Characteristics of Candida albicans Derived From HIV‐Positive Individuals With Oral Candidiasis: Genotyping, Phenotypic Variation, Antifungal Susceptibility, and Biofilm Formation

ABSTRACT

Background

Oral candidiasis (OC) is one of the most common mucosal infections in those afflicted with HIV/AIDS. This study aimed to provide detailed information on the phenotype, genotype, antifungal susceptibility, and biofilm formation ability of oral Candida albicans isolated from HIV‐infected patients with OC.

Methods

A total of 25 C. albicans isolates were collected from oral lesions of HIV‐infected patients referred to Behavioral Diseases Counseling Center affiliated with Ahvaz Jundishapur University of Medical Sciences, Iran. The antifungal susceptibility testing was done according to CLSI M27 guideline (fourth edition). The crystal violet method was used to evaluate the biofilm formation ability of isolates. Different phenotypes were identified on yeast extract‐peptone‐dextrose agar medium supplemented with phloxine B. Genotyping analysis of the isolates was performed using high‐resolution melting (HRM) assays and ABC genotyping.

Results

The highest and lowest susceptibility of the C. albicans isolates was found for fluconazole 24 (96%) and ITC 18 (72%), respectively. Forty‐eight percent of the isolates had high biofilm formation ability and exhibited gray cell type. The most common genotype was genotype B (52%). HRM analysis of HIS3, EF3, and CDC3 markers showed three, four, and five different groups, respectively.

Conclusion

Investigating the phenotype, antifungal susceptibility and biofilm formation ability of the C. albicans isolates obtained from oral lesions of HIV‐infected patients revealed that the dominant genotypes in the current research could cause more serious infections from the oral source. We recommend further research with a larger sample size to determine the molecular epidemiology of C. albicans among HIV patients in Iran.

The present study was designed to determine the genetic diversity of the C. albicans isolates taken from HIV‐infected patients living in Ahvaz using simple and inexpensive HRM analysis of HIS3, EF3, and CDC3 microsatellites and ABC typing. Additionally, the antifungal susceptibility test, biofilm formation assay, phenotypic switching, and possible correlations between them were investigated.

1. Introduction

Candida albicans is a ubiquitous commensal yeast in healthy individuals [1] as well as an important opportunistic pathogen for immunocompromised patients, which is responsible for both superficial and systemic infections [2]. Therefore, the presence of this yeast can indicate the presence of underlying systemic disease. Among people living with HIV/AIDS, oral candidiasis (OC) is one of the most common oral mucosal infections proved to be the first indicator of HIV infection [3]. The prevalence of C. albicans in these patients is estimated to be 0.9%–83% [4]. Although several factors are involved in C. albicans infection, the natural C. albicans populations are a combination of closely related strains [5], and some types play a greater role in causing the infection [6]. For instance, C. albicans genotypes that occur more likely in multilocus sequence typing as Clade 1 strains may present significantly higher drug resistance and growth abilities with stable inheritance [7]. Also, the tristable phenotypic switching system (gray, opaque, and white cells) and the differences in enzymatic activity may contribute to the adaptation of C. albicans to disseminate in different tissues and inhabit host niches [8].

Typing methods have been described as a useful tool for epidemiological surveys, nosocomial transmissions, infection routes, and genotype‐phenotype correlations [9]. Several PCR‐based methods for C. albicans genotyping have been developed since 1990s [9], including ABC genotyping, which is based on the presence or absence of an intron in 25S ribosomal DNA (rDNA) [10]. Typing techniques based on microsatellite loci such as EF3, HIS3, and CDC3 are useful tools for genotyping in C. albicans [11]. High‐resolution melting (HRM) analysis is a technique for this purpose. Although HRM method has a lower discriminatory power (0.77) compared to methods based on capillary electrophoresis, it provides a simple, homogeneous, close tube, post‐PCR approach for the analysis of genetic variations (SNPs, mutations, methylations) in PCR amplicons [5, 12]. During HRM, using fluorescent DNA binding dyes with improved saturation properties, each PCR product is identified based on temperature melting (T _m), namely the temperature at which half of the double strand DNA is denatured [13]. There is limited information regarding the patterns of microsatellite genotypes in C. albicans isolated from HIV‐infected patients with OC [14, 15].

Therefore, the present study was designed to determine the genetic diversity of the C. albicans isolates taken from HIV‐infected patients living in Ahvaz using simple and inexpensive HRM analysis of HIS3, EF3, and CDC3 microsatellites and ABC typing. Additionally, the phenotype, antifungal susceptibility, biofilm formation ability, and possible correlations between them were investigated.

2. Materials and Methods

2.1. Isolates and Identification

A total of 25 Candida albicans isolates were collected from 22 October 2020 to 21 April 2021. Isolates were previously acquired from oral lesions of HIV‐infected patients referred to Behavioral Diseases Counseling Center affiliated with Ahvaz Jundishapur University of Medical Sciences, Iran. The C. albicans isolates utilized in the current investigation were accurately identified using macroscopic, microscopic, and molecular methods [3]. All the isolates were cultured on CHROMagar Candida medium (CHROMagar; Pioneer, Paris, France), and after incubation for 48–72 h at 35°C in aerobic environments, they were transferred to microtubes containing sterile distilled water for storage at room temperature for a short time (10–15 days). For definitive identification, a 900 bp fragment from ITS r‐DNA region was subjected to PCR‐sequencing. For this purpose, yeast cells were cultured for 48 h on Sabouraud dextrose agar (SDA) at 35°C in an aerobic environment. Genomic DNA was extracted using a fast, efficient, and reproducible boiling method for at least 20 min in distilled water without adding chemical reagents and then purified by phenol‐chloroform‐isoamyl alcohol (Sigma‐Aldrich, Germany); afterward, DNA was precipitated using isopropanol (Merck, Germany) and the pellet was washed by 70% ethanol. Finally, the DNA was dried in room temperature and dissolved in 100 μL distilled water [16]. A260/A280 ratio and DNA concentration (ng/μL) were calculated using microvolume UV‐Vis spectrophotometer (NanoDrop; Thermo Scientific). Subsequently, the ITS region was amplified using V9G (5′ TTACGTCCCTGCCCTTTGTA 3′) and LS266 (5′ GCATTCCCAAACAACTCGACTC 3′) primers [17]. Strands of the amplified DNA were analyzed at Cardiology Department of Rajaie Cardiovascular, Medical and Research Center, Tehran, Iran.

2.2. Antifungal Susceptibility Test

In vitro antifungal susceptibility testing was done according to Clinical and Laboratory Standards Institute (CLSI) M27 (fourth edition guideline) [18]. All the C. albicans isolates were tested against amphotericin B (AMB), fluconazole (FLC), itraconazole (ITC), posaconazole (PCZ), and caspofungin (CAS). For this purpose, antifungal agents were purchased from Sigma‐Aldrich (Steinheim, Germany) and the following concentration ranges were prepared: 0.03–16 μg/mL for AMB and FLC, 0.01–8 μg/mL for ITC and PCZ, and 0.0001–0.5 μg/mL for CAS. Antifungal agents (100 μL) and an equal volume of standard inoculum yeast suspension were added to each well of microtiter plate. The standard inoculum suspensions were prepared at a wavelength of 530 nm using spectrophotometric method (equal to a 0.5 McFarland). The stock solution was dilutedat 0.5 × 10³ and 2.5 × 10³ cells/mL with RPMI 1640 medium. The minimum inhibitory concentration (MIC) was considered that concentration eliciting 100% inhibition of growth for AMB and 50% inhibition for FLC, ITC, PCZ, and CAS. Also, MIC geometric (GM) as well as concentrations inhibiting 50% (MIC50) and 90% (MIC90) of the isolates was calculated for each antifungal. CLSI breakpoints [19] and epidemiological cutoff values (ECVs) [20] were used for susceptibility interpretation. Two reference strains, namely C. krusei (Candida krusei) ATCC 6258 and C. parapsilopsis (Candida parapsilosis) ATCC 22019, served as quality control strains.

2.3. Biofilm Formation Assays

In the present study, the biofilm formation ability of the C. albicans isolates was evaluated using crystal violet method, which provides a quantitative assessment of biofilm biomass [21, 22]. Briefly, based on the protocol, all the isolates were cultured in Sabouraud Dextrose Broth in a shaker incubator at 30°C for 24 h in an aerobic environment. After washing twice with sterile phosphate buffer solution (1× PBS) (pH 7.4) (Sigma‐Aldrich), a fresh aqueous yeast suspension of 0.5 McFarland turbidity was prepared and subsequently diluted at 1:10 with RPMI 1640 medium. The 200 μL aliquots of suspension were poured in flat bottom 96 microplates (three wells for each strain) and incubated for 48 h at 37°C. The wells that contained solely the medium were considered as negative control, and the reference strain C. albicans ATCC 10231 served as the positive control. Then, the content of wells was aspirated, washed three times with sterile PBS and air dried. Afterward, each well was stained using 100 μL of 2% crystal violet for 15 min at 37°C. In the next step, excess stain was gently removed by washing with PBS, the wells air‐dried, and the bound dye solubilized with 100 μL of 96% ethanol [21].

The biomass was quantified by reading absorbance (Abs) at 595 nm using a microplate reader (BioTek, Elx808). Based on the level of biomass production, the isolates were classified into three categories as follows: low biofilm formers (LBF), high biofilm formers (HBF), and intermediate biofilm former (IBF), if their biomass Abs were less than the first quartile (Q1; Abs_isolate ≤ 1.5), greater than the third quartile (Q3; Abs_isolate > 2.6), and between the first and third quartile (Q1–Q3), respectively [23].

2.4. Phenotype Switching Assays

Yeast cell suspensions with a concentration of 500–1000 CFU/mL were prepared from overnight cultures in sterile distilled water. Twenty‐five microliters of each C. albicans suspension was spread on yeast extract‐peptone‐dextrose (YPD; Merck) agar supplemented with 5 μg/mL of phloxine B (Merck) to evaluate the phenotype switching and incubated for 5 days at 37°C. Opaque colonies are deep pink in the presence of phloxine B, whereas white colonies remain white and gray colonies are light pink [8].

2.5. Genotyping Assays

Genotyping analysis of the C. albicans isolates was performed using HRM assays using three sets of HRM primers previously described, namely CDC3, EF3, and HIS3 (Table 1) [5]. Genes amplification by HRM was carried out with a Type‐it HRM PCR Kit (QIAGEN, Germany) on a Rotor‐Gene 6000 (Corbett Research) using the following program: an initial PCR activation step at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 55°C for 30 s, and extension at 72°C for 10 s, followed by T _m analysis with increasing temperatures from 60°C to 95°C at a rate of 0.1°C/2 s. One primer pair was used in each PCR analysis. Also, reaction with distilled water as the DNA template were used as the non‐template control (NTC). After that, the melting curves of all samples were analyzed using Gene Scanning Software Version 1.5.0 (Roche Instrument Centre, Switzerland). Also, to confirm HRM genotyping results, real time PCR products were sequenced using Applied Biosystems 3500 Genetic Analyzer, an 8‐capillary Sanger sequencing instrument. Afterward, phylogenetic trees were obtained using neighbor joining (NJ) method as well as Kimura's two‐parameter distance correction (K2P) model with 1000 bootstrap replications supported by MEGA11 software.

TABLE 1.

HRM primer sequences.

Primer	Primer sequence (5′ → 3′)	T m (°C)	Size (bp)	Chromosome	Locus
EF3	F: TTTCCTCTTCCTTTCATATAGAA	56	136	5	Elongation factor
	R: GGATTCACTAGCAGCAGACA	58
CDC3	F: CAGATGATTTTTTGTATGAGAAGAA	58	127	1	Cell division cycle
	R: CAGTCACAAGATTAAAATGTTCAAG	59
HIS3	F: TGGCAAAAATGATATTCCAA	50	176	2	Histidine 3
	R: TACACTATGCCCCAAACACA	56

In addition, ABC genotyping was done by amplifying the 25S rDNA gene with specific primers CAINT‐L (5′‐ATAAGGGAAGT CGGCAAAATAGATCCGTAA‐3′) and CAINT‐R (5′‐CCTTGGCTGT GGTTTCGCTAGATAGTAGAT‐3′) [24]. The reaction mixture contained 12.5 μL of 2× master mix (Amplicon), 0.5 μL of each primer (10 μM), 2 μL of DNA template, and PCR‐grade water to make a total volume of 25 μL. The amplification program involved an initial denaturation at 95°C for 7 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 25 s, extension at 72°C for 30 min with a final extension step of 7 min at 72°C. The PCR product of −450 bp represented type A, 840 bp type B, while type C was detected by simultaneously observing the bands of 450 and 840 bp.

2.6. Statistical Analysis

In this research, a total of 25 clinical C. albicans isolates were meticulously tested in duplicate and the results of each sample presented as the mean value. The DP index helps calculate the average probability that a different type than two unrelated strains is randomly sampled in the microbial population of a given taxon. Descriptive statistics and chi‐squared test were used for data analysis using SPSS Statistics for Windows, Version 23.0 (IBM SPSS Statistics for Windows; Version 23.0., IBM Corp, Armonk, NY), and p ≤ 0.05 was considered the default value for significance.

3. Result

3.1. Isolates and Identification

The sequences were compared to reference sequences in GenBank (NCBI) database, according to which ≥ 99% similarity was observed. Finally, all the nucleotide sequences were uploaded to GenBank and accession numbers OP601573‐97 were obtained.

3.2. Antifungal Susceptibility Test

All the C. albicans isolates were wild type (i.e., isolates without mutational or acquired resistance mechanisms) to AMB and PCZ (Table 2). The highest and lowest susceptibility of the C. albicans isolates were found for FLC 24 (96%) and ITC 18 (72%), respectively. Moreover, two isolates (8%) were in the intermediate range to CAS. A total of 24% and 4% of the isolates exhibited susceptible dose dependency (SDD) to ITC and FLC, respectively, whereas only one isolate (4%) was resistant to itraconazole.

TABLE 2.

In vitro antifungal susceptibility of the Candida albicans isolates.

Candida albicans (n = 25)	MIC (μg/mL)				CBP			ECV
	MIC range	MIC50 a	MIC90 a	MICGM	S (%)	I/SDD (%)	R (%)	WT (%)	NWT (%)
AMB	0.015–0.5	0.25	0.5	0.1379	—	—	—	25 (100)	0
FLC	0.25–4	0.5	1.0	0.6071	24 (96)	1 (4)	0	—	—
ITC	0.0039–1.0	0.062	0.25	0.0510	18 (72)	6 (24)	1 (4)	—	—
PCZ	0.0002–0.031	0.0039	0.015	0.0050	—	—	—	25 (100)	0
CAS	0.0078–0.5	0.062	0.25	0.0520	23 (92)	2 (8)	0	—	—

Abbreviations: AMB, amphotericin B; CAS, caspofungin; CBP, species‐specific CLSI clinical breakpoints; ECV, specific epidemiological cutoff value; FLC, fluconazole; GM, geometric mean; I, intermediate; ITC, itraconazole; MIC, minimum inhibitory concentration; NWT, non‐wild‐type; PCZ, posaconazole; R, resistant; S, susceptible; SDD, susceptible dose dependency; WT, wild‐type.

^a MIC50 and MIC90: concentrations at which 50% and 90% of the isolates are inhibited.

3.3. Biofilm Formation Assays

Our analysis demonstrated that 12 isolates (48%) had high ability of biofilm formation, while 7 C. albicans isolates (28%) showed low biofilm formation. The C. albicans isolates were classified into three categories based on the level of biomass production as shown in Figure 1.

FIGURE 1.

Biofilm mass based on absorbance quarter; 48% of the isolates had biomass greater than the third quartile (HBF), 24% lay in second quartile (IBF) and 28% had ≤ first quartile (LBF). HBF, high biofilm formation; IBF, intermediate biofilm formation; LBF, low biofilm formation.

3.4. Phenotype Switching Assays

Almost half of the phenotypes detected on YPD agar medium that contained phloxine B in the present study were gray cell type (48%) (Figure 2). In addition, white and opaque colonies were observed in 20% and 16% of the isolates. More details of each phenotype according to color and shape are shown in Table 3.

FIGURE 2.

Different phenotypes of the Candida albicans isolates according to colony color in YPD agar media contained white, opaque, gray cells and sectored colonies.

TABLE 3.

Different phenotypes of the Candida albicans isolates according to color and shape of colony.

Colonies' color on solid media		N (%) isolates	Colonies shape	N (%) isolates
With phloxine B	Without phloxine B
Deep‐pink and rough	Gray and rough (opaque)	4 (16)	Ring phenotype	3 (12)
			Central phenotype	1 (4)
Light‐pink and shiny	Gray and shiny (gray)	12 (48)	Central phenotype	2 (8)
			Dome‐shape	10 (40)
White and shiny	White and shiny (white)	5 (20)	Dome‐shape	5 (20)
Sectored colonies	—	4 (16)	Dome‐shape	4 (16)

3.5. Genotyping Assays

The PCR‐HRM assay was performed for genotyping of 25 C. albicans isolates using three microsatellite markers of EF3, CDC3, and HIS3. The no template control did not show C _q values, indicating no product amplification during HRM assay. Each HRM clade demonstrated different T _m and subsequently different melting curves. For genotype categorization, those isolates having plots within ±0.2 relative fluorescence unit (RFU) cutoffs were considered as the “same” genotype, whereas strains with plots outside of ±0.2 RFU cutoffs were marked as “different.” All the C. albicans isolates were successfully classified into groups by real‐time PCR‐HRM assay. In this way, HRM analysis of HIS3, EF3, and CDC3 markers showed three, four, and five different groups, respectively (Figure 3). Discrimination power (DP) for CDC3 and EF3 markers was 0.74, and it was 0.64 for HIS3 marker. Combination of the three markers yielded a DP value of 0.90. Also, 10 C. albicans isolates (40%) recovered from the oral cavity of HIV patients were heterozygous for CDC3 marker (Figure 4), while all those isolates showed a homozygous genotype for EF3 and HIS3. The CDC3, EF3, and HIS3 sequence‐based phylogenetic tree of the C. albicans isolates is shown in Figure 5. Almost all the nodes had bootstrap percentages greater than 75%. Therefore, the phylogenetic trees were characterized by high robustness within our isolates.

FIGURE 3.

Melting curves corresponding to the HRM groups for Candida albicans CDC3 (A), EF3 (B), and HIS3 (C) locus. Each melting curve represents a HRM clade.

FIGURE 4.

Heterozygous strains according to melting curves analysis.

FIGURE 5.

The phylogenetic tree based on CDC3 (A), EF3 (B), and HIS3 (C) sequence of the Candida albicans isolates computed by NJ analyses and K2P model. The support of each branch is indicated by percentages at each node. The corresponding HRM groups are specified in these trees.

Finally, ABC typing analysis showed that out of 25 C. albicans strains, the most common genotype was genotype B (13 isolates, 52%), followed by genotype A (nine isolates, 36%) and genotype C (three isolates, 12%). Contrary to our expectation, there was no statistically significant relationship between genotype, phenotype, antifungal susceptibility pattern, and intensity of biofilm formation. Several factors may affect our evaluation such as small sample size, temperature conditions, geographical area, as well as the impact of host immune response, underlying medical conditions, and variations in host genetics. Further research is needed to fully understand the complex interplay between these factors.

4. Discussion

All three types (A, B, and C) of C. albicans were detected in our study, and genotype B was the most prevalent type. We found only three isolates belonging to genotype C. Odds et al. stated that genotype C is a rare genotype recovered in only 173 (9%) C. albicans isolates [25]. While Amanloo et al. reported genotype A (14 isolates; 45.2%) as the most frequent among Iranian patients who suffer from oropharyngeal candidiasis [26], in Sardi et al. survey, genotype B (51.6%) was the predominant type, which was in agreement with our results. Based on their research, in reduced oxygen atmospheric condition, genotype B was strongly positive for proteinase (95.5%) and phospholipase activities (15.6%) and showed high hydrophobicity (41.5%) under anaerobic conditions. Some pieces of evidence show that the transferable intron region of 25S rDNA gene is related to flucytosine sensitivity and that genotype B is more susceptible to flucytosine. For this reason, the isolation of genotype B was higher among HIV patients [27]. According to Chavez et al.'s explanation, genotype B of the C. albicans isolates has a high tendency toward progress to invasive infection [28]. Therefore, more in‐depth studies on virulence factors and molecular characteristics of genotype B C. albicans isolated from Ahvaz patients are required. Also, ABC genotyping has been shown to help clinicians predict whether or not a patient's C. albicans OC is likely to develop candidemia [27].

By the way, all genotypes have the flexibility to adapt to environmental stressors as a key aspect of C. albicans lifestyle that is critical for its survival as a commensal or pathogenic agent, a phenomenon known as phenotype switching [29]. As indicated by previous studies, various phenotypes differ not only in colony and cellular appearance but also in gene expression patterns [8, 30]. Some genes are expressed exclusively in certain phenotypes, and these differences lead to various host invasion ability of these phenotypes [30]. Gray cells, which were the dominant phenotype observed in our study, exhibit an intermediate level of mating competency and cell size and have the highest secreted aspartyl proteinase activity compared to opaque and white phenotypes. Finally, gray cells show the highest ability to cause cutaneous infections [8, 31]. Also, gray cells are more virulent than white and opaque cells in an ex vivo oral infection models [32] as well as in areas having a lower temperature than internal regions of the body. This phenotype is in transition from white to opaque phenotype or vice versa. If they switch to opaque phenotype, the cells can experience mating and are probably cleared from the oral cavity due to the low virulence power, but if they switch to white phenotype, the cells can cause systemic infections from the oral source [8].

Our analysis demonstrated that approximately half of the C. albicans isolates are high biofilm former. In general, the pathogenesis of Candida depends upon both virulence and host factors, and it is not correlated with the infected site. Previous studies have shown that the pathogenicity of oral Candida isolates is similar to systemic Candida isolates [33]. Specifically, the phenotype switching and biofilm formation capacity is central to C. albicans pathogenesis [34]. National Institute of Health (NIH) has estimated that 60%–80% of microbial infections are related to biofilm formation [35]. Aboualigalehdari et al. suggested that higher biofilm formation is due to the presence of persister cells leading to survival in the face of drug treatment in C. albicans isolates [21]. Therefore, high biofilm formation ability can be an important virulence factor facilitating the transition of normal flora to pathogenic phenotype as well as inherent resistance to the majority of known antifungal drugs. We fervently hope that these findings help predict to better treatment of patients infected with C. albicans.

Among the isolates we described, only one isolate (4%) was resistant to ITC, whereas 24% and 4% of them had SDD to ITC and FLC, respectively. The results of this research support the findings of previous investigations, in which one isolate (1%) was FLC‐resistant and another one was categorized into the susceptible dose‐dependent group [36]. Moreover, 18% and 1% of the isolates tested in the Goulart et al. analysis exhibited SDD and resistance to ITC, respectively [36]. Low rates of resistance to AMB and CAS have been reported where all the isolates were sensitive to AMB and CAS [37, 38].

It is worth noting that 50% of the isolates (three out of six) that showed SDD to ITC had a gray phenotype. Also, the only ITC‐resistant and FLC‐susceptible dose‐dependent isolate was of gray type, which was categorized into the genotype A group based on ABC typing. This is while both white and gray phenotypes that were in intermediate range to CAS and susceptible dose‐dependent to ITC had genotypes B. Heterozygous non‐susceptible strains to antifungals tested in the present study were highly frequent (six out of seven isolates), which may play a role in Candida colonization and transmission. It seems that deeper knowledge is needed to identify the characteristics of C. albicans clinical isolates.

As ABC typing method cannot fully distinguish between strains, HRM analysis was used for more successful typing of C. albicans. For this purpose, C. albicans microsatellites (CDC3, EF3, and HIS3) were amplified using HRM technique. Afterward, HRM analysis was performed and clinical isolates were plotted together. These results were consistent with those obtained by sequence‐based phylogenetic tree. Previous studies that used these three loci for genotyping analysis reported DP values in 0.77–0.99 range [5, 14]. Therefore, our results support previous surveys in which HRM has been described as a useful tool for genotyping of C. albicans strains [5, 39, 40]. Costa et al. [40] combined MLP and high‐resolution DNA melting (HRM) analysis for genotyping the CDC3 locus of 95 C. albicans isolates. HRM analysis for a given electrophoretic group generated three different melt curves. The results of the mentioned study demonstrated that HRM is a useful tool to explore the polymorphism of microsatellite markers in diploid organisms such as the C. albicans isolates, which can be an easy approach to increase the resolving power of other genotyping methods. Using combined MLP and HRM analysis of microsatellite loci, Ben Abdeljelil et al. [39] found that three genotypes were common among health care workers and neonates, suggesting that horizontal transmission is involved in the acquisition of multiple episodes of nosocomial C. albicans cross‐infection.

To the best of our knowledge, this is the first study in Iran in which three microsatellite markers have been analyzed by HRM for genotyping the C. albicans clinical isolates. HRM is a cost‐effective, high‐speed alternative for C. albicans genotyping in the clinical laboratory because it only requires real‐time PCR equipment with easy interpretation of results [5].

5. Conclusion

Investigating the characteristics such as phenotype, antifungal susceptibility, and biofilm formation ability of the C. albicans isolates obtained from oral lesions of HIV‐infected patients revealed that the dominant genotypes of the current research have the potential to cause more serious infections from the oral source. Whereas ITC and CAS exhibited lower susceptibility rates compared to FLC, fluconazole still has an acceptable sensitivity to be prescribed as the first‐line treatment for OC among HIV patients. Despite financial limitations, this study attempted to provide valuable information about the genotype of this species. The results of the present study highlight the need for further research with a larger sample size to make more detailed and in‐depth comparisons. This is particularly important in the context of Ahvaz region where there is a lack of comprehensive studies on the genotype of the C. albicans isolates obtained from oral lesions of HIV‐infected patients.

Author Contributions

M.F. was involved in the study design and interpretation of the study's data and the final editing of the manuscript. M.E. contributed to all the steps of experimental work, collection and preparation of clinical samples, data analysis and preparation of the manuscript draft. A.Z.M. contributed interpretation of the data. E.M. contributed to the study sampling design and statistical calculations. M.H. contributed in molecular analysis.

Ethics Statement

This study was approved by the Ethics Committee of Ahvaz Jundishapur University of Medical Sciences Council (IR.AJUMS.MEDICINE.REC.1399.034).

Consent

Consent to participate: Consent to participate in the study was obtained from all individuals and is available. Consent for publication: All authors consent to the publication of the study results.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data underlying the research results are available. No other new data were generated or analyzed in support of this research.