The Comparative Effect of Plasma Exosomes of Young and Old People on the Expression of BCL-2 and BAX Genes in Hematopoietic Stem Cells

Abstract

Apoptosis may disrupt differentiation of hematopoietic stem cells (HSCs), which can affect aging. Thus, the main goal of this study was to compare the effect of plasma exosomes from young and old people on the expression of Bcl-2-associated X (BAX) and B-cell lymphoma 2 (BCL-2) genes in the HSCs. Plasma samples were acquired from four elderly adults and four younger adults, referring to Blood Transfusion Organization of Tehran-Iran during August 2022– September 2022.Then, the exosomes of the samples were extracted and analyzed using DLS, TEM, and CD63 surface marker. HSCs were isolated from umbilical cord blood cells. The MTT test was used to assess the viability of exosomes-treated HSCs at doses of 5 and 10 μg/ml. The expression of BAX and BCL-2 genes in the cells was examined using real-time PCR. A one-way analysis of variance (ANOVA) was performed to examine the distinctions among five groups. The viability of HSCs was not affected by the exosomes from young and old people than the control group (P = 0.453). Exosomes from young people (doses 5 and 10 µg/ml) did not have any significant impacts on BAX (P = 0.746, and P = 0.345, respectively) and BCL-2 (P = 0.773, and P = 0.461, respectively) expression in the HSCs compared to the control group. The BAX gene was significantly upregulated and the BCL-2 gene was significantly downregulated after utilizing the exosomes derived from the plasma of elderly individuals (dose 10 µg/ml) compared to the control (P = 0.001, P = 0.002, respectively). The current research shows that aged people's exosomes can increase BAX/ BCL-2 ratio in umbilical cord blood-derived HSCs compared to control and young groups.

Introduction

Blood is produced by hematopoietic stem cells throughout life [1]. Maintaining self-renewal and differentiation of stem cells is crucial for the homeostasis of the hematological system [2]. Self-renewal and differentiation in hematopoietic stem cells (HSC) are decreased by age, regardless of the microenvironment, due to many intrinsic factors [3]. It was once believed that DNA damage would lead to HSC senescence [1, 4]. Recent discoveries have revealed more biological processes, including epigenetics, chromatin structure, autophagy, proteostasis, metabolic alterations, and their relationships with HSCs [5–7]. These naturally vary with age in HSC and are crucial for understanding stem cell aging. Understanding HSC aging is important for blood disorders including myelodysplastic syndromes and acute myeloid leukemia due to the growing older population and the fact that aging is the main risk factor for most diseases [8].

Numerous investigations have been undertaken in recent times to examine the various elements present in the blood [9]. Exosomes have emerged as novel biomarkers associated with the aging phenomenon. The capacity of exosomes, the tiniest extracellular vesicles, is to facilitate intercellular communication and transfer biological information between young and old cells in a bidirectional manner [10]. Exosomes are a type of endocytic carriers that are typically 50–200 nm in size [11]. They convey lipids, carbohydrates, nucleic acids, mRNAs, microRNAs (miRNA), and proteins, which in turn affects the behavior of destination cells. There is considerable evidence of the involvement of exosomes and miRNA derived from exosomes in normal and pathological aging processes [12, 13]. Exosomes are widely acknowledged for their numerous benefits, including the secure preservation of advantageous constituents and their targeted delivery to impaired tissue cells [14, 15]. Exosomes have the potential to be biomarkers for illness diagnosis and could be used as a vehicle for drug delivery [16].

The involvement of apoptosis in the process of aging and the development of age-related disorders has been investigated in multiple organs, including the brain, cardiovascular system, immune system, gut, eye macula, prostate, and ovary [17, 18]. Apoptosis leads to the progressive decline in both the structural integrity and functional capacity of tissues and organs during the aging process. The BCL-2 family proteins, which regulate apoptosis, contain a diverse array of proteins that encompass both inhibitors and activators of cell death [19]. The aging process has been shown in previous research to result in a decline and increase in the levels of BCL-2 and BAX proteins, which are recognized as anti-apoptotic and pro-apoptotic, respectively [20].

To our current understanding, the impact of young and old exosomes on altering the expression of Bax and BCL2 in HSCs has not been explored. As HSCs are increasingly subjected to environmental stress, mutation, clonal hematopoiesis, and replication errors during aging, it is crucial to understand the pathways that could influence cellular aging [21]. This understanding may help in supporting the restoration of the hematopoietic system, maintaining homeostasis, preventing cell damage, and ultimately enhancing the quality of human life [22]. Hence, given the significance of apoptosis in the aging process and especially in HSCs, in addition to the body's ability to interact with these cells through exosomes; the aim of this study was to assess the impact of plasma exosomes derived from young and old individuals on the BCL-2 and BAX genes in HSCs.

Materials and Methods

Participants and Ethical Consideration

The current experimental study was conducted in vitro. The current research is a component of a study examining the impact of exosomes derived from elderly and youthful individuals on the aging process of HSCs sourced from umbilical cord blood. Plasma samples (four elderly and four younger adults) were collected from the Blood Transfusion Organization of Tehran-Iran during August 2022– September 2022. The sample size was selected based on previous studies [23–25]. In order to participate in the study, individuals had to meet specific criteria. The inclusion criteria consisted of being male and being in the age range of 25–44 for young men and 60–75 for older men. In contrast, individuals falling outside the specified age range, individuals with type 1 and type 2 diabetes, acute and chronic inflammatory conditions, infectious diseases, cancer, and those who have undergone any surgical procedures within the 90 days preceding their participation in the study were excluded. Furthermore, exclusion criteria encompassed factors such as steroid medication, smoking, drug usage, and the presence of hormonal abnormalities such as hypothyroidism and Cushing's syndrome. The trial was conducted in accordance with confidentiality protocols and participants' informed consent. The Ethics committee of Tehran University of Medical Sciences approved it with the ethics ID: IR.TUMS.SPH.REC.1401.112.

Sample Collection

The first step in collecting blood samples was to conduct thorough physical examinations on both research groups. During these examinations, several characteristics of the individuals, including age, blood group, blood pressure, weight, and height, were meticulously documented. The presence of illnesses, including human immunodeficiency virus (HIV), hepatitis B, hepatitis C, and syphilis, was tested through a series of examinations. Subsequently, the specimens were sent to the research laboratory division of the Faculty of Allied Medical Sciences at Tehran University of Medical Sciences, where those were preserved at a temperature of -80°C until the isolation of exosomes.

Isolation of Plasma Exosomes

Exosomes were isolated using ultracentrifugation. In order to achieve this objective, the plasma samples were initially subjected to defreezing at ambient temperature. In the next stage, the plasma samples were diluted 1:3 with a sterile phosphate-buffered saline (PBS) solution. At a temperature of 4°C, the diluted samples were centrifuged for 30 min at 17,000 × g. The purpose of this process was to eliminate cell bodies and any excess apoptotic bodies. Following the initial centrifugation, the supernatant was subjected to further centrifugation using an ultracentrifuge model Beckman L5-65 (Beckman, USA). This subsequent centrifugation step was carried out for 75 min at 100,000 × g and at a temperature of 4°C. Further, the pellet was resuspended in 2 ml of PBS and further filtered through a 0.22 μm filter. The filtered suspension was adjusted to a final volume of 13 ml and subjected to a subsequent centrifugation step at 100,000 g and 4°C for 75 min. Subsequently, the pellet comprising exosomes was resuspended in a sterile PBS, with a volume of 0.5 ml, and stored at a temperature of -80°C until further experimentation.

Characterization of Exosomes

The exosomes were characterized after the extraction process. The quantification of exosomal proteins was conducted using the bicinchoninic acid (BCA) assay. The DNAbiotech BCA Protein Assay kit (DNAbiotech, Iran) was utilized for this purpose. The manufacturer's guidelines were followed in the operational procedure. Bovine serum albumin (BSA) was considered as the standard. By using the dynamic light scattering [DLS (Malvern, United Kingdom)], the size of exosome particles was assessed. The transmission electron microscope [TEM (EM10C-100kV Zeiss, Germany)] was used to evaluate the shape of exosomes. The analysis was carried out on exosome samples that were obtained fresh and had not been frozen. The western blotting technique was employed to quantify the particular biomarker of exosomes (CD63) using CD63 antibody (Santa Cruz Biotechnology, USA) [26].

Isolation of HSCs Using MACS Technique

Umbilical cord blood samples were obtained from the Iranian Blood Transfusion Organization. The mononuclear cells in the umbilical cord blood were isolated using the Ficoll method and a concentration gradient. Following the extraction of peripheral blood mononuclear cells, hematopoietic stem and progenitor cells were further extracted utilizing the magnetic-activated cell sorting (MACS) approach. The cells obtained using the MACS technique exhibited a notable level of purity and viability. The isolation of CD34⁺ HSCs was carried out using the methodology provided by the Miltenyi Biotec kit (USA), employing a positive selection approach. The kit contains beads that have been coupled with CD34 antibodies. To confirm the purity of isolated HSCs, flow cytometric analysis was carried out using APC-conjugated CD34 (Biolegend) and FITC-conjugated CD45 (Biolegend). The data obtained were analyzed in the FlowJo software (version 8). The extracted HSCs were cultured in Roswell Park Memorial Institute (RPMI) culture medium supplemented with penicillin/streptomycin antibiotics. The cells were incubated at a temperature of 37 °C and 5% CO₂.

Evaluation of the Viability of HSCs Treated With Exosomes

The assessment of the viability of the HSCs was conducted using the MTT technique. At first, a volume of 100 μl of RPMI medium containing 5 × 10³ cells was added into each well of a 96-well plate. Then, 100 μl of RPMI medium containing exosome concentrations of 5 and 10 μg/ml were added to each well for 24 h. In addition, we had a blank experiment with 100 μl RPMI medium containing PBS. Subsequently, the plates were incubated at a temperature of 37°C and 5% CO₂. In the next stage, 10 μl of MTT solution was added and the plate was placed within the incubator for a duration of 4 h. Following the incubation period, the solution was gently pipeted with 100 μl of dimethyl sulfoxide (DMSO) and put in a dark place for 10 min. At last, the optical density of the plate was measured at a wavelength of 570 nm. The percentage of cell viability was then computed using the following formula.

$$\mathrm{Percentage}\mathrm{of}\mathrm{viable}\mathrm{cells}=\left(\mathrm{average},,\mathrm{absorbance},,\mathrm{of},,\mathrm{control},,\mathrm{samples},-,\text{blank},/,\mathrm{average},,\mathrm{absorbance},,\mathrm{of},,\mathrm{treated},,\mathrm{samples},-,\text{blank}\right)\times 100$$

Treatment With Exosomes and RNA Extraction

The expression of BAX and BCL-2 genes was measured in the HSCs treated with RPMI medium containing exosomes and PBS (as control group). Exosome concentrations of 5 and 10 μg/ml were used to treat cells for 24 h. The cells were then collected and centrifuged at 3000 × g for 5 min. After washing with PBS, the cell pellet was centrifuged. The kit's instructions were followed to extract cellular RNA. The RNA from the cells was extracted using the SinaPureTM ONE kit (catalog number: Ex6031). The RNA quantity was determined using spectrophotometry, while its quality was assessed via electrophoresis on a 1.5% agarose gel.

cDNA Synthesis

The cDNA synthesis process was performed using the SinaClon First Strand cDNA Synthesis Kit, (catalog number RT5201).

Real Time PCR Method

The Roche LightCycler® 96 detection system was used to conduct the real time PCR analysis to assess changes in the expression of the BCL-2 and BAX genes in the HSCs. In order to assess the expression of the target genes, a real time PCR was conducted in a 20 μL volume, employing SYBR green to detect the PCR products generated during the reaction. Table 1 contains the primer sequences for the genes being investigated. The experimental procedure was consisting of an initial denaturation cycle at 95°C for a duration of 10 min, followed by 40 cycles of denaturation at 95°C for 15 s and annealing/extension at 60°C for 60 s. The temperature range of 60°C to 95°C was utilized to plot the melting point. Finally, BAX and BCL-2 mRNA expressions were normalized to β-actin gene expression and delta delta Ct (ΔΔCt) method was used to calculate relative expression of genes.

Table 1.

Primers used in real time PCR reaction

Gene	Forward Primer (5’ → 3’)	Reverse Primer (5’ → 3’)
BAX	5’CCCGAGAGGTCTTTTTCCGAG3’	5’CCAGCCCATGATGGTTCTGAT3’
BCL-2	5’AGAGATTCATGCCTGTGCCC3’	5’GTCAATCCGCAGGAATCCCA3’
β-ACTIN	5’TCCTTCCTGGGCATGGAGT3’	5’ACTGTGTTGGCGTACAGGTC3’

Statistical Analysis

All statistical analyses were conducted using SPSS software v.26 (SPSS, Chicago, IL, USA), and all graphs were generated using GraphPad Prism 8.0 (San Diego, CA, USA). The researchers employed descriptive statistics to provide a comprehensive overview of the individuals' characteristics. The Shapiro–Wilk test was used to evaluate the data's normality. The data in this study is derived from at least three independent and separate studies. The analysis involved conducting a one-way analysis of variance (ANOVA) to examine the distinctions among five groups. Additionally, a Tukey honestly significant difference (HSD) post hoc test was employed. A significance threshold of p < 0.05 was utilized. All data were presented as mean ± SD.

Results

Participant Characteristics

Four young male with a mean age of 37 ± 2.5 (SD) and four elderly men with a mean age of 62 ± 0.75 (SD) were recruited to the study (P < 0.001).

Characterization of Exosomes

Exosomes from plasma samples were assessed for size using the DLS technique. According to Fig. 1A, the mean size of exosomes was determined to be 135.7 nm. The examination of exosomes derived from plasma was conducted utilizing a TEM to assess their morphology. The observations revealed that the structural integrity of exosomes' membrane and their spherical morphology were preserved (Fig. 1B). The CD63 marker was assessed as a surface marker of exosomes through the utilization of the western blot. The results shown in Fig. 1C demonstrate the identification of bands with a molecular weight of 26 kDa, confirming the presence of CD63.

Fig. 1.

Characterization of exosomes extracted from plasma samples was performed using DLS, TEM and Western blotting tests. A DLS results of exosomes with an average size of 135.7 nm, B Examining exosomes with TEM microscope which shows their coherent and spherical structure, C Western blotting bands to evaluate the presence of the CD63 marker

Verification of HSCs

As the data presented in Fig. 2, 98.9% of the cells expressed the CD34 marker. This finding confirms the accuracy and validity of the research conducted.

Fig. 2.

The flow cytometry was carried out to evaluate the presence of CD34 marker in hematopoietic stem cells isolated from the umbilical cord blood

Evaluation of the Viability of HSCs in the Presence of Exosome

The MTT assay was utilized to examine the toxicity effect of exosomes on HSCs obtained from umbilical cord blood. The findings are depicted in Fig. 3. different doses of exosomes did not have toxicity on HSCs (P = 0.453 among the five groups).

Fig. 3.

Viability of HSCs was tested in the presence of RPMI medium containing concentrations of 5 and 10 μg/ml of exosomes isolated from old (O-Exo), young (Y-Exo) people and control (RPMI medium containing PBS). All data were presented as mean ± SD

Evaluation of Gene Expression

The results shown in Fig. 4A show that the level of BCL-2 gene expression in HSCs treated with 5 μg/ml exosomes from elderly people was not significantly different than the control group (P = 0.083), but the concentration of 10 μg/ml exosome of elderly people caused a significant decrease in the expression of BCL-2 compared to the control (P = 0.002). Moreover, a significant difference was observed between the exosomes of young and old people at the concentration of 10 μg/ml (P = 0.020). Also, the expression of BCL-2 in cells treated with the concentration of 10 μg/ml old exosomes was significantly reduced in comparison with the cells treated with the concentration of 5 μg/ml young exosomes (P = 0.009). However, the expression of this gene in the cells treated with 5 and 10 μg/ml exosomes of young people was almost similar to the control (P = 0.773, and P = 0.461, respectively).

Fig. 4.

Expression of BCL-2 (A) and BAX (B) and BAX/ BCL-2 (C) was compared in HSCs treated with RPMI medium containing concentrations of 5 and 10 μg/ml exosomes from old (O), young (Y) individuals and control (RPMI medium containing PBS). All data were presented as mean ± SD. (*P < 0.05, **P < 0.01, ***P < 0.001)

The BAX gene expression level was significantly higher in the HSCs treated with 5 μg/ml (P = 0.018) and 10 μg/ml (P = 0.001) exosomes of elderly people than the control group. At the concentration of 10 μg/ml, the exosomes of old people caused a significant increase in BAX gene expression compared to the concentrations of 5 μg/ml (P = 0.002) and 10 μg/ml (P = 0.007) of exosomes of young people. Nevertheless, the expression of this gene was non-significantly increased in the cells treated with 5 μg/ml (P = 0.746) and 10 μg/ml (P = 0.345) exosomes of young people compared to the control group. The results are shown in Fig. 4B.

The BAX/ BCL-2 expression ratio was calculated and compared. The results are shown in Fig. 4C. The ratio of BAX/ BCL-2 was significantly increased in the HSCs that received old exosomes with a concentration of 10 g/ml compared to other groups (P < 0.001). However, other groups had not significant differences in the BAX/BCL-2 expression ratio.

Discussion

Our findings demonstrated that exosome administration did not have any impact on cell viability. In the HSCs treated with exosomes from young individuals, expression levels of BAX and BCL-2 were reported to be comparable to those of the control group. Nevertheless, it is noteworthy that the exosomes derived from the plasma of elderly individuals elicited a significant upregulation in the expression of the pro-apoptotic gene BAX, while concurrently induced a downregulation in the expression of the anti-apoptotic gene BCL-2.

In line with our study, in 2023, Sourki et al. [27] have investigated the effect of the plasma-derived extracellular vesicles of elderly and young human donors on human umbilical cord blood (hUCB)-derived HSCs in vitro. Their results showed that extracellular vesicles changed the differentiation and growth functionality of HSCs depending on the age of the donor. On the contrary of the current findings, extracellular vesicles of young donors could improve the self-renewal and proliferation potential of HSCs whereas aged individuals stimulated senescence-related differentiation. They indicated a down-regulation of miR-146 and an up-regulation of miR-29 and miR-96 in extracellular vesicles derived from elderly donors, promoting senescence fate.

In other studies, the effect of plasma exosome on HSCs has not been evaluated. An experiment investigated the effects of young exosomes on aging, aged animals that were given young exosomes showed changes in markers related to aging. The expression of p16^Ink4A, MTOR, and IGF1R genes had significantly been decreased in the lungs and livers of aged mice. Moreover, telomerase-related genes such as Men1, Mre11a, Tep1, Terf2, Tert, and Tnks had been significantly upregulated. These findings indicated that the expression of aging-related molecules in aged animals could be altered by young mouse exosomes [28]. In another study, aged bone marrow MSCs (OMSCs) were treated with exosomes from human umbilical cord MSCs (UMSCs). Senescence-related β-galactosidase activity and p53, p21, and p16 expression were considerably higher in OMSCs compared to UMSCs. These OMSC senescent characteristics were greatly attenuated by UMSC exosomes. In addition, MiR-136 expression was higher in UMSCs and exosome treated OMSCs than OMSCs [29]. On the other hand, adipose-derived stem cell exosomes (ADSC-Exos) were assessed for their anti-aging effects on skin fibroblasts (HDF) by Gou et al. This study demonstrated that ADSC-Exos minimized HDF senescence and boosted HDF migration. ADSC-Exos promoted type I collagen expression and decreased ROS and SA-β-Gal activity in HDFs. The study revealed that ADSC-Exos significantly decreased the expression of aging-related proteins, including p53, p21, and p16 [30]. So, exosomes transferred features from young to elderly cells in all investigations to prevent the aging processes.

How exosomes affect the expression of aging-related factors is not known precisely. We speculate that plasma exosomes obtained from young and old individuals were able to transfer their contents to HSCs and affect these cells. It has been showed that exosomes derived from stem cells contain antioxidant enzymes [31, 32]. On the contrary, higher levels of ROS in plasma EVs derived from old mice compared to young mice indicates the ability of old exosomes to spread oxidative stress [33]. Moreover, Sourki et al. [27] have shown that the exosome associated miRNAs could modulate the aging process.

The current study had some limitations. Low sample size was a limitation in our research and next researchers must consider it in the future to substantiate the hypothesis. In addition, this study only looked at concentrations of 5 and 10 μg/ml in exosomes, but more concentrations are required for a more reliable assessment. Exosome-induced apoptosis was determined by examining the expression of apoptotic genes. While flow cytometry can provide more precise apoptotic rate estimates (examining apoptosis by annexin V/ PI to confirm cytologically). This study used HSCs from umbilical cord blood samples (as young HSCs), but future research could use HSCs from old people to compare the effects of old and young exosomes better than the current study.

Conclusion

This study has examined the effect of plasma exosomes from young and old adults on expression of BAX and BCL-2 in HSCs for the first time. The present study has found that the exosomes of aged people altered the expression of BAX and BCL-2 in HSCs. The expression of these genes was not affected by the exosomes of young people. The effect mechanism of exosomes on BAX and BCL-2 in HSCs must be assessed in next investigations like compounds contained in exosomes and changes caused by exosomal miRNAs. By addressing these concerns, we can gain a better understanding of hematopoietic stem cell aging, which is expected to be studied in the future.

Authors’ Contributions

All authors contributed to the study conception and design; data acquisition, analysis, and interpretation; and drafting and revising of the manuscript. All authors discussed the results and contributed to the final manuscript.

Funding

The current investigation was supported by the Tehran University of Medical Sciences (grant no. 99111264006).

Data Availability

The datasets used and/or analysed during the study available from the corresponding author on reasonable request.

Declarations

Ethical Approval

The protocols were performed in compliance with the Declaration of Helsinki and approved by the Ethics Committee of Tehran University of Medical Sciences (ID number: IR.TUMS.SPH.REC.1401.112). All individuals involved in the study were required to provide informed consent by means of affixing their signature to the consent form.

Consent for Publication

Not applicable.

Competing Interests

The authors declare no conflict of interests.