Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Oct 28.
Published in final edited form as: Methods Mol Biol. 2024;2837:257–270. doi: 10.1007/978-1-0716-4027-2_22

In vitro enzymatic and cell culture-based assays for measuring activity of HBV ribonuclease H inhibitors

Qilan Li 1, John E Tavis 1,*
PMCID: PMC11514518  NIHMSID: NIHMS2028874  PMID: 39044091

Summary

HBV is a small, enveloped DNA virus that replicates by reverse transcription of an RNA intermediate. Current anti-HBV treatment regiments employ interferon α or nucleos(t)ide analogs, but they are not curative, are of long duration and can be accompanied by systemic side-effects. The HBV ribonuclease H (RNaseH) is essential for viral replication, however it is unexploited as a drug target. RNaseH inhibitors that actively block viral replication would represent an important addition to the potential new drugs for treating HBV infection. Here we describe two methods to measure the activity of RNaseH inhibitors. The DNA oligonucleotide-directed RNA cleavage assay allows mechanistic analysis of compounds for anti-HBV RNaseH activity. Analysis of preferential inhibition of plus-polarity DNA strand synthesis by HBV RNaseH inhibitors in a cell culture model of HBV replication can be used to measure the ability of RNaseH inhibitors to block viral replication.

Keywords: Hepatitis B virus, Ribonuclease H, Inhibitors, DNA-oligonucleotide directed RNA cleavage assay, HBV core particle DNA, quantitative PCR

1. Introduction

The hepatitis B virus (HBV) is a small, enveloped DNA virus that replicates within cytoplasmic viral core particles by reverse transcription via RNA intermediate [1,2]. The encapsidated viral genome is a 3.2 kb partially double-stranded relaxed circular DNA (rcDNA). HBV is hepatotropic virus and upon hepatocyte entry the DNA-containing core particle is translocated into the nucleus where the rcDNA is converted into a covalently closed circular DNA (cccDNA). The cccDNA is the template for viral mRNA and pre-genomic RNA synthesis [1]. Persistence of cccDNA in infected cells is the major mechanism of HBV chronicity [3].

HBV infection remains a major public health problem despite the availability of a prophylactic vaccine [4]. More than 250 million people worldwide are chronically infected with HBV [5] and are at an increased risk for developing end-stage liver disease and hepatocellular carcinoma [4].

Treatment of HBV infection includes the use of pegylated IFN-α and nucleos(t)ide analog chain terminators such as lamivudine, adefovir, tenofovir, and entecavir [4]. While these drugs can slow progression of HBV-induced disease, they rarely eliminate viral infection. Clearly, new drugs with different targets and mechanisms for anti-HBV therapy are urgently needed.

Promising therapeutic approaches that directly target the virus-infected cells, as well as immunotherapeutic strategies that activate the HBV-specific adaptive immune response or innate intrahepatic immunity are being developed [3,6]. The HBV polymerase, the only protein with enzymatic activity encoded by the virus, is a multifunctional enzyme [7]. The reverse transcriptase (RT) activity primes DNA synthesis using a tyrosine in its own N terminal domain, covalently linking the product DNA to the enzyme. The RT activity also synthesizes the viral DNA during reverse transcription of single-stranded pre-genomic RNA to DNA. The ribonuclease H (RNaseH) domain of the HBV polymerase hydrolyzes the RNA strand of RNA/DNA hybrids that are generated during reverse transcription to enable synthesis of the second strand of DNA by the RT activity, yielding a circular, partially double-stranded DNA product called the rcDNA. Both activities are necessary for viral replication, however, currently available direct-acting anti-HBV drugs – the nucleos(t)ide analogs – target HBV RT, whereas RNaseH inhibitors are yet to be developed. Therefore, RNaseH is an attractive target for new anti-HBV drugs that might provide new approach to treat patients when used in combination with current drugs, potentially contributing to a functional cure for HBV infections [8]. We developed a low throughput replication inhibition assay sensitive to HBV RNaseH inhibitors [9] and subsequently adapted the replication inhibition assay to a 96-well mid-throughput format [10]. Use of this assay identified >300 HBV RNaseH inhibitors that effectively inhibit both HBV RNaseH activity and viral replication [11–17]. These compounds are in multiple chemotypes, with the best compounds having 50% effective concentrations (EC50) <100 nM and selectivity indexes in culture >1,100.

This chapter describes two protocols for measuring activity of HBV RNaseH inhibitors. The first is used to test whether a compound directly inhibits the HBV RNaseH activity in vitro in a DNA oligonucleotide-directed RNA cleavage assay [17]. In this assay, the activity of recombinant HBV RNaseH is determined by its ability to cleave an RNA substrate in the form of an RNA:DNA heteroduplex. The RNA fragment products of the reaction are then resolved by urea polyacrylamide gel electrophoresis and detected by fluorescent staining (Figure 1A). Inhibition of RNaseH activity is assessed by quantifying the intensity of cleaved RNA bands after compound addition to the reaction mixture and comparing to the activity of vehicle-treated enzyme (Figure 1B and 1C). The second protocol is used to measure inhibition of HBV replication in cell culture by RNaseH inhibitors. This method is a strand-preferential qPCR assay that detects RNaseH replication inhibitors by measuring preferential suppression of the encapsidated viral plus-polarity DNA strand compared to the minus-polarity DNA strand by quantitative PCR (qPCR) (Figure 2). This is because the HBV plus-polarity DNA strand can only be made when the RNaseH removes the pgRNA from newly synthetized minus-polarity DNA strand and generates the short RNA primer for synthesis of the plus-polarity DNA strand [1,7]. Thus, the amount of plus-polarity DNA is strictly dependent on HBV RNaseH activity. In contrast, synthesis of the minus-polarity DNA strand is largely unaffected by RNaseH inhibitors [18,17,19]. Antiviral activity of RNaseH inhibitors is tested by treating cells replicating HBV (e.g. HepDES19 cells, which contain a tetracycline-repressible expression cassette for a replication-competent HBV genotype D genome [20]) with the compounds and determining the amount of HBV minus- and plus-polarity DNA strands in core particles [15,14,12].

Figure 1. Oligonucleotide-directed RNA cleavage assay.

Figure 1.

Open in a new tab

A. Schematic representation of oligonucleotide-directed RNA cleavage assay. RNA is bound to a complementary DNA oligonucleotide to form the RNA:DNA heteroduplex substrate for RNaseH. The RNaseH cleaves the RNA within the RNA:DNA heteroduplexes. RNA, grey line; DNA, black line; S, substrate; P1 and P2, RNaseH cleavage products of the substrate RNA. B. Example oligonucleotide-directed RNA cleavage assay. Activity of HBV RNaseH is assessed in the presence of different concentration of compound of interest (compound 46, β-thujaplicinol is shown) or in the presence of DMSO as a vehicle control. Reaction products are resolved by denaturing polyacrylamide electrophoresis and detected by fluorimetry on a Typhoon imager. S, substrate, a 264 nt RNA derived from the Duck Hepatitis B Virus genome (DRF+ RNA); P1, cleavage product 1; P2, cleavage product 2; “−”, a non-complementary DNA oligonucleotide as a specificity control; “+ ”, complementary DNA oligonucleotide; RNA only, includes RNA but no enzyme as a control for RNA quality; RNA + #46, control for compound solution purity and lack of compound-induced non-specific RNA cleavage with no enzyme present. C. Example of quantitation of compound anti-HBV RNaseH activity. The intensity of P2 band was quantified using ImageJ. Non-specific background values were determined from the incorrect oligonucleotide negative control lane and subtracted from all experimental values. Relative activity of HBV RNaseH is presented as the percentage of intensity of the P2 band with compound present in the reaction relative to the intensity of P2 band in the control vehicle-containing reaction. Data are mean values ± one standard deviation from three independent experiments. Figure is modified from [9].

Figure 2. Replication inhibition assay.

Figure 2.

Open in a new tab

A procedural flow-chart is shown. Plus-polarity DNA is measured by amplifying HBV DNA across the gap in the minus-polarity DNA strand in the core particle-derived rcDNA. Minus-polarity DNA strands are measured by amplifying sequences downstream of the 3’ end of the vast majority of plus-polarity DNA strands in viral cores.

2. Materials

  1. 10% dimethyl sulfoxide (DMSO).

  2. Diethylpyrocarbonate (DEPC) H2O (see Note 1).

  3. 10x RH buffer: 500 mM Tris-HCl, pH 7.5; 50 mM MgCl2; 1,000 mM NaCl; 20 mM TCEP; 0.5% Tween 20 (see Note 2).

  4. 0.5% octylphenoxy poly(ethyleneoxy)ethanol (NP-40).

  5. RNaseOut™ Recombinant Ribonuclease Inhibitor (ThermoFisher), 100 mM.

  6. 5x TBE buffer: 1.1 M Tris-HCl; 900 mM Boric Acid; 25 mM EDTA, pH 8.3.

  7. In vitro-transcribed (DRF+) RNA (can be made using the Ambion MEGAscript Kit). Sequence:

    5’GGGAACAAAAGCUUGCAUGCCUGCAGGUCGACUCUAGAGGAUCCCCACUUUGUCCCGAGCAAAUAUAAUCCUGCUGACGGCCCAUCCAGGCACAGACCGCCUGAUUGGACGGCUUUUCCAUACACCCCUCUCUCGAAAGCAAUAUAUAUUCCACAUAGGCUAUGUGGAACUUAAGAAUUACACCCCUCUCCUUCGGAGCUGCUUGCCAAGGUAUCUUUACGUCUACAUUGCUGUUGUCGUGUGUGACUGUGGGUACCGAGCUCG’ (see Note 3).

  8. Complimentary DNA oligo, D2507: 5’GTTCCACATAGCCTATGTGG3’; non-complimentary control DNA oligo, D2526: 5’CCACATAGGCTATGTGGAAC3’; 1 μg/μL (see Note 4).

  9. 9% Sequencing acrylamide solution, for 100 mL: 5x TBE, 20 mL; 30 mL 30% acrylamide/Bis Solution (19:1) (Bio-Rad 1610154); 48 g urea, H2O to 100 mL (see Note 5).

  10. Ammonium persulfate (APS): 10% solution in water (see Note 6).

  11. N,N,N′,N′-Tetramethylethylenediamine (TEMED).

  12. Sequencing loading buffer: 98% formamide; 10 mM EDTA; 0.025% xylene cyanol; 0.025% bromophenol blue (see Note 6).

  13. SYBER™ Gold stain (ThermoFisher).

  14. 1 M Tris-HCl, pH 7.5.

  15. 0.5 M ethylenediaminetetraacetic acid (EDTA), pH 8.0.

  16. 5 M NaCl.

  17. 1 M CaCl2.

  18. Cell lysis buffer: 10 mM Tris-HCl pH 7.4; 1% Tween; 150 mM NaCl.

  19. Micrococcal nuclease (MN) (2000 U/μL, New England Biolabs #M0247S); MN buffer (NEB #B0247S).

  20. Kappa Probe Force universal PCR master mix (Roche KK4303).

  21. Qiagen protease (Qiagen 19157).

  22. Primers and probe (IDT Inc.) for the plus-polarity HBV DNA strand: 5’CATGAACAAGAGATGATTAGGCAGAG3’; 5’GGAGGCTGTAGGCATAAATTGG3’; 5’/56-FAM/CTGCGCACC/ZEN/AGCACCATGCA/3IABkFQ.

  23. Primers and probe for the minus-polarity HBV DNA strand: 5’GCAGATGAGAAGGCACAGA3’; 5’CTTCTCCGTCTGCCGTT3’; 5’/56-FAM/AGTCCGCGT/ZEN/AAAGAGAGGTGCG/3IABkFQ.

3. Methods

3.1. Oligonucleotide-directed RNA cleavage assay

  1. Thaw frozen compound solutions (typically stored at 10 mM in 100% DMSO). Vortex, then briefly centrifuge. Dilute test compound to 10x desired concentration in 10% DMSO in DEPC H2O.

  2. Prepare a master mix. Calculate the total volume required for each component: Volume for 1 reaction × the total number of reactions.

    Reaction mixture for one reaction:

    3.5 μL DEPC H2O

    2 μL 0.5% NP-40

    2 μL 10x RH buffer

    0.5 μL RNaseOut

    3 μL DNA oligo, 0.05 μg/μL

    2 μL 10x test compound in 10% DMSO or 10% DMSO for vehicle control

    6 μL HBV RNaseH (see Note 7)

    1 μL DRF+ RNA, 0.1 μg/μL

    Assemble the master mix in the following order: H2O, NP-40, RH buffer, RNaseOut. Add all components to 1.5 mL microcentrifuge tube, vortex briefly to mix, then centrifuge the tubes briefly to spin down the contents and eliminate air bubbles.

  3. Assemble reactions on ice. Aliquot 8 μL master mix to each reaction tube. Add 3 μL of the appropriate DNA oligo to each tube. Add 2 μL 10x test compound or 10% DMSO to each tube. Add 6 μL HBV RNaseH protein to each tube (see Note 7). Vortex tubes to mix, then briefly centrifuge the tubes. Initiate the reaction by adding 1 μL of DRF+ RNA immediately before the experiment to each reaction tube, so that the final concentration of RNA in the reaction is 0.02 μg/μL. Vortex briefly to mix, then centrifuge the tubes briefly to spin down the contents and eliminate air bubbles (see Note 8).

  4. Incubate reactions at 37 °C for 60–90 min.

  5. Stop the RNaseH reactions with 80 μL 1x formamide loading buffer per reaction.

3.2. Detection of products from the oligonucleotide-directed RNA cleavage assay.

  1. Warm the 9% sequencing acrylamide solution (9% acrylamide/bis-acrylamide [19:1]/6M urea in 1x TBE) to near room temperature and check to be sure the urea has not crystallized before pouring a gel.

  2. Set up a vertical mini-gel. Prepare 9% sequencing acrylamide mix – for each 10 cm × 11 cm mini-gel mix 20 mL 9% sequencing acrylamide solution, 150 μL 10% APS and 20 μL TEMED. Pour a single-phase gel and insert the comb. Let the gel solidify at room temperature, the gel will be ready to use in approximately 40 minutes.

  3. Remove casting clamps, rinse the plates carefully with dH2O and remove the comb. Mount the gel in a mini-gel rig, using 1x TBE as the running buffer. Rinse the residual unpolymerized acrylamide and urea from the wells using a syringe and needle.

  4. Pre-run the gel for 5 min. at 40 mA (220–230V).

  5. Heat samples to >90°C for 3–5 min. and chill them immediately on ice. Rinse the wells in the gel again with a syringe and needle to remove urea that has diffused into the wells. Promptly load 50 μL of sample per well.

  6. Electrophorese at 40 mA (220–230V) until bromophenol blue is near the bottom of the gel.

  7. Soak gel in dH2O with shaking for 2× 15 min. to remove the urea.

  8. Stain gel with a 10,000-fold dilution of SYBR Gold in TE for 15 min. Briefly rinse gel with dH2O to remove excess stain.

  9. View gel on an UV transilluminator or image with a Typhoon imager (optimal excitation 488–495 nm, optimal emission = 520–540 nm).

  10. Calculate inhibition activity of compounds as the percentage of intensity of P2 band (Figure 1B) with compound present in the reaction relative to the intensity of P2 band in the control DMSO-containing reaction as follows: % Inhibition = 100% - [(relative intensity of P2 band in the presence of inhibitor/relative intensity of P2 band in control vehicle treated sample)*100%] (see Note 9).

3.3. HBV replication inhibition assay in HepDES19 cells

HepDES19 cells are maintained in Dulbecco’s modified Eagle’s medium (DMEM)/F12 supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S) with 1 μg/mL tetracycline on 10 cm Biocoat collagen-coated dishes (Corning). Expression of HBV pgRNA to launch HBV reverse transcription is induced by removing tetracycline from the culture medium. Cells are incubated at 37°C in the presence of 5% CO2.

  1. Day 1. Plate 4 × 104 HepDES19 cells [20] to each of the inner 60 wells in 96-well tissue culture plate in 0.2 mL of DMEM/F12 supplemented with 10% FBS, 100 U/mL penicillin, and 100 U/mL streptomycin. The outer wells are filled with 200 μL of PBS as an evaporation buffer.

  2. Day 3. 48 hours later replace medium with 0.2 mL medium containing the desired concentration of the test compounds. Balance the dimethyl sulfoxide (DMSO) concentration for all samples to 1% v/v. Include at least one well with DMSO added as vehicle control (final concentration 1 %) (see Note 10).

  3. Day 6. Lyse the cells 72 hours after compound treatment. Decant the medium from the wells, wash cells two times with PBS, and incubate cells with 150 μL cell lysis buffer (10 mM Tris-HCl pH 7.4, 1% Tween 20 and 150 mM NaCl) for 40 min at room temperature with shaking at 350 rpm on a microplate shaker (see Note 11).

  4. Transfer the cell lysate to a clean 96-well qPCR plate and centrifuge at 4,500 X g for 5 min at room temperature to sediment nuclei and other debris. Transfer 50 μL supernatant of each cell lysate into a non-skirted 96-well PCR plate.

  5. Digest non-encapsidated nucleic acids by adding 0.13μL micrococcal nuclease (New England Biolabs).1.33μl MN buffer, and 0.54 μl 1M CaCl2 and incubating at 37 °C for 1 hour (see Notes 12 and 13).

  6. Inactivate the micrococcal nuclease by incubating the sample at 70 °C in a thermocycler for 10 minutes.

  7. Digest core particles and cellular proteins with 0.01AU Qiagen protease per sample overnight at 37 °C (see Note 15).

  8. Inactivate the Qiagen protease at 90 oC in a thermocycler for 10 minutes and then place the samples on ice. The cell lysates should be used for real-time qPCR analysis on the same day as they are prepared because PCR quality declines rapidly with longer storage times.

3.4. Detection of HBV DNA from the replication inhibition assay.

  • 1.

    Calculate the total volume required for each component of the qPCR reactions to assemble reaction master mixes. Reaction mixture for one reaction:

    10 μL Kappa Probe Force universal PCR master mix

    0.2 μL forward primer, 20 μM

    0.2 μL reverse primer, 20 μM

    0.3 μL TaqMan probe, 3 μM

    5.3 μL H2O

    4 μL sample DNA from Section 3.3

  • 2.

    Prepare two PCR master mix solutions, one for measuring the plus-polarity strand of HBV DNA and the second one for measuring the minus-polarity DNA strand. Add all components, except for sample DNA, to 1.5 mL microcentrifuge tubes, vortex briefly to mix, then centrifuge the tubes briefly to spin down the contents and eliminate air bubbles.

  • 3.

    Add 16 μL of PCR master mix to each well of an optical qPCR reaction plate (MicroAmp Fast Optical 96-well reaction plate, Applied Biosystems, Cat. No 4346906).

  • 4.

    Add 4 μL of the HBV core-derived DNA sample from Section 3.3 or HBV DNA standard (see Note 15) to each well, cover the reaction plate with Optical Adhesive Covers (Applied Biosystems, Cat. #4360954), then centrifuge the plate briefly to spin down the contents and eliminate air bubbles.

  • 5.

    Run the qPCR reaction. For the Applied Biosystems Real-Time PCR 7500 Fast system instrument, use the following parameters: 98°C for 3 min, 40 cycles at 95 °C for 15 sec, 60 °C for 30 sec.

  • 8.

    Calculate the amount of plus- and minus-polarity strands DNA as the percentage relative to the quantity of DNA in DMSO-treated cells to estimate inhibitory activity of compounds (Figure 3). EC50 values are calculated from the plus-polarity DNA data using GraphPad Prism using the four-parameter variable slope algorithm (see Note 16).

Figure 3. Inhibition of HBV replication by an RNaseH inhibitor.

Figure 3.

Open in a new tab

Inhibition of replication by compound 1144 was measured against an HBV genotype D isolate in HepDES19 cells. The EC50 value was calculated based on quantification of the plus-polarity DNA strand.

4. Notes

  1. DEPC treatment is a commonly used method for eliminating RNase contamination from water and other solutions. DEPC destroys enzymatic activity by modifying –NH, -SH, and –OH groups in RNases and other proteins. To prepare DEPC water, add 1 mL of DEPC to 1L of H2O. Shake well to disperse the DEPC through the H2O. Incubate at room temperature for at least 12 hours, then autoclave on liquid cycle for 20 min to inactivate the remaining DEPC.

  2. Prepare 10x RH buffer in relatively large batches and freeze small aliquots at −20 °C.

  3. Use the standard protocol provided by manufacturer of the kit used for in vitro transcription of DRF+; we typically use the Ambion Megascript kit. Purify in vitro transcribed RNA using RNeasy MinElute™ Cleanup Kit (Qiagen). Determine concentration of RNA fluorometrically using QuantiFluor® RNA System (Promega) and dilute to 0.1 μg/μL. Check quality by agarose electrophoresis. Store RNA at −75 °C in small aliquots.

  4. Any ~200–300 nucleotide RNA and complimentary ~20 nucleotide long DNA oligonucleotide will work. A negative control DNA oligonucleotide that is not complimentary to the RNA should be included in the assays to determine specificity of RNaseH reaction for heteroduplexes and exclude potential contribution of contaminating nucleases to the RNA cleavage reaction. It is best to design the complementary DNA oligonucleotide so that it does not bind directly to the middle of the RNA so that the P1 and P2 products can be distinguished from each other. The non-complementary negative control DNA oligonucleotide should be the same size as the complementary oligonucleotide.

  5. Unpolymerized acrylamide is a neurotoxin. Always wear personal protective equipment when handling acrylamide and avoid skin contact. Store at 4 °C protected from light. Urea can precipitate from the solution at 4 °C, so warm the solution to dissolve urea crystals before preparing the gel.

  6. Store frozen at −20°C in small aliquots.

  7. We express the HBV RNaseH in E. coli as a maltose-binding protein fusion with a hexahistidine tag at its C-terminus [21]. The HBV RNaseH is purified by nickel-affinity chromatography, dialyzed in buffer containing 50 mM HEPES, pH 7.3, 0.3 M NaCl, 20% glycerol, and 5mM DTT, and stored at −80 °C in small aliquots. The RNaseH preparation protocol and expression clones are undergoing continuous refinement, so contact John Tavis to obtain the latest protocol and expression constructs.

  8. We recommend including a control reaction without HBV RNaseH in each experiment to monitor the quality of RNA and any unspecific cleavage that might occur due to contamination.

  9. Quantitation of P1 band intensity is unreliable due to a 3’−5’ exonuclease activity of the HBV RNaseH [21].

  10. Cells are incubated for 3 days without changing the media. This can result in false negative results if the compound is unstable under those conditions. If this is suspected, refresh the compound-containing media daily.

  11. Cell lysis buffer contains 1% Tween 20 and will lyse the plasma membrane but not affect HBV core particles or completely disrupt the nucleus. Consequently, low speed centrifugation will separate the lysates from the nuclear fraction and unbroken cells.

  12. Ca++ is needed for micrococcal nuclease to be active [22]. The micrococcal nuclease from New England Biolabs comes with MN buffer containing the appropriate concentration of CaCl2.

  13. Micrococcal nuclease is a relatively non-specific endo- and exonuclease that digests double-stranded, single-stranded, circular and linear RNA and DNA substrates. The enzyme is active in the pH range of 7.0 – 10.0 as long as salt concentration is less than 100 mM [22]. Micrococcal nuclease treatment is necessary to remove non-encapsidated RNA and DNA from the lysate that might later interfere with qPCR. Encapsidated HBV DNAs are protected from micrococcal nuclease digestion by the viral capsid.

  14. HBV core particles are lysed to release the rcDNA with protease digestion. Qiagen Protease is a broad-specificity serine protease with high activity, cleaving preferentially at neutral and acidic residues. Qiagen protease is employed because it is easily heat inactivated, so the nucleic acids do not need to be fully purified prior to qPCR. We use a long protease digestion time to ensure removal of the HBV polymerase protein which is covalently attached to the HBV (−) polarity strand DNA. This prevents the DNA:HBV polymerase chimeric molecules from precipitating upon heat denaturation during qPCR and interfering with DNA quantification. Use liquid stocks of Qiagen Protease within one month of dissolving the protease as poor results can be obtained with longer storage.

  15. Double-stranded HBV DNA template for a standard curve is prepared by isolating total DNA from HepDES19 cells using QIAamp DNA Mini Kit (Qiagen, Cat. No 51304) and amplifying a 1388 base pair genomic region of HBV DNA with primers H2900+ (5’-CCGCTTGGGACTCTCTCGTCCC-3’) and HPE180STOP- (5’-TCACCATGGGAAGCTTACTCTTGTTCCCAAGAATATGG-3’).

  16. Preferential suppression of the HBV plus-polarity DNA strand indicates inhibition of viral DNA synthesis by either blocking the RNaseH activity or inhibiting DNA chain elongation. The minus-polarity data typically reflect cytotoxicity for RNaseH inhibitors.

Acknowledgements

Writing of this chapter was supported by grants R01 AI148362 and R01 AI150610 from the National Institutes of Health to John Tavis. We thank all current and past members of Tavis lab for their many contributions to the development and validation of the methods described here.

References

  • 1.Seeger C, Zoulim F, Mason WS (2021) Hepadnaviridae. In: Fields Virology, vol 2: DNA Viruses. Fields Virology. Wolters Kluwer, Philadelphia, pp 640–682 [Google Scholar]
  • 2.Summers J, Mason WS (1982) Replication of the Genome of a Hepatitis B-Like Virus by Reverse Transcription of an RNA Intermediate. Cell 29:403–415 [DOI] [PubMed] [Google Scholar]
  • 3.Revill PA, Chisari FV, Block JM, Dandri M, Gehring AJ, Guo H, Hu J, Kramvis A, Lampertico P, Janssen HLA, Levrero M, Li W, Liang TJ, Lim SG, Lu F, Penicaud MC, Tavis JE, Thimme R, Members of the ICE-HBV Working Groups, Chairs of the ICE-HBV Stakeholders Groups, Senior Advisors to ICE-HBV, Zoulim F (2019) A global scientific strategy to cure hepatitis B. Lancet Gastroenterol Hepatol 4:545–558. doi: 10.1016/S2468-1253(19)30119-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Trepo C, Chan HL, Lok A (2014) Hepatitis B virus infection. Lancet 384 (9959):2053–2063. doi: 10.1016/S0140-6736(14)60220-8 [DOI] [PubMed] [Google Scholar]
  • 5.Polaris Observatory C (2018) Global prevalence, treatment, and prevention of hepatitis B virus infection in 2016: a modelling study. Lancet Gastroenterol Hepatol 3 (6):383–403. doi: 10.1016/S2468-1253(18)30056-6 [DOI] [PubMed] [Google Scholar]
  • 6.Roca Suarez AA, Testoni B, Zoulim F (2021) HBV 2021: New therapeutic strategies against an old foe. Liver international : official journal of the International Association for the Study of the Liver 41 Suppl 1:15–23. doi: 10.1111/liv.14851 [DOI] [PubMed] [Google Scholar]
  • 7.Clark DN, Tajwar R, Hu J, Tavis JE (2021) The hepatitis B virus polymerase. In: Cameron CE, Arnold JJ (eds) The Enzymes Vol. L: Viral Replication Enzymes and Their Inhibitors Part B, vol 50. Academic Press, London, UK, pp 195–226 [DOI] [PubMed] [Google Scholar]
  • 8.Edwards TC, Ponzar NL, Tavis JE (2019) Shedding light on RNaseH: a promising target for hepatitis B virus (HBV). Expert Opin Ther Targets 23:559–563. doi: 10.1080/14728222.2019.1619697 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lomonosova E, Tavis JE (2017) In Vitro Enzymatic and Cell Culture-Based Assays for Measuring Activity of HBV RNaseH Inhibitors. Methods in molecular biology 1540:179–192. doi: 10.1007/978-1-4939-6700-1_14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Li Q, Edwards TC, Ponzar NL, Tavis JE (2021) A mid-throughput HBV replication inhibition assay capable of detecting ribonuclease H inhibitors. J Virol Methods:114127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cai CW, Lomonosova E, Moran EA, Cheng X, Patel KB, Bailly F, Cotelle P, Meyers MJ, Tavis JE (2014) Hepatitis B virus replication is blocked by a 2-hydroxyisoquinoline-1,3(2H,4H)-dione (HID) inhibitor of the viral ribonuclease H activity. Antiviral Res 108:48–55. doi: 10.1016/j.antiviral.2014.05.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Edwards TC, Mani N, Dorsey B, Kakarla R, Rijnbrand R, Sofia MJ, Tavis JE (2019) Inhibition of HBV replication by N-hydroxyisoquinolinedione and N-hydroxypyridinedione ribonuclease H inhibitors. Antiviral Res 164:70–80. doi: 10.1016/j.antiviral.2019.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hu Y, Cheng X, Cao F, Huang A, Tavis JE (2013) beta-Thujaplicinol inhibits hepatitis B virus replication by blocking the viral ribonuclease H activity. Antiviral Res 99 (3):221–229. doi: 10.1016/j.antiviral.2013.06.007 [DOI] [PubMed] [Google Scholar]
  • 14.Li Q, Lomonosova E, Donlin MJ, Cao F, O’Dea A, Milleson B, Berkowitz AJ, Baucom JC, Stasiak JP, Schiavone DV, Abdelmessih RG, Lyubimova A, Fraboni AJ, Bejcek LP, Villa JA, Gallicchio E, Murelli RP, Tavis JE (2020) Amide-containing alpha-hydroxytropolones as inhibitors of hepatitis B virus replication. Antiviral Res 177:104777. doi: 10.1016/j.antiviral.2020.104777 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lomonosova E, Daw J, Garimallaprabhakaran AK, Agyemang NB, Ashani Y, Murelli RP, Tavis JE (2017) Efficacy and cytotoxicity in cell culture of novel alpha-hydroxytropolone inhibitors of hepatitis B virus ribonuclease H. Antiviral Res 144:164–172. doi: 10.1016/j.antiviral.2017.06.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lu G, Lomonosova E, Cheng X, Moran EA, Meyers MJ, Le Grice SF, Thomas CJ, Jiang JK, Meck C, Hirsch DR, D’Erasmo MP, Suyabatmaz DM, Murelli RP, Tavis JE (2015) Hydroxylated Tropolones Inhibit Hepatitis B Virus Replication by Blocking the Viral Ribonuclease H Activity. Antimicrob Agents Chemother 59 (2):1070–1079. doi: 10.1128/AAC.04617-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tavis JE, Cheng X, Hu Y, Totten M, Cao F, Michailidis E, Aurora R, Meyers MJ, Jacobsen EJ, Parniak MA, Sarafianos SG (2013) The hepatitis B virus ribonuclease H is sensitive to inhibitors of the human immunodeficiency virus ribonuclease H and integrase enzymes. PLoS pathogens 9 (1):e1003125. doi: 10.1371/journal.ppat.1003125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gerelsaikhan T, Tavis JE, Bruss V (1996) Hepatitis B Virus Nucleocapsid Envelopment Does Not Occur without Genomic DNA Synthesis. JVirol 70:4269–4274 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Pierra Rouviere C, Dousson CB, Tavis JE (2020) HBV replication inhibitors. Antiviral Res 179:104815. doi: 10.1016/j.antiviral.2020.104815 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Guo H, Jiang D, Zhou T, Cuconati A, Block TM, Guo JT (2007) Characterization of the intracellular deproteinized relaxed circular DNA of hepatitis B virus: an intermediate of covalently closed circular DNA formation. J Virol 81 (22):12472–12484. doi: 10.1128/JVI.01123-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Villa JA, Pike DP, Patel KB, Lomonosova E, Lu G, Abdulqader R, Tavis JE (2016) Purification and enzymatic characterization of the hepatitis B virus ribonuclease H, a new target for antiviral inhibitors. Antiviral Res 132:186–195. doi: 10.1016/j.antiviral.2016.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Cuatrecasas P, Fuchs S, Anfinsen CB (1967) Catalytic properties and specificity of the extra-cellular nuclease of Staphylococcus aureus. Journal of Biological Chemistry 242:1541–1547 [PubMed] [Google Scholar]

RESOURCES