraughty SP, Scott VE, Gauld SB, 2019. IL-23 induces regulatory T cell plasticity with implications for inflammatory skin diseases. Scientific reports 9, 17675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Katsifis GE, Moutsopoulos NM, Wahl SM, 2007. T lymphocytes in Sjogren’s syndrome: contributors to and regulators of pathophysiology. Clin Rev Allergy Immunol 32, 252–264. [DOI] [PubMed] [Google Scholar]
  36. Keindl M, Davies R, Bergum B, Brun JG, Hammenfors D, Jonsson R, Lyssenko V, Appel S, 2022. Impaired activation of STAT5 upon IL-2 stimulation in Tregs and elevated sIL-2R in Sjogren’s syndrome. Arthritis Res Ther 24, 101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kim GY, Ligons DL, Hong C, Luckey MA, Keller HR, Tai X, Lucas PJ, Gress RE, Park JH, 2012. An in vivo IL-7 requirement for peripheral Foxp3+ regulatory T cell homeostasis. J Immunol 188, 5859–5866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lee BH, Tudares MA, Nguyen CQ, 2009. Sjogren’s syndrome: an old tale with a new twist. Arch Immunol Ther Exp (Warsz) 57, 57–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lee C, Song JH, Cha YE, Chang DK, Kim YH, Hong SN, 2022. Intestinal Epithelial Responses to IL-17 in Adult Stem Cell-derived Human Intestinal Organoids. J Crohns Colitis 16, 1911–1923. [DOI] [PubMed] [Google Scholar]
  40. Li DY, Xiong XZ, 2020. ICOS(+) Tregs: A Functional Subset of Tregs in Immune Diseases. Frontiers in immunology 11, 2104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Li X, Li X, Qian L, Wang G, Zhang H, Wang X, Chen K, Zhai Z, Li Q, Wang Y, Harris DC, 2007. T regulatory cells are markedly diminished in diseased salivary glands of patients with primary Sjogren’s syndrome. J Rheumatol 34, 2438–2445. [PubMed] [Google Scholar]
  42. Lin JC, Pan KL, Li CF, Lee KF, Lin KY, Lin KM, Lin CY, 2023. Altered subgroups of regulatory T cells in patients with primary Sjogren’s syndrome. Heliyon 9, e15565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Lin X, Rui K, Deng J, Tian J, Wang X, Wang S, Ko KH, Jiao Z, Chan VS, Lau CS, Cao X, Lu L, 2015. Th17 cells play a critical role in the development of experimental Sjogren’s syndrome. Ann Rheum Dis 74, 1302–1310. [DOI] [PubMed] [Google Scholar]
  44. Liu MF, Lin LH, Weng CT, Weng MY, 2008. Decreased CD4+CD25+bright T cells in peripheral blood of patients with primary Sjogren’s syndrome. Lupus 17, 34–39. [DOI] [PubMed] [Google Scholar]
  45. Long SA, Buckner JH, 2011. CD4+FOXP3+ T regulatory cells in human autoimmunity: more than a numbers game. J Immunol 187, 2061–2066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Lucca LE, Axisa PP, Singer ER, Nolan NM, Dominguez-Villar M, Hafler DA, 2019. TIGIT signaling restores suppressor function of Th1 Tregs. JCI insight 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Mavragani CP, Moutsopoulos HM, 2007. Conventional therapy of Sjogren’s syndrome. Clin Rev Allergy Immunol 32, 284–291. [DOI] [PubMed] [Google Scholar]
  48. Milovanovic J, Popovic B, Milovanovic M, Kvestak D, Arsenijevic A, Stojanovic B, Tanaskovic I, Krmpotic A, Arsenijevic N, Jonjic S, Lukic ML, 2017. Murine Cytomegalovirus Infection Induces Susceptibility to EAE in Resistant BALB/c Mice. Frontiers in immunology 8, 192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Nguyen C, Singson E, Kim JY, Cornelius JG, Attia R, Doyle ME, Bulosan M, Cha S, Peck AB, 2006. Sjogren’s syndrome-like disease of C57BL/6.NOD-Aec1 Aec2 mice: gender differences in keratoconjunctivitis sicca defined by a cross-over in the chromosome 3 Aec1 locus. Scand J Immunol 64, 295–307. [DOI] [PubMed] [Google Scholar]
  50. Nguyen CQ, Cha SR, Peck AB, 2007. Sjogren’s syndrome (SjS)-like disease of mice: the importance of B lymphocytes and autoantibodies. Front Biosci 12, 1767–1789. [DOI] [PubMed] [Google Scholar]
  51. Nguyen CQ, Yin H, Lee BH, Carcamo WC, Chiorini JA, Peck AB, 2010. Pathogenic effect of interleukin-17A in induction of Sjogren’s syndrome-like disease using adenovirus-mediated gene transfer. Arthritis Res Ther 12, R220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Nguyen CQ, Yin H, Lee BH, Chiorini JA, Peck AB, 2011. IL17: potential therapeutic target in Sjogren’s syndrome using adenovirus-mediated gene transfer. Lab Invest 91, 54–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Nguyen HD, Aljamaei HM, Stadnyk AW, 2021. The Production and Function of Endogenous Interleukin-10 in Intestinal Epithelial Cells and Gut Homeostasis. Cellular and molecular gastroenterology and hepatology 12, 1343–1352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Nikolov NP, Illei GG, 2009. Pathogenesis of Sjogren’s syndrome. Curr Opin Rheumatol 21, 465–470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Omrani O, Krepelova A, Rasa SMM, Sirvinskas D, Lu J, Annunziata F, Garside G, Bajwa S, Reinhardt S, Adam L, Kappel S, Ducano N, Donna D, Ori A, Oliviero S, Rudolph KL, Neri F, 2023. IFNgamma-Stat1 axis drives aging-associated loss of intestinal tissue homeostasis and regeneration. Nature communications 14, 6109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Overacre-Delgoffe AE, Chikina M, Dadey RE, Yano H, Brunazzi EA, Shayan G, Horne W, Moskovitz JM, Kolls JK, Sander C, Shuai Y, Normolle DP, Kirkwood JM, Ferris RL, Delgoffe GM, Bruno TC, Workman CJ, Vignali DAA, 2017. Interferon-gamma Drives Treg Fragility to Promote Anti-tumor Immunity. Cell 169, 1130–1141 e1111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Petermann F, Rothhammer V, Claussen MC, Haas JD, Blanco LR, Heink S, Prinz I, Hemmer B, Kuchroo VK, Oukka M, Korn T, 2010. gammadelta T cells enhance autoimmunity by restraining regulatory T cell responses via an interleukin-23-dependent mechanism. Immunity 33, 351–363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Prakhar P, Alvarez-DelValle J, Keller H, Crossman A, Tai X, Park YK, Park JH, 2021. The small intestine epithelium exempts Foxp3+ Tregs from their IL-2 requirement for homeostasis and effector function. JCI insight 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Ramos-Casals M, Tzioufas AG, Stone JH, Siso A, Bosch X, 2010. Treatment of primary Sjogren syndrome: a systematic review. JAMA 304, 452–460. [DOI] [PubMed] [Google Scholar]
  60. Riviere E, Pascaud J, Virone A, Dupre A, Ly B, Paoletti A, Seror R, Tchitchek N, Mingueneau M, Smith N, Duffy D, Cassard L, Chaput N, Pengam S, Gauttier V, Poirier N, Mariette X, Nocturne G, 2021. Interleukin-7/Interferon Axis Drives T Cell and Salivary Gland Epithelial Cell Interactions in Sjogren’s Syndrome. Arthritis Rheumatol 73, 631–640. [DOI] [PubMed] [Google Scholar]
  61. Sada PR, Isenberg D, Ciurtin C, 2015. Biologic treatment in Sjogren’s syndrome. Rheumatology (Oxford) 54, 219–230. [DOI] [PubMed] [Google Scholar]
  62. Sasidharan Nair V, Elkord E, 2018. Immune checkpoint inhibitors in cancer therapy: a focus on T-regulatory cells. Immunology and cell biology 96, 21–33. [DOI] [PubMed] [Google Scholar]
  63. Schmaler M, Broggi MA, Lagarde N, Stocklin BF, King CG, Finke D, Rossi SW, 2015. IL-7R signaling in regulatory T cells maintains peripheral and allograft tolerance in mice. Proc Natl Acad Sci U S A 112, 13330–13335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Segal B, Bowman SJ, Fox PC, Vivino FB, Murukutla N, Brodscholl J, Ogale S, McLean L, 2009. Primary Sjogren’s Syndrome: health experiences and predictors of health quality among patients in the United States. Health Qual Life Outcomes 7, 46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Simonetta F, Gestermann N, Martinet KZ, Boniotto M, Tissieres P, Seddon B, Bourgeois C, 2012. Interleukin-7 influences FOXP3+CD4+ regulatory T cells peripheral homeostasis. PloS one 7, e36596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Tai X, Van Laethem F, Pobezinsky L, Guinter T, Sharrow SO, Adams A, Granger L, Kruhlak M, Lindsten T, Thompson CB, Feigenbaum L, Singer A, 2012. Basis of CTLA-4 function in regulatory and conventional CD4(+) T cells. Blood 119, 5155–5163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Takashima S, Martin ML, Jansen SA, Fu Y, Bos J, Chandra D, O’Connor MH, Mertelsmann AM, Vinci P, Kuttiyara J, Devlin SM, Middendorp S, Calafiore M, Egorova A, Kleppe M, Lo Y, Shroyer NF, Cheng EH, Levine RL, Liu C, Kolesnick R, Lindemans CA, Hanash AM, 2019. T cell-derived interferon-gamma programs stem cell death in immune-mediated intestinal damage. Science immunology 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Tarique M, Saini C, Naqvi RA, Khanna N, Sharma A, Rao DN, 2017. IL-12 and IL-23 modulate plasticity of FoxP3(+) regulatory T cells in human Leprosy. Molecular immunology 83, 72–81. [DOI] [PubMed] [Google Scholar]
  69. Verstappen GM, Corneth OBJ, Bootsma H, Kroese FGM, 2018. Th17 cells in primary Sjogren’s syndrome: Pathogenicity and plasticity. J Autoimmun 87, 16–25. [DOI] [PubMed] [Google Scholar]
  70. Voulgarelis M, Tzioufas AG, 2010. Pathogenetic mechanisms in the initiation and perpetuation of Sjogren’s syndrome. Nat Rev Rheumatol 6, 529–537. [DOI] [PubMed] [Google Scholar]
  71. Wang Q, He J, Flies DB, Luo L, Chen L, 2017. Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability. Scientific reports 7, 6086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Youinou P, Pers JO, 2011. Disturbance of cytokine networks in Sjogren’s syndrome. Arthritis Res Ther 13, 227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Zhou J, Jin JO, Kawai T, Yu Q, 2016. Endogenous programmed death ligand-1 restrains the development and onset of Sjgren’s syndrome in non-obese diabetic mice. Scientific reports 6, 39105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Zhou J, Yu Q, 2018. Anti-IL-7 receptor-alpha treatment ameliorates newly established Sjogren’s-like exocrinopathy in non-obese diabetic mice. Biochimica et biophysica acta 1864, 2438–2447. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES