Abstract
Background
Biological aging is a complex process influenced by various factors, including reproductive status and castration. This study aimed to evaluate the impact of castration on biological aging in dogs.
Method
Fifteen male crossbred dogs were randomly divided into a sham-operation control group (n = 5) and a castrated group (n = 10). Blood samples were collected at weeks 0, 4, 8, 12, 16, and 18 post-surgery. Malondialdehyde (MDA as indicator of Lipid peroxidation), C-reactive protein (as an indicator of inflammation), telomere length, mitochondrial DNA (mtDNA) copy number, and the expression of age-related (P16, P21, TBX2) and telomerase-related (TERT) genes were assessed in blood samples.
Results
Plasma MDA levels were higher in the control group at weeks 16 and 18, while CRP levels were higher only at week 18. Telomere length and mtDNA copy number were lower in the control group at week 18. Gene expression analysis showed that P16 was lower in the control group at weeks 8 and 12, P21 and TERT were lower at weeks 16 and 18, and TBX2 was lower at weeks 16 and 18. The TBX2/P16 ratio was lower in the control group at weeks 16 and 18 but higher at week 12, while the TBX2/P21 ratio did not differ between groups.
Conclusion
Castration appears to have a protective effect against biological aging in dogs, as evidenced by lower lipid peroxidation, inflammation, and age-related changes in telomere length, mtDNA copy number, and gene expression.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12917-024-04337-9.
Keywords: Castration, Age-related genes, TERT, Dog, Telomere
Background
Biological aging (senescence) is a complex, multifactorial process involving numerous cellular, molecular, and systemic changes. It is the progressive decline in physiological function and the increased vulnerability to cellular apoptosis and diseases [1]. The biological aging varies among individuals and is influenced by genetic, environmental, and lifestyle factors. These factors may gradually increase oxidative stress and inflammation that in turn, may influence cell signaling such as SIRT1/AMPK pathway [2, 3], and induce cellular damage and gene dysregulation [4]. It has been determined that DNA damage, telomere attrition, mitochondrial dysfunction, and changing of age-related genes (e.g., P16, P21, and TBX2) may lead the cells to cellular senescence and aging [5, 6]. Previous research involving a variety of dog breeds has demonstrated a correlation between neutering and an extended lifespan [7]. This increased longevity may be attributed to reduced risks of certain cancers and reproductive diseases, as neutering eliminates risks associated with conditions like testicular cancer and pyometra in females [8]. However, Joonè and Konovalov (2023) indicated that neutering Rottweilers before 4.5 years of age may adversely impact their longevity [9].
Telomeres are protective caps at the ends of chromosomes that prevent DNA damage during cell division. Telomere shortening is one of the most widely recognized markers of cellular aging and is associated with increased risks of age-related diseases [10, 11]. Telomerase is an enzyme that extends telomeres. Activating telomerase in certain cells could potentially delay cellular senescence and aging. The TERT gene, related to telomerase reverse transcriptase, is the primary gene that encodes telomerase [12]. This gene encodes the protein component of telomerase, which is responsible for adding nucleotide sequences to the ends of telomeres, thereby maintaining their length. Another component of the telomerase enzyme is encoded by the TERC gene, which contributes to the telomerase RNA component. The RNA produced by the TERC gene acts as a template for the addition of telomere repeats by the TERT protein [12].
The p16 and p21 are key factors in cellular senescence and hallmarks of biological aging, with p21 thought to be necessary for initiating the senescence-like growth arrest while p16 is required for maintenance of this state [13]. They are cyclin-dependent kinase inhibitors (CDKI) that specifically inhibit CDK4 and CDK6. These kinases, when bound to cyclin D, phosphorylate the retinoblastoma protein (pRB), allowing cells to progress from the G1 phase to the S phase of the cell cycle. DNA damage, oxidative stress, or telomere shortening cause P16 and P21 levels to increase [14].
TBX2 is a member of the T-box family of transcription factors, which are critical regulators of developmental processes and cellular function. The TBX2 plays an essential role in embryonic development, cell cycle regulation, and cellular senescence. It exerts its effects by repressing the expression of cell cycle inhibitors, such as P21 and P16. TBX2 was shown to prevent senescence by a mechanism involving their ability to transcriptionally repress these cell cycle inhibitors [15, 16].
Mitochondria are important cellular organelles whose function determines the levels of biological aging. Beyond energy production, mitochondria are involved in various cellular processes, including regulating apoptosis, calcium homeostasis, and the generation of reactive oxygen species (ROS). ROS is a byproduct of normal metabolic processes in mitochondria [17]. While ROS plays a role in cell signaling and homeostasis, excessive ROS can damage cellular components. When the efficiency of mitochondria in electron transport declines, leading to increased leakage of electrons and higher ROS production [18]. This oxidative stress could be a significant factor in cellular aging and age-related diseases [19].
The present study aimed to evaluate biological aging levels due to castration in dogs through assessment of lipid peroxidation, inflammation (via C-reactive protein), telomere length, mitochondrial DNA copy number, and expression of age-related (p16, p21, TBX2) and telomerase-related (TERT) genes.
Results
MDA as lipid peroxidation and CRP as inflammation indicators
Figure 1 shows the levels of plasma MDA and CRP in the control and castrated groups at different times after surgery.
Fig. 1.
Comparison of malondialdehyde (MDA) and C-reactive protein (CRP) levels between and within control and castrated groups of dogs at different times. Values are means ± SE; *Significant difference between two groups (P < 0.05); a, b,c Significant difference between different times within the control group (P < 0.05); A, B Significant difference between different times within the castrated group (P < 0.05)
The MDA level was significantly higher in the control group than in the castrated group at weeks 16 and 18 (P < 0.05) while there were no significant differences between the two experimental groups at weeks 0, 4, 8, and 12 (P > 0.05). Within the control group, the MDA levels increased at weeks 8 and 12 compared to weeks 0, 4, 16, and 18 (P < 0.05). The MDA also increased at weeks 16 and 18 compared to weeks 0 and 4 (P < 0.05). Within the castrated group, the MDA levels only increased at weeks 8 and 12 compared to weeks 0, 4, 16, and 18 (P < 0.05), while this parameter did not change at weeks 0, 4, 16, and 18 (P > 0.05).
The CRP level was only higher in the control group than in the castrated group at week 18 (P < 0.05) while there were no significant differences between the two experimental groups at other weeks (P > 0.05). Within the control and castrated groups, the CRP levels did not change at any week (P > 0.05).
Telomere length and mtDNA copy number
Figure 2 represents changes in the telomere length and mtDNA copy number between and within the control and castrated groups during 18 weeks. The telomere length was lower in the control group than in the castrated group only at week 18 (P < 0.05), while there were no significant differences between the two experimental groups at previous weeks (P > 0.05). Within the control and castrated groups, the telomere length did not change at any week (P > 0.05).
Fig. 2.
Comparison of relative telomere length and mitochondrial DNA copy number between and within control and castrated groups of dogs at different times. Values are means ± SE; *Significant difference between two groups (P < 0.05); a, b Significant difference between different times within the control group (P < 0.05); A, B Significant difference between different times within the castrated group (P < 0.05)
The mtDNA copy number was lower in the control group than in the castrated group only at week 18 (P < 0.05), while there were no significant differences between these groups at previous weeks (P > 0.05). Within the control group, the mtDNA copy number did not change at any week (P > 0.05). Within the castrated group, the mtDNA copy number only increased at week 18 compared to previous weeks (P < 0.05), while this parameter did not change at weeks 0, 4, 12, and 16 (P > 0.05).
Relative expression of P16, P21, TBX2, TERT genes, and TBX/P16, TBX/P21 ratios
Figure 3 indicates the relative expression of P16, P21, TBX2, and TERT genes and their ratios (TBX2/P16 and TBX2/P21) in the control and castrated groups.
Fig. 3.
Comparison of transcriptional levels of P16, P21, TBX2, and TERT genes and their ratios between and within control and castrated groups of dogs at different times. Values are means ± SE; *Significant difference between two groups (P < 0.05); a, b,c Significant difference between different times within the control group (P < 0.05); A, B,C Significant difference between different times within the castrated group (P < 0.05)
The relative expression of the P16 gene was lower in the control group than in the castrated group at weeks 8 and 12 (P < 0.05), while there were no significant differences between the two groups at weeks 0, 4, 16, and 18 (P > 0.05). Within the control group, the P16 transcript decreased at weeks 16 and 18 compared to weeks 0, 4, 8, and 12 (P < 0.05). Within the castrated group, the P16 transcript only increased at week 12 compared to weeks 0, 4, 8, 16, and 18 (P < 0.05), while this parameter did not change at weeks 0, 4, 8, 16, and 18 (P > 0.05).
The relative expression of the P21 gene was lower in the control group than in the castrated group at weeks 16 and 18 (P < 0.05), while there were no significant differences between the two groups at weeks 0, 4, 8, and 12 (P > 0.05). Within the control group, the P21 transcript did not change at the mentioned times (P < 0.05). Within the castrated group, the P21 transcript increased at weeks 16 and 18 compared to weeks 0, 4, 8, and 12 (P < 0.05), while this parameter did not change at weeks 0, 4, 8, and 12 (P > 0.05).
The relative expression of the TBX2 gene was lower in the control group than in the castrated group at weeks 16 and 18 (P < 0.05), while there were no significant differences between the two groups at weeks 0, 4, 8, and 12 (P > 0.05). Within the control group, the TBX2 transcript only increased at week 6 compared to other weeks (P < 0.05), while this parameter did not change at weeks 0, 4, 8, 16, and 18 (P > 0.05). Within the castrated group, the TBX2 transcript increased at weeks 16 and 18 compared to weeks 0, 4, 8, and 12 (P < 0.05). Also, this transcript significantly increased at weeks 8 and 12 compared to weeks 0 and 4.
The relative expression of the TERT gene was lower in the control group than in the castrated group at weeks 16 and 18 (P < 0.05), while there were no significant differences between the two groups at weeks 0, 4, 8, and 12 (P > 0.05). Within the control group, the TERT transcript did not change at any week (P > 0.05). Within the castrated group, the TERT transcript increased at weeks 16 and 18 compared to weeks 0, 4, 8, and 12. Also, this transcript significantly increased at week 18 compared to previous weeks (P < 0.05).
The TBX2/P16 ratio was lower in the control group than in the castrated group at weeks 16 and 18, while it was higher at week 12 (P < 0.05). There were no significant differences between the two groups at weeks 0, 4, and 8 (P > 0.05). Within the control group, the TBX2/P16 ratio increased at weeks 8 and 16 compared to weeks 0 and 4 (P < 0.05). This ratio also increased at week 8 compared to previous weeks (P < 0.05). Within the castrated group, the TBX2/P16 ratio increased at weeks 16 and 18 compared to weeks 0, 4, 8, and 12 (P < 0.05). There were no significant differences between weeks 0, 4, 8, and 12 within the castrated group (P > 0.05).
The TBX2/P21 ratio did not change between the control and castrated groups at any week (P > 0.05). Within the control group, the TBX2/P21 ratio decreased at weeks 8 and 12 compared to weeks 0 and 4 (P < 0.05). This ratio did not change between other weeks. Within the castrated group, the TBX2/P21 ratio decreased at weeks 4, 8, 12, 16, and 18 compared to week 0 (P < 0.05). This ratio did not change between weeks 4, 8, 12, 16, and 18.
Discussion
The study evaluated the impact of castration on biological aging in dogs by analyzing various biomarkers related to cellular senescence during 18 weeks. These biomarkers included lipid peroxidation, CRP, telomere length, mtDNA copy number, and the expression levels of age-related genes (P16, P21, TBX2) and telomerase-related genes (TERT). The present findings provided insights into the molecular and cellular mechanisms that may contribute to the aging process following castrated dogs.
Castration (through the removal of testicles) leads to significant hormonal changes that can affect various physiological and psychological aspects of health. Testosterone and dihydrotestosterone are the primary male sex hormones, produced mainly by the testicles that immediately decline following castration. they play a crucial role in sexual development, muscle mass maintenance, and mood regulation [20]. On the other hand, castration increases serum FSH and LH levels due to the lack of testicle feedback inhibition. These hormonal changes cause many effects such as reactive pituitary hyperplasia and shrinkage of the prostate [21].
MDA is a marker of lipid peroxidation and oxidative stress. The study found that MDA levels were significantly lower in castrated dogs at weeks 16 and 18, returning to baseline levels observed at week 0. This suggests a reduction in oxidative damage following castration. Oxidative stress is a significant factor in cellular aging [22], and its reduction post-castration could explain the observed improvements in other age-related factors. Many studies have investigated the correlations between castration/testosterone and oxidative stress parameters in rats and humans, consistently reporting that testosterone depletion leads to increased oxidative stress [23–26]. Abou-Khalil et al. found no significant differences in serum oxidant and antioxidant levels in donkeys after castration compared to pre-castration levels during 60 days [27]. On the other hand, Aengwanich, et al. [28] determined that castration in dogs causes an increase in antioxidant capacity after 15 days, suggesting that castration does not elevate oxidative stress in this species at least for a short time. These conflicting results may stem from variations in physiological responses to castration between species, as well as differences in the timing of oxidative stress assessments. However, our data indicated that while MDA levels initially increased, they returned to baseline levels observed on day zero after 16 weeks.
CRP is an inflammation marker that is linked to biological aging [29]. The lower CRP levels in castrated dogs at week 18 suggest reduced systemic inflammation. Of course, this parameter did not change within groups. While the majority of studies show an inverse relationship between CRP and testosterone [30, 31], some conflicting findings have also been reported. Nazifi, et al. [32] Grewal et al. [33] and Tvarijonaviciute, et al. [34] reported in castrated dogs that CRP levels do not change in the long term. However, they did not continue to evaluate CRP levels until 18 weeks.
Birch and Gil reviewed that cellular senescence leads to significant phenotypic changes, resulting in the production of a bioactive secretome known as the senescence-associated secretory phenotype (SASP). The SASP comprises a complex mixture of pro-inflammatory cytokines, chemokines, growth factors, and proteases secreted by senescent cells. This phenotype plays a crucial role in aging and age-related diseases by promoting chronic inflammation [35]. In our study, hormonal changes following castration may influence SASP factors, potentially contributing to the observed reduction in systemic inflammation indicated by lower CRP levels.
The study indicated that telomere length was significantly longer in castrated dogs at week 18 (but not within groups). Telomeres, which protect chromosome ends from deterioration, shorten with each cell division, and their length is a reliable marker of cellular aging [36]. The finding suggests that castration might slow telomere attrition, potentially delaying cellular senescence. The mechanism behind this could involve reduced metabolic rate or decreased oxidative stress post-castration, both of which are known to impact telomere dynamics [37]. Kawauchi et al. reported that neutering in dogs results in a decrease in metabolism, which may contribute to the maintenance of telomere length, as suggested by Nonsa-Ard et al. [38]. However, a meta-analysis review determined no effect of testosterone or sexual ornamentation on telomere dynamics in human [39].
The increased expression of the TERT gene in castrated dogs at weeks 16 and 18 may be evidence of telomerase level. TERT encodes the catalytic subunit of telomerase, an enzyme that adds nucleotide sequences to telomeres, thereby maintaining their length [40]. Enhanced TERT expression could contribute to telomere elongation and cellular longevity in castrated dogs. In this regard, Ravindranath et al. (2001) also revealed that telomerase is activated in the prostate of castrated monkeys [41].
The mtDNA copy number was higher in castrated dogs only at week 18. Liu, et al. [42] reported that castration resulted in large differences of mtDNA copy numbers in various tissues of pigs. The mtDNA copy numbers increased in adrenal glands and adipose tissues in castrated pigs, especially in intermuscular adipose, and greater omentum, whereas that of mesenteric adipose, retroperitoneal adipose, skeletal muscle, heart, seminal vesicle, prostate, and mammary glands showed the opposite trend indistinctively. These findings suggest that castration can significantly impact mitochondrial biogenesis and function in a tissue-specific manner [42]. The observed changes in mtDNA copy number may reflect the altered metabolic and hormonal states associated with castration, which can differentially affect energy production requirements and mitochondrial activity in various tissues.
Both P16 and P21 play crucial roles in regulating the cell cycle and inducing cellular senescence in response to DNA damage and oxidative stress [13]. The study found higher expression levels of these genes in castrated dogs at various time points, suggesting an initial upregulation of senescence pathways. TBX2, a transcription factor, can repress the expression of P16 and P21, thus preventing cell senescence [43]. The increased TBX2 expression and especially the TBX2/P16 ratio in castrated dogs at later stages suggests a feedback mechanism to counteract the senescence-inducing signals from P16 and P21. This balance might help maintain cellular function, contributing to the observed positive effects on telomere length and mitochondrial activity.
This study had limitations regarding the duration of dog maintenance and research approval by the ethical committee. The research should have ended immediately after the first measured parameters changed statistically.
Conclusion
The study provides compelling evidence that dog castration might influence biological aging by modulating key molecular and cellular pathways. The observed longer telomeres, higher mtDNA copy numbers, altered expression of senescence-related genes, and reduced oxidative stress and inflammation collectively suggest that castration could delay the onset of cellular senescence. However, these findings’ exact mechanisms and long-term implications warrant further investigation. This study clarifies the relationship between castration and aging, which may help inform veterinary practices and provide insights into the biology of aging related to canine castration.
Methods
Animals, castration, and blood sampling
A total of 15 male crossbred dogs (2–4 years old; 16 ± 5 kg body weight) with normal quality were included in this study. The dogs were obtained from the dog-keeping farm of the Shahrekord city municipality and were returned to their original location upon completion of the research. Dogs were cared for Faculty of Veterinary Medicine (Shahrekord University) and housed in pens with ample runs. All dogs were evaluated according to their history and absence of any previous illness. General clinical examinations were conducted and documented, including a physical examination and a thorough evaluation of the genitalia, which involved palpation of the testes, epididymides, and prostate. All animals were administered conventional vaccination and deworming protocols. No dog presented a history of medication, neutralization, or diarrhea in the past four months. Blood samples of the experimental groups were taken from a cephalic vein for hematological analysis. They were fed well twice a day and were given access to water ad libitum.
Dogs were randomly divided into two groups including sham-operation (as control, 5 dogs) and treatment (as castrated, 10 dogs) groups. All dogs were anaesthetized by use of standard clinical protocols. Food was withheld from dogs overnight (approximately eight hours), but water was not withheld. Dogs were premedicated with 0·5 mg/kg xylazine intramuscularly (im), and 0·2 mg/kg meloxicam (Metacam Boehringer) intravascularly (iv). Anesthesia was induced with 10 mg/kg ketamine iv and 0.3 mg/kg diazepam. Dogs were intubated, and anesthesia was maintained with isoflurane in oxygen. Anesthesia was monitored by clinical assessment, pulse oximetry, and non-invasive blood pressure.
In treatment dogs (as the castrated group), open orchidectomy was performed via a prescrotal approach according to Hamilton, et al. [44]. Briefly, the skin and subcutaneous tissue with the median raphe over the testicle were incised. The incision was continued through the spermatic fascia to exteriorise the testicle. The parietal vaginal tunic was also incised without incising the tunica albuginea. The ligament of the tail of the epididymis was separated from the tunic. The three-clamp technique was implemented. The vascular cord and ductus deferens were individually ligated, and an additional encircling ligature was placed around both structures. A haemostat was placed across the cord near the testicle before the transection of the ductus deferens and vascular cord between the ligatures and haemostat. An encircling ligature was placed around the cremaster muscle and tunic. The second testicle was advanced into the incision site and removed as described for the first. The dense fascia was apposed on either side of the penis with a simple continuous pattern as was used for the vascular cord and ductus. The skin was apposed with an intradermal suture pattern. In the control group, the skin and subcutaneous tissue with the median raphe over the testicle were incised. The incision was only done on the skin, spermatic fascia, and parietal vaginal tunic and then was stitched similar to the treatment group.
Blood samples (5 ml) were prepared from all dogs immediately before and after surgery (as in week 0) and in weeks 4, 8, 12, 16, and 18 post-surgery. Following the separation of plasma from part of the blood samples, the plasma and whole blood are stored at -70 ˚ C until the next experiments.
Plasma malondialdehyde and C-reactive protein assessments
The malondialdehyde (MDA), an indicator of lipid peroxidation, was measured according to Hassanpour, et al. [45]. Briefly, trichloroacetic acid was added to plasma samples. After centrifuging, the supernatants were recovered. Then an equal volume of the thiobarbituric acid (TBA) was added and the samples were incubated in the boiling water bath for 10 min. After cooling of samples, absorbance was measured at 532 nm by a spectrophotometer (Corning 480, USA).
The C-reactive protein (CRP) was measured using the immunoturbidimetric method. A commercially available kit (Biorex Fars Co., Shiraz, Iran) and an autoanalyzer (BT1500) were used to perform it.
DNA extraction, RNA extraction, and cDNA synthesis
DNA was extracted from whole blood samples using a High yield DNA Purification Kit (DNP™ Kit, SinaClon BioScience, Karaj, Iran) according to the manufacturer’s instructions. The yielded pellet of DNA was resuspended in 50 µl of solvent buffer and stored at − 70 °C.
The total RNA of whole blood samples was extracted using RNX-Plus solution (Sinaclon Bioscience, Karaj, Iran) and the acid guanidinium thiocyanate-phenol-chloroform single-step method according to Hassanpour, et al. [10]. The yielding RNA pellet was resuspended in 20 µl DEPC-treated water and then treated with RNAase free DNAase (SinaClon) to clean contaminating genomic DNA. The quality and integrity of RNA samples were evaluated by spectrophotometry. Only RNA samples representing an A260/A280 ratio of 1.8–2.2 were suitable for cDNA synthesis.
The synthesis of cDNA was done using the Easy cDNA Synthesis Kit (Parstous Co., Mashhad, Iran) according to the manufacturer’s instructions. The yielding cDNA was stored at -20 °C.
Telomere size analysis by quantitative real-time PCR
To measure the relative telomere length of blood cells, relative quantitative real-time PCR (RT-qPCR) was performed using a 2× SYBR Green Real-Time PCR kit (Ampliqon Co., Denmark). The telomere and β-actin (as a reference gene) primers were synthesised according to Hassanpour, et al. [10] (Table 1). The amplification was done in a final volume of 10 µl for both telomere and β-actin. A sample of 15 ng DNA was added in each reaction. The final concentration of forward and reverse primers of telomere was 250 and 750 nM, respectively. The final concentration of each primer of β-actin was 250 nM. Amplifications were performed in triplicate for each heart sample in a Rotor-Gene 6000 thermocycler (Qiagen, Australia). The PCR programme for telomere was 95 °C for 15 min and 20 cycles of 95 °C for 15 s and 54 °C for 2 min. The PCR programme for β-actin was 95 °C for 15 min and 45 cycles of 95 °C for 5 s and 60 °C for 20 s. A no-template control reaction was run to ensure no contamination. The melt curves of telomere and β-actin following amplification showed a single peak (Figure S1), evidence of specific amplification (Figure S1). The relative telomere length was calculated according to Nasiri, et al. [46].
Table 1.
Canine primers used for quantitative real-time PCR
| Target | Primers (5′-3′) | Tm (oC) | GC (%) | Ta (oC) |
PCR Product (bp) | Accession No. |
|---|---|---|---|---|---|---|
| Telomere |
GGTTTTTGAGGGTGAGGGTGA GGGTGAGGGTGAGGGT |
67.6 | 48.7 | 54 | 78 | - |
|
TCCCGACTATCCCTATCCCTATC CCTATCCCTATCCCTA |
69.7 | 53.8 | 60 | |||
| β-actin | GGAGCGAGCATCCCCAAAGTTC | 60.2 | 60.0 | NM_001195845.3 | ||
| GCCCTTCTCTGCAGGGAGAAAC | 60.1 | 60.2 | ||||
| TERT | ACCAGCCAGTGAGGAAGAAC | 59.6 | 55.0 | 60 | 80 | NM_001031630.2 |
| TTTGAGAAGGGAGTAGCAGCA | 59.0 | 47.6 | ||||
| CYPTB | CACTAATCTTCTCTCTGCCATCC | 58.4 | 47.8 | 60 | 86 | - |
| GGGTTGCTTTGTCCACTGAG | 59.1 | 55.0 | ||||
| P16 | TATTTGCGTGTTGGCGGAGA | 60.3 | 50.0 | 60 | 117 | XM_038552533.1 |
| AATGGATGACGAGGGCGAAG | 60.2 | 55.0 | ||||
| P21 | GCCCTACCCTTCCCCCATTT | 61.6 | 60 | 60 | 95 | XM_532125.7 |
| GCCCTATCCACAGCGTCTAC | 59.9 | 60 | ||||
| TBX2 | CTTCCCTTTCCACCTCTCCCA | 61.1 | 57.1 | 60 | 81 | AH012457.2 |
| TATGCCCACCTTGCTTTCTCC | 60.3 | 52.4 |
Mitochondrial DNA (mtDNA) copy number analysis by quantitative real-time PCR
The relative mtDNA copy number of blood cells was determined by evaluating the ratio of mtDNA to nuclear DNA using fluorescence-based RT-qPCR. The mitochondrial gene CPYTB, encoding cytochrome b, and the nuclear gene, encoding β-actin, were used for relative quantification [47]. The relative RT-qPCR was performed as mentioned above. The sequence and characteristics of primers are represented in Table 1. The PCR programme for CYPTB and β-actin was 95 °C for 15 min and 45 cycles of 95 °C for 5 s and 60 °C for 20 s. Melting curves of CYPTB and β-actin genes amplicons after the PCR reactions showed one peak (Figure S1).
Assessment of P16, P21, and TBX2 gene expression by RT-qPCR
To determine the possible changes in the transcriptional levels of age-related genes (P16, P21, and TBX2) in the blood cells of all dogs, relative RT-qPCR was performed using PCR kit as mentioned above. To normalize the input load of cDNA and to quantify the relative target gene expression, β-actin was used as a stable control gene. The used specific primers of genes are represented in Table 1. The PCR for each sample was performed in three replicates. 10 ng cDNA and 400 nM of each specific primer were used in a total volume of 10 µl. The program of PCR amplification was 94 °C for 10 min, then 40–45 cycles of 94 °C for 5 s and 60 °C for 20 s. Melting curves of P16, P21, and TBX2 gene amplicons after the PCR reactions showed one peak (Figure S1). Data of the threshold cycle numbers and mean efficiency values were recorded and calculated using LinRegPCR software. The relative gene expression (target / β-actin) was calculated through the Pfaffl method and according to Hassanpour et al., [48].
Statistical analysis
Data are given as mean ± standard error (SE). The normality of all data was determined using Kolmogorov–Smirnov test. The normally distributed data were compared through parametric tests. Differences between the mean values of two control and castrated groups in each time were compared using the independent Student’s t-test. Also, the comparisons of mean values between different times within each group were made by One-way repeated-measures ANOVA. Blood sample data collected before and after surgery on the same day did not show statistically significant differences; therefore, the pre-operative data have been excluded. All analyses were performed using SPSS 26.0 software (IBM-SPSS, Inc, Chicago, IL, USA). Differences were considered significant at P < 0.05.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
The authors would like to acknowledge the invaluable contributions of the technicians at the veterinary clinic of Shahrekord University.
Author contributions
H.H. was the supervisor, designed the study, and analyzed data. M.J. performed the surgery. Z.C-K, E.R and R.J. conducted the experiments, collected the samples, and assembled data. H.H. and M.M. contributed to writing, reviewing, and editing the final manuscript. All authors read and approved the final manuscript.
Funding
This research was supported by the funds granted for a student thesis via Vice Chancellor for Research of Shahrekord University.
Data availability
Data is provided within the manuscript or supplementary information files.
Declarations
Ethics approval and consent to participate
The project underwent ethical review and was approved by the local Ethics Committee of Shahrekord University (IR.SKU. REC.1402.062). The owner of dog-keeping farm (related to Shahrekord city municipality) signed the informed written consent The care and use of experimental animals complied with local animal welfare laws, guidelines and policies. The study was also carried out in compliance with the ARRIVE guidelines [49].
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Dodig S, Čepelak I, Pavić I. Hallmarks of senescence and aging. Biochemia Med. 2019;29(3):483–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Mosaoa RM, Al-Rabia MW, Asfour HZ, Alhakamy NA, Mansouri RA, El-Agamy DS, Abdulaal WH, Mohamed GA, Ibrahim SR, Elshal M. Targeting SIRT1/AMPK/Nrf2/NF-кB by sitagliptin protects against oxidative stress-mediated ER stress and inflammation during ANIT-induced cholestatic liver injury. Toxicology. 2024;507:153889. [DOI] [PubMed] [Google Scholar]
- 3.Yi W, Chen F, Yuan M, Wang C, Wang S, Wen J, Zou Q, Pu Y, Cai Z. High-fat diet induces cognitive impairment through repression of sirt1/AMPK-mediated autophagy. Exp Neurol. 2024;371:114591. [DOI] [PubMed] [Google Scholar]
- 4.McHugh D, Gil J. Senescence and aging: causes, consequences, and therapeutic avenues. J Cell Biol. 2018;217(1):65–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Carnero A. Markers of cellular senescence. Cell Senescence: Methods Protocols 2013;965:63–81. [DOI] [PubMed]
- 6.Nasiri L, Vaez-Mahdavi M-R, Hassanpour H, Ghazanfari T, Kaboudanian Ardestani S, Askari N, Ghaffarpour S, Zamani MS. Transcription of biological aging markers (ANRIL, P16INK4a, TBX2, and TERRA) and their correlations with severity of sulfur mustard exposure in veterans. Drug Chem Toxicol 2024;1–9. [DOI] [PubMed]
- 7.Urfer SR, Kaeberlein M. Desexing dogs: a review of the current literature. Animals. 2019;9(12):1086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.McKenzie B. Evaluating the benefits and risks of neutering dogs and cats. CABI Reviews. 2010;2010:1–18. [Google Scholar]
- 9.Joonè CJ, Konovalov DA. The effect of neuter status on longevity in the Rottweiler dog. Sci Rep. 2023;13(1):17845. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hassanpour H, Mirshokraei P, Salehpour M, Amiri K, Ghareghani P, Nasiri L. Canine sperm motility is associated with telomere shortening and changes in expression of shelterin genes. BMC Vet Res. 2023;19(1):236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Herrmann M, Pusceddu I, März W, Herrmann W. Telomere biology and age-related diseases. Clin Chem Lab Med (CCLM). 2018;56(8):1210–22. [DOI] [PubMed] [Google Scholar]
- 12.Ghanim GE, Fountain AJ, Van Roon A-MM, Rangan R, Das R, Collins K, Nguyen THD. Structure of human telomerase holoenzyme with bound telomeric DNA. Nature. 2021;593(7859):449–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kumari R, Jat P. Mechanisms of cellular senescence: cell cycle arrest and senescence associated secretory phenotype. Front cell Dev Biology. 2021;9:645593. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Amani J, Gorjizadeh N, Younesi S, Najafi M, Ashrafi AM, Irian S, Gorjizadeh N, Azizian K. Cyclin-dependent kinase inhibitors (CDKIs) and the DNA damage response: the link between signaling pathways and cancer. DNA Repair. 2021;102:103103. [DOI] [PubMed] [Google Scholar]
- 15.Li S, Luo X, Sun M, Wang Y, Zhang Z, Jiang J, Hu D, Zhang J, Wu Z, Wang Y. Context-dependent T-BOX transcription factor family: from biology to targeted therapy. Cell Communication Signal. 2024;22(1):350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Khan SF, Damerell V, Omar R, Du Toit M, Khan M, Maranyane HM, Mlaza M, Bleloch J, Bellis C, Sahm BD. The roles and regulation of TBX3 in development and disease. Gene. 2020;726:144223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Hernansanz-Agustín P, Enríquez JA. Generation of reactive oxygen species by mitochondria. Antioxidants. 2021;10(3):415. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Brillo V, Chieregato L, Leanza L, Muccioli S, Costa R. Mitochondrial dynamics, ROS, and cell signaling: a blended overview. Life. 2021;11(4):332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Rudzińska M, Parodi A, Balakireva AV, Chepikova OE, Venanzi FM, Zamyatnin AA Jr. Cellular aging characteristics and their association with age-related disorders. Antioxidants. 2020;9(2):94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Obukohwo OM, Benneth B-A, Simon OI, Oghenetega OB, Victor E, Faith FY, Okwute PG, Rume RA, Godswill OO, Kingsley NE. Testosterone: The Male Sex Hormone. In: Testosterone-Functions, Uses, Deficiencies, and Substitution. edn.: IntechOpen; 2023.
- 21.Wistuba J, Neuhaus N, Nieschlag E. Physiology of testicular function. In: Andrology: male Reproductive Health and Dysfunction. edn.: Springer; 2023:15–54.
- 22.Hajam YA, Rani R, Ganie SY, Sheikh TA, Javaid D, Qadri SS, Pramodh S, Alsulimani A, Alkhanani MF, Harakeh S. Oxidative stress in human pathology and aging: molecular mechanisms and perspectives. Cells. 2022;11(3):552. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Muthu SJ, Seppan P. Apoptosis in hippocampal tissue induced by oxidative stress in testosterone deprived male rats. Aging Male. 2020;23(5):1598–610. [DOI] [PubMed] [Google Scholar]
- 24.Kataoka T, Hotta Y, Maeda Y, Kimura K. Testosterone deficiency causes endothelial dysfunction via elevation of asymmetric dimethylarginine and oxidative stress in castrated rats. J Sex Med. 2017;14(12):1540–8. [DOI] [PubMed] [Google Scholar]
- 25.Babcock MC, DuBose LE, Witten TL, Stauffer BL, Hildreth KL, Schwartz RS, Kohrt WM, Moreau KL. Oxidative stress and inflammation are associated with age-related endothelial dysfunction in men with low testosterone. J Clin Endocrinol Metabolism. 2022;107(2):e500–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Marin DP, Bolin AP, de Santos C, Curi R, Otton R. R: Testosterone suppresses oxidative stress in human neutrophils. Cell biochemistry and function 2010;28(5):394–402. [DOI] [PubMed]
- 27.Abou-Khalil NS, Ali MF, Ali MM, Ibrahim A. Surgical castration versus chemical castration in donkeys: response of stress, lipid profile and redox potential biomarkers. BMC Vet Res. 2020;16:1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Aengwanich W, Sakundech K, Chompoosan C, Tuchpramuk P, Boonsorn T. Physiological changes, pain stress, oxidative stress, and total antioxidant capacity before, during, and after castration in male dogs. J Veterinary Behav. 2019;32:76–9. [Google Scholar]
- 29.Tang Y, Fung E, Xu A, Lan HY. C-reactive protein and ageing. Clin Exp Pharmacol Physiol. 2017;44:9–14. [DOI] [PubMed] [Google Scholar]
- 30.Mohamad N-V, Wong SK, Hasan WNW, Jolly JJ, Nur-Farhana MF, Ima-Nirwana S, Chin K-Y. The relationship between circulating testosterone and inflammatory cytokines in men. The Aging Male; 2019. [DOI] [PubMed]
- 31.Grandys M, Majerczak J, Zapart-Bukowska J, Duda K, Kulpa JK, Zoladz JA. Lowered serum testosterone concentration is associated with enhanced inflammation and worsened lipid profile in men. Front Endocrinol. 2021;12:735638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Nazifi S, Mogheiseh A, Shojaei Tabrizi A, Hajikaram Rayat M. Effect of oral melatonin administration on inflammatory cytokines and acute phase proteins after the castration of dogs. Comp Clin Pathol. 2020;29:829–36. [Google Scholar]
- 33.Grewal MR, Gurayah AA, Weber A, Ramasamy R. The relationship between c-reactive protein and total testosterone in aging men: findings from the baltimore longitudinal study of aging. Fertil Steril. 2023;120(4):e34. [Google Scholar]
- 34.Tvarijonaviciute A, Martinez-Subiela S, Carrillo‐Sanchez J, Tecles F, Ceron J. Effects of orchidectomy in selective biochemical analytes in beagle dogs. Reprod Domest Anim. 2011;46(6):957–63. [DOI] [PubMed] [Google Scholar]
- 35.Birch J, Gil J. Senescence and the SASP: many therapeutic avenues. Genes Dev. 2020;34(23–24):1565–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Daios S, Anogeianaki A, Kaiafa G, Kontana A, Veneti S, Gogou C, Karlafti E, Pilalas D, Kanellos I, Savopoulos C. Telomere length as a marker of biological aging: a critical review of recent literature. Curr Med Chem. 2022;29(34):5478–95. [DOI] [PubMed] [Google Scholar]
- 37.Metcalfe NB, Olsson M. How telomere dynamics are influenced by the balance between mitochondrial efficiency, reactive oxygen species production and DNA damage. Mol Ecol. 2022;31(23):6040–52. [DOI] [PubMed] [Google Scholar]
- 38.Nonsa-Ard R, Aneknan P, Tong-Un T, Honsawek S, Leelayuwat C, Leelayuwat N. Telomere length is correlated with resting metabolic rate and aerobic capacity in women: a cross-sectional study. Int J Mol Sci. 2022;23(21):13336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Taylor GT, McQueen A, Eastwood JR, Dupoué A, Wong BB, Verhulst S, Peters A. No effect of testosterone or sexual ornamentation on telomere dynamics: a case study and meta-analyses. Ecol Evol. 2024;14(3):e11088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Udroiu I, Marinaccio J, Sgura A. Many functions of telomerase components: certainties, doubts, and inconsistencies. Int J Mol Sci. 2022;23(23):15189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Ravindranath N, Ioffe SL, Marshall GR, Ramaswamy S, Plant TM, Dym M. Androgen depletion activates telomerase in the prostate of the nonhuman primate, Macaca mulatta. Prostate. 2001;49(1):79–89. [DOI] [PubMed] [Google Scholar]
- 42.Liu C, Ma J, Zhang J, Zhao H, Zhu Y, Qi J, Liu L, Zhu L, Jiang Y, Tang G. Testosterone deficiency caused by castration modulates mitochondrial biogenesis through the AR/PGC1α/TFAM pathway. Front Genet. 2019;10:505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Sapega O. Genotoxic stress and senescence in tumour cells: impact on the tumour growth and anti-tumour immunity. 2021.
- 44.Hamilton K, Henderson E, Toscano M, Chanoit G. Comparison of postoperative complications in healthy dogs undergoing open and closed orchidectomy. J Small Anim Pract. 2014;55(10):521–6. [DOI] [PubMed] [Google Scholar]
- 45.Hassanpour H, Khalaji-Pirbalouty V, Nasiri L, Mohebbi A, Bahadoran S. Oxidant and enzymatic antioxidant status (gene expression and activity) in the brain of chickens with cold-induced pulmonary hypertension. Int J Biometeorol. 2015;59:1615–21. [DOI] [PubMed] [Google Scholar]
- 46.Nasiri L, Vaez-Mahdavi M-R, Hassanpour H, Askari N, Ardestani SK, Ghazanfari T. Concomitant use of relative telomere length, biological health score and physical/social statuses in the biological aging evaluation of mustard-chemical veterans. Int Immunopharmacol. 2022;109:108785. [DOI] [PubMed] [Google Scholar]
- 47.Darr CR, Moraes LE, Connon RE, Love CC, Teague S, Varner DD, Meyers SA. The relationship between mitochondrial DNA copy number and stallion sperm function. Theriogenology. 2017;94:94–9. [DOI] [PubMed] [Google Scholar]
- 48.Hassanpour H, Nikoukar Z, Nasiri L, Bahadoran S. Differential gene expression of three nitric oxide synthases is consistent with increased nitric oxide in the hindbrain of broilers with cold-induced pulmonary hypertension. Br Poult Sci. 2015;56(4):436–42. [DOI] [PubMed] [Google Scholar]
- 49.Du Sert NP, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M. Reporting animal research: explanation and elaboration for the ARRIVE guidelines 2.0. PLoS Biol. 2020;18(7):e3000411. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data is provided within the manuscript or supplementary information files.