Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2023 Mar 3;65(3):153–160. doi: 10.1111/dgd.12843

Ndst1, a heparan sulfate modification enzyme, regulates neuroectodermal patterning by enhancing Wnt signaling in Xenopus

Takayoshi Yamamoto 1,✉, Yuta Kambayashi 1, Kohei Tsukano 1, Tatsuo Michiue 1,2,✉
PMCID: PMC11520968  PMID: 36726238

Abstract

Neural tissue is derived from three precursor regions: neural plate, neural crest, and preplacodal ectoderm. These regions are determined by morphogen‐mediated signaling. Morphogen distribution is generally regulated by binding to an extracellular matrix component, heparan sulfate (HS) proteoglycan. HS is modified by many enzymes, such as N‐deacetyl sulfotransferase 1 (Ndst1), which is highly expressed in early development. However, functions of HS modifications in ectodermal patterning are largely unknown. In this study, we analyzed the role of Ndst1 using Xenopus embryos. We found that ndst1 was expressed in anterior neural plate and the trigeminal region at the neurula stage. ndst1 overexpression expanded the neural crest (NC) region, whereas translational inhibition reduced not only the trigeminal region, but also the adjacent NC region, especially the anterior part. At a later stage, ndst1 knocked‐down embryos showed defects in cranial ganglion formation. We also found that Ndst1 activates Wnt signaling pathway at the neurula stage. Taken together, our results suggest that N‐sulfonated HS accumulates Wnt ligand and activates Wnt signaling in ndst1‐expressing cells, but that it inhibits signaling in non‐ndst1‐expressing cells, leading to proper neuroectodermal patterning.

Keywords: ectoderm, heparan sulfate, morphogen, Wnt, Xenopus

ndst1 is expressed in anterior neural plate and the trigeminal region in Xenopus neurula. It enhances Wnt signaling in a region‐specific manner by accumulating Wnt ligand. This makes a clear boundary of Wnt signaling, and governs neuroectodermal patterning.

graphic file with name DGD-65-153-g004.jpg

1. INTRODUCTION

Neural tissue comprises many types of cells that are derived from neural plate (NP), neural crest (NC), or preplacodal ectoderm (PPE) (Grocott et al., 2012; Thawani & Groves, 2020). These differentiation processes are regulated by multiple morphogens, such as Wnt, BMP, and FGF (Ozair et al., 2013; Rogers et al., 2009; Schlosser, 2014; Stern, 2006; Tsukano et al., 2022; Yamamoto et al., 2023). However, it remains unclear how these processes are precisely regulated by diffusing molecules.

Extracellular molecules are important regulators of morphogen distribution (Rogers & Schier, 2011; Yamamoto et al., 2022). Among them, an extracellular matrix component, heparan sulfate (HS), binds to morphogens, and restricts their diffusion (Yan & Lin, 2009). For instance, in neuroectodermal patterning, binding of a secreted BMP antagonist (gremlin) to HS is required for NC specification (Pegge et al., 2020).

HS is a glycosaminoglycan (GAG), which is covalently attached to a core protein. HS is modified in stepwise processes by multiple enzymes, initially by N‐deacetylase/N‐sulfotransferase (NDST), forming many different modification domains. Different modifications are thought to have discrete functions, that is, binding of specific morphogens, but the details have not been fully determined. In Xenopus gastrula embryos and HeLa cells, two modifications of HS mediated by NDST, N‐acetyl and N‐sulfo HS, create different domains on the cell membrane, and have different roles in Wnt/β‐catenin signaling pathway (Mii et al., 2017) (defined as Wnt signaling hereafter). Wnt8 is preferentially localized on N‐sulfo‐rich HS, whereas the antagonist, Frzb, is localized on N‐acetyl‐rich HS; however, the functions of Ndst are largely unknown in early development.

Wnt signaling is a key pathway during early embryogenesis, including NC specification (García‐Castro et al., 2002; Gomez et al., 2019; Ikeya et al., 1997; LaBonne & Bronner‐Fraser, 1998; Saint‐Jeannet et al., 1997). The ligand is secreted from the source, diffuses in the extracellular space, and binds to extracellular components, such as the receptor, Frizzled, and HS. In the Wnt/β‐catenin pathway, interaction of Wnt with Frizzled directs stabilization of β‐catenin through inhibition of GSK3β‐mediated phosphorylation, thereby promoting its nuclear localization. In ectodermal patterning, GSK3β overexpression disrupts NC specification (Saint‐Jeannet et al., 1997). Consistently, Wnt8 is essential for Fgf8a‐mediated NC induction ( Hong et al., 2008 ). At later stages, Wnt1 and Wnt3a, secreted from the dorsal neural tube, are required for NC differentiation (Ikeya et al., 1997; Saint‐Jeannet et al., 1997). In contrast, for specification of PPE, which is a neighboring tissue of NC, inhibition of Wnt signaling is required (Brugmann et al., 2004; Litsiou et al., 2005). This precise tuning of Wnt ligand distribution is thought to be essential for neuroectodermal patterning; however, it is not clear whether HS modifications are involved.

Among HS modification enzymes, NDST is the most well‐known for regulation of Wnt signaling (Mii et al., 2017). There are four NDST genes (NDST1‐4) in most mammals (Aikawa et al., 2001). These are also conserved in Xenopus laevis, and among them, ndst1 shows high expression in early development (Michiue et al., 2017). Although Ndst1 mutant mice showed defects of the forebrain and forebrain‐derived structures (Grobe et al., 2005), its function, especially in early neural development, is largely unknown. Here, we analyzed the role of Ndst1 to understand the mechanism of neuroectodermal patterning by utilizing Xenopus laevis embryos.

2. MATERIALS AND METHODS

2.1. Xenopus embryo manipulation and microinjection

All animal experiments were approved by the Office for Life Science Research Ethics and Safety at the University of Tokyo. Manipulation of Xenopus embryos and microinjection experiments were carried out according to standard methods, as previously described (Sive et al., 2000). Briefly, unfertilized eggs were obtained from female frogs injected with gonadotropin and artificially fertilized with testis homogenate. Fertilized eggs were de‐jellied with 4.6% L‐cysteine‐hydrochloride solution (pH 7.8), and incubated in 1/10× Steinberg's solution at 16–20°C. Embryos were staged as reported (Nieuwkoop & Faber, 1967). Amounts of injected mRNAs are described in the figure legends.

2.2. Injected samples

mRNAs were transcribed in vitro using an mMessage mMachine SP6 kit (Thermo Fisher Scientific). ndst1 template was the same as in our previous paper (Mii et al., 2017).

Because X. laevis is an allotetraploid, we used a 1:1 mixture of two morpholino antisense oligonucleotides (MOs) targeting transcripts from both homeologs of ndst1: AGGAGTGGCACAAGCTCACAAATGC (ndst1.L) and AGGAATGGCACAAGCTCACAAATGC (ndst1.S) (Mii et al., 2017). Dextran tetramethylrhodamine (TMR) was used as a tracer (Invitrogen, D1818). Injected amounts of mRNAs and MOs are shown in the legends.

2.3. Whole mount in situ hybridization (WISH)

WISH was performed based on Xenopus standard methods (Harland, 1991) with slight modifications in the duration of washes and a hybridization temperature of 65°C. Plasmids for RNA probes were linearized and transcribed in vitro using a DIG RNA labeling mix (Roche). Enzymes for RNA probe synthesis are listed below.

2.4. β‐Catenin immunohistochemistry and confocal imaging

Xenopus gastrula embryos were fixed with MEMFA (0.1 M MOPS, pH 7.4, 2 mM EGTA, 1 mM MgSO4, 3.7% formaldehyde). Specimens were stained with β‐catenin antibody (C2206, Sigma, 1:1000). The specimens were observed using a confocal microscope (FV‐1200, Olympus).

2.5. RNA probe synthesis for in situ hybridization

Gene Restriction enzyme Transcription enzyme References
ndst1 EcoRI T7 (Mii et al., 2017)
sox3 EcoRI T3 (Nitta et al., 2006)
foxd3 EcoRI T7 (Matsukawa et al., 2015)
slug SpeI T7 (Matsukawa et al., 2015)
neurod4 PstI T7 (Matsukawa et al., 2015)
islet1 EcoRI T7 (Matsukawa et al., 2015)
krt12.4 BamHI T7 (Watanabe et al., 2018)
Open in a new tab

2.6. Phylogenetic analysis of ndst gene

Coding sequences of putative homologs of ndst1.L of X. laevis were collected from genes in cyclostomes, vertebrates, and echinoderms using ORTHOSCOPE v1.5.2 (Inoue & Satoh, 2019). Multiple alignments were constructed using MUSCLE program (Edgar et al., 2004). Phylogenetic trees were generated using the maximum likelihood method (ML) using MEGA11: Molecular Evolutionary Genetics Analysis version 11 (Tamura et al., 2021).

3. RESULTS AND DISCUSSION

ndst1 is broadly expressed at the gastrula stage in Xenopus, but slightly more in the dorsal region (Mii et al., 2017). Its expression pattern at later stages was previously unknown. To investigate this, we carried out in situ hybridization, and found that at the early neurula stage (stage 13), ndst1 is expressed around the anterior region (Figure S1). At later stages (stages 15, 17), ndst1 is mainly expressed in anterior NP and a region lateral to it (Figure 1). This expression in the lateral region appeared to coincide with the expression pattern of a trigeminal marker gene, neurod4 (ath3) (Hardwick & Philpott, 2015; Matsukawa et al., 2015). To investigate their expression patterns side‐by‐side, we performed in situ hybridization against trigeminal marker genes, neurod4, and islet1. Hemi‐sections show that these three genes are similarly expressed in the lateral region of the sensorial layer of epidermal ectoderm (Figure 1).

FIGURE 1.

FIGURE 1

Open in a new tab

Expression pattern of ndst1, neurod4, and islet1 in Xenopus neurula. Spatial expression pattern of ndst1, neurod4, and islet1 was visualized by in situ hybridization at the neurula stage (stages 15, 17; anterior view, dorsal to the top). The specimen was cut with a razor at the dashed line (hemi‐section). All three genes were expressed at the lateral sensorial layer of neuroectoderm (arrowhead). Scale bar = 500 μm. nc, neural crest; np, neural plate.

Because Xenopus laevis is an allotetraploid species with two homeologous chromosomes, L and S, it has two ndst1 genes, ndst1.L and ndst1.S (Session et al., 2016). During embryonic stages, the L gene is highly expressed (Michiue et al., 2017). To investigate role of ndst1 during Xenopus early development, we injected ndst1.L mRNA into two blastomeres of the lateral region of the animal pole with a tracer lacZ mRNA at the 4‐cell stage (Figure 2a). Expression of NC marker genes, slug and foxd3, was expanded to the non‐neuroectodermal region on the injected side (Figure 2b,c). The anterior region of expression of sox3, an NP marker gene, was also expanded laterally. These expansions of expressing regions of foxd3, slug, and sox3 in overexpressing embryos were statistically significant (Figure 2c), suggesting that ndst1 expression regulates neuroectodermal patterning.

FIGURE 2.

FIGURE 2

Open in a new tab

Overexpression of ndst1 expands the neural crest region (a) Schematic view of the injection. 25 pg ndst1.L mRNA with a tracer, 100 pg lacZ mRNA, were injected into two blastomeres at the 4‐cell stage (slightly lateral from the midline as indicated), and the specimens were fixed at the neurula stage (st. 17). The light brown cells are the dorsal blastomere. The dark ones are the ventral blastomere. (b and c) Expression pattern of foxd3, slug, and sox3 in ndst1‐overexpressed embryos. lacZ injected cells (a tracer) are colored red (“injected side” in the figures). ndst1 overexpression expands the neuroectodermal‐gene expressed region as quantified in (c). Arrowheads indicate the expanded region. Dashed line indicates the midline of the embryo. Differences in expression areas were quantified by their area or width from the midline for the injected and uninjected sides. Statistical significance was analyzed by Student's t‐test (p = 1.1 × 10−6 [foxd3; n = 28 (uninjected) vs. 27 (injected)], 6.1 × 10−5 [slug; n = 20 (uninjected) vs. 15 (injected)], 0.014 [sox3; n = 20 (uninjected) vs. 12 (injected)]). *p < 0.05, ***p < 0.005. Scale bar = 500 μm.

Similarities in expression patterns of ndst1, neurod4, and islet1 suggest that ndst1 functions in differentiation of the trigeminal nerve, which is derived from PPE. To examine this, we knocked down ndst1 homeologs using a morpholino antisense oligonucleotide (MO), as previously reported (Mii et al., 2017). We injected ndst1 MOs with a tracer, tetramethylrhodamine (TMR), into the slightly lateral region of the animal pole of a dorsal blastomere at the 4‐cell stage (Figure 3a). As a result, expression of a trigeminal marker gene, neurod4, decreased at the neurula stage (Figure 3b,c). In addition, anterior expression of an NC marker, foxd3, decreased (Figure 3b,c) and an epidermal marker gene, krt12.4, shrank laterally (Figure S2A,C). Although we wondered whether neighboring tissue would expand, the region expressing the NP marker, sox3, was not substantially altered (Figure S2A,B). Consistent with the defect in the trigeminal region at the neurula stage, ndst1 further reduced expression of islet1 in the trigeminal and branchial regions at the tailbud stage (Figure 3d,e). These results indicate that Ndst1 is essential at least for differentiation of the prospective trigeminal region and NC. In addition, ndst1 knockdown may enhance differentiation of the neural/epidermal border other than NP, the trigeminal region, or NC because expression of all genes analyzed in this study was either reduced or unchanged.

FIGURE 3.

FIGURE 3

Open in a new tab

Knockdown of ndst1 reduces the anterior neural crest region. (a) Schematic view of the injection. 2.5 pmol of ndst1 morpholino antisense oligos with a tracer, tetramethylrhodamine (TMR), were injected into dorsal blastomere (dorsal and ventral blastomeres, slightly lateral from the midline as indicated), and specimens were fixed at the neurula stage (st. 17). (b and c) Expression pattern of foxd3 and neurod4. TMR injected cells are colored red (the right side in the figures). This morpholino injection reduced the expressed region of both genes (arrowhead) as quantified in (c). p = 1.8 × 10−8 (neurod4; n = 11 (control morpholino antisense oligonucleotide [MO]) vs. 13 (ndst1 MO)), 1.9 × 10−7 (foxd3; n = 11 (control MO) vs. 12 (ndst1 MO)) (Student's t‐test). (d and e) islet1 expression pattern at the tailbud stage (st. 32) in the morphants. ndst1 knockdown reduces islet1 expression in the trigeminal region (arrow), and the branchial region (arrowheads) as quantified in (e) (Fisher's exact test, p = 6.3 × 10−5 (trigeminal ganglia), 1.2 × 10−2 (cranial ganglia); n = 12 each). ***p < 0.005. Scale bar = 500 μm.

The region affected by ndst1 knockdown, the cranial region including the trigeminal region and NC, raises the possibility that acquisition of the ndst gene contributed to jaw evolution by shaping the morphogen gradient, including Wnt, because jaws are principally derived from the cranial region, which is a driving force of vertebrate evolution (Depew et al., 2002; Shigetani et al., 2002). At least, this gene, which has an N‐deacetylase/N‐sulfotransferase domain, is conserved not only in jawed vertebrates (gnathostomes), but also in Ciona intestinalis, C. elegans, Drosophila, cnidarians, and Trichoplax, suggesting that the Ndst gene appeared in the common ancestor of all metazoans (Filipek‐Górniok et al., 2015) although at least in C. elegans and Drosophila the sulfation site in sugar chains differs from that of vertebrate NDST (Kusche‐Gullberg et al., 2012; Toyoda et al., 2000). To further investigate whether this gene is conserved in cyclostomes (jawless vertebrates), we constructed a phylogenetic tree of putative Ndst genes of cyclostomes (lampreys and hagfish) and jawed vertebrates (Figure S3). Because putative Ndst genes of cyclostomes formed a monophyletic group with Ndst genes of jawed vertebrates, the Ndst gene(s) is apparently conserved in cyclostomes. However, only because the Ndst gene(s) itself is conserved, it does not necessarily mean that its expression pattern is also conserved. To further address whether Ndst is involved in jaw evolution, its expression pattern in cyclostomes should be analyzed in future studies.

Ndst1 enhances Wnt signaling at the gastrula stage (Mii et al., 2017) and region‐specific regulation of Wnt signaling is essential for neuroectodermal patterning (García‐Castro et al., 2002; Litsiou et al., 2005). Therefore, we wondered whether Ndst1 induces region‐specific enhancement of Wnt signaling during the neurula stage. To examine this, we injected ndst1 mRNA with a tracer, mRFP mRNA into two blastomeres at the 4‐cell stage (Figure 4a), and analyzed nuclear localization of β‐catenin (an indicator of Wnt‐signal activation) using immunohistochemistry. Cells positive for nuclear β‐catenin were increased with ndst1 expression, but not with mRFP expression (Figure 4b,c). This indicates that Ndst1 enhances Wnt signaling during neuroectodermal patterning.

FIGURE 4.

FIGURE 4

Open in a new tab

ndst1 overexpression enhances Wnt activity at the neurula stage. (a) Schematic view of the injection. 400 pg mRFP mRNA with/without 25 pg ndst1 mRNA was injected into two blastomeres at the 4‐cell stage as indicated. Specimens were fixed at the neurula stage (stage 17). (b and c) Number of cells positive for nuclear β‐catenin was increased by ndst1‐expression in the non‐neuroectodermal region. β‐catenin was visualized in the region that indicated by dotted box in (a) using immunohistochemistry against β‐catenin (green). Cells injected mRFP mRNA with/without ndst1 mRNA are colored magenta. The neuroectodermal region is the center (black bar). The non‐neuroectodermal region is indicated by blue bars. Cells positive/negative for β‐catenin were counted in the non‐neuroectodermal region (uninjected side vs. injected side of mRFP injected or mRFP + ndst1 injected embryos). Fisher's exact test, p = 0.84 (mRFP; n.s.; n = 172 [uninjected] vs. 143 [injected]), 1.4 × 10−11 (mRFP + Ndst1; ***; n = 131 [uninjected] vs. 130 [injected]). Scale bar = 100 μm. (d) Schematic view of N‐sulfo‐rich HS function on morphogen distribution.

Combined with the finding that ndst1 expression enhances Wnt signaling (Figure 4b,c) and accumulates Wnt8a ligands (Mii et al., 2017), which are mainly secreted from the posterior region (Kiecker & Niehrs, 2001; Litsiou et al., 2005), ndst1 knockdown is thought to reduce Wnt accumulation around Ndst1‐expressing cells, in the anterior NP and the trigeminal region (Figure 1), thereby reducing induction of the trigeminal region and NC. This is consistent with previous reports that Wnt is required for NC specification, but seemingly inconsistent with reports that Wnt signaling must be inhibited for specification of the precursor of the trigeminal region, PPE. However, Wnt signaling is also required when PPE is subdivided into smaller regions. Among the smaller regions of PPE derivatives, the trigeminal placode region requires a higher level of Wnt activation (Heisenberg et al., 2001; Park & Saint‐Jeannet, 2008; Watanabe et al., 2015). This can explain the PPE defect, a reduction of trigeminal formation, in ndst1‐knocked‐down embryos.

However, Ndst1‐deficient mice embryos show defects similar to mutants of the FGF and Shh pathways (Pallerla et al., 2007). In neuroectodermal patterning, FGF signaling is required for NP, NC, and PPE specification (Ahrens & Schlosser, 2005; Litsiou et al., 2005; Streit & Stern, 1999). Our finding that Ndst1 regulates Wnt signaling at the neurula stage does not rule out the possibility that it also regulates FGF signaling.

We also revealed that ndst1 affects not only cells in which it is expressed, but also neighboring cells, including NC (Figure 3). Accumulation of Wnt ligand by Ndst1 enhances Wnt signaling near ndst1‐expressing cells but inhibits further Wnt spreading. This may broadly affect neuroectodermal patterning, not limited to ndst1‐expressing cells, as observed in ndst1‐knockdown embryos.

In general, to form a morphogen gradient, it is necessary to have a “sink” that removes morphogen from the extracellular space (Crick, 1970). Because N‐sulfo‐rich HS, which is the product of Ndst1, and is present more or less throughout embryos at the gastrula stage, is readily internalized from the cell membrane with morphogen, we thought that it not only accumulates morphogens but also serves as a morphogen “sink” (Mii et al., 2017). Additionally, the present data suggest that N‐sulfo‐rich HS localized in specific regions of embryos actively reduces the amount of morphogen in regions distal to the morphogen source, clearly defining boundaries of morphogen‐mediated signaling, rather than merely shaping gradients (Figure 4d). Thus, region‐specific removal of morphogen mediated by N‐sulfo‐rich HS may be essential to form complex gradients for proper patterning, including neuroectodermal differentiation in vertebrates.

AUTHOR CONTRIBUTIONS

Takayoshi Yamamoto, Yuta Kambayashi, Kohei Tsukano, and Tatsuo Michiue conceived this project. Takayoshi Yamamoto, Yuta Kambayashi and Kohei Tsukano performed experiments and wrote the manuscript with help from Tatsuo Michiue.

CONFLICT OF INTEREST STATEMENT

The authors declare no competing interests.

Supporting information

Figure S1. ndst1 expression pattern at early neurula stage in Xenopus. Anterior view of ndst1 expression at stage 13 (dorsal to the top). Scale bar = 500 μm.

DGD-65-153-s001.tiff (33.2MB, tiff)

Figure S2.Knockdown of ndst1 reduced the epidermal region, but not the neural plate region. (A) Schematic view of the injection. 2.5 pmol of ndst1 morpholino antisense oligos with a tracer, TMR, were injected into the dorsal blastomere, and specimens were fixed at the neurula stage (st. 17). (B–C) Expression pattern of sox3 and krt12.4. TMR injected cells are colored red (the right side in each figure). This morpholino injection reduced krt12.4‐expressed region (arrowhead; n = 25 [control MO], n = 26 [ndst1 MO]), but not sox3‐expressed region (n = 29/30 [control MO], n = 28/30 [ndst1 MO]). Differences in krt12.4‐expressed region were quantified by the width from the midline to the place where the expression is visible, as shown by double‐headed arrows in the figures. ***p = 4.25 × 10−5 (Student's t‐test). Scale bar = 500 μm.

DGD-65-153-s002.tiff (33.2MB, tiff)

Figure S3. Phylogenetic tree of ndst genes. The tree was constructed with coding sequences of ndst genes using the maximum likelihood method. As the outgroup, we used coding sequences of hs3st genes of Mus musculus, Gallus gallus, and X. tropicalis because these genes showed the lowest E values other than ndst genes. Each branch is labeled with the species name, gene ID, and gene name, in that order. However, if the gene was not annotated, the gene name is not shown in the figure. Green lines indicate genes of cyclostomes. Blue lines indicate cephalochordates. Magenta lines indicate echinoderms.

DGD-65-153-s003.tiff (33.2MB, tiff)

ACKNOWLEDGMENTS

We thank Dr. Takafumi Ikeda, Ms. Saki Ichikawa, and Ms. Minami Ojima (University of Tokyo, Japan) for help in starting this work, Dr. Yusuke Mii (NIBB, Japan) for critical comments on this project and for providing us morpholino for Ndst1, and Dr. Steven D Aird for technical editing of the manuscript. This work was supported in part by MEXT/JSPS KAKENHI (19 K16138 to TY, 18 K06244/21 K06183 to TY and TM), JST SPRING (JPMJSP2108 to KT) and Narishige Zoological Science Award (to TY). We also thank the National BioResource Project (NBRP) and the NBRP Information Center (National Institute for Genetics) for providing the Xenopus genomic database (http://viewer.shigen.info/xenopus/).

Yamamoto, T. , Kambayashi, Y. , Tsukano, K. , & Michiue, T. (2023). Ndst1, a heparan sulfate modification enzyme, regulates neuroectodermal patterning by enhancing Wnt signaling in Xenopus . Development, Growth & Differentiation, 65(3), 153–160. 10.1111/dgd.12843

Takayoshi Yamamoto, Yuta Kambayashi and Kohei Tsukano contributed equally to this work.

Communicating Editor: Sachiko Tsuda

This article is part of the special issue “Versatile utilities of amphibians.”

Funding information Japan Science and Technology Agency, Grant/Award Number: JPMJSP2108; Ministry of Education, Culture, Sports, Science and Technology, Grant/Award Numbers: 18K06244, 19K16138, 21K06183; Narishige Zoological Science Award

Contributor Information

Takayoshi Yamamoto, Email: tyamamoto@bio.c.u-tokyo.ac.jp.

Tatsuo Michiue, Email: tmichiue@bio.c.u-tokyo.ac.jp.

REFERENCES

  1. Ahrens, K. , & Schlosser, G. (2005). Tissues and signals involved in the induction of placodal Six1 expression in Xenopus laevis . Developmental Biology, 288(1), 40–59. 10.1016/J.YDBIO.2005.07.022 [DOI] [PubMed] [Google Scholar]
  2. Aikawa, J. I. , Grobe, K. , Tsujimoto, M. , & Esko, J. D. (2001). Multiple isozymes of heparan sulfate/heparin GlcNAc N‐deacetylase/GlcN N‐sulfotransferase. Structure and activity of the fourth member, NDST4. The Journal of Biological Chemistry, 276(8), 5876–5882. 10.1074/JBC.M009606200 [DOI] [PubMed] [Google Scholar]
  3. Brugmann, S. A. , Pandur, P. D. , Kenyon, K. L. , Pignoni, F. , & Moody, S. A. (2004). Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor. Development, 131(23), 5871–5881. 10.1242/DEV.01516 [DOI] [PubMed] [Google Scholar]
  4. Crick, F. (1970). Diffusion in embryogenesis. Nature, 225(5231), 420–422. 10.1038/225420A0 [DOI] [PubMed] [Google Scholar]
  5. Depew, M. J. , Lufkin, T. , & Rubenstein, J. L. R. (2002). Specification of Jaw subdivisions by Dlx genes. Science, 298(5592), 381–385. 10.1126/SCIENCE.1075703 [DOI] [PubMed] [Google Scholar]
  6. Edgar, R. C. , Drive, R. M. , & Valley, M. (2004). MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32(5), 1792–1797. 10.1093/nar/gkh340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Filipek‐Górniok, B. , Carlsson, P. , Haitina, T. , Habicher, J. , Ledin, J. , & Kjellén, L. (2015). The NDST gene family in zebrafish: Role of NDST1B in pharyngeal arch formation. PLoS One, 10(3), e0119040. 10.1371/JOURNAL.PONE.0119040 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. García‐Castro, Martín I. , Marcelle, C. , & Bronner‐Fraser, M. (2002). Ectodermal Wnt function as a neural crest inducer. Science, 297(5582), 848–851. 10.1126/SCIENCE.1070824 [DOI] [PubMed] [Google Scholar]
  9. Gomez, G. A. , Prasad, M. S. , Wong, M. , Charney, R. M. , Shelar, P. B. , Sandhu, N. , Hackland, J. O. S. , Hernandez, J. C. , Leung, A. W. , & Garcıá‐Castro, M. I. (2019). WNT/β‐catenin modulates the axial identity of embryonic stem cell‐derived human neural crest. Development, 146(16), dev175604. 10.1242/DEV.175604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Grobe, K. , Inatani, M. , Pallerla, S. R. , Castagnola, J. , Yamaguchi, Y. , & Esko, J. D. (2005). Cerebral hypoplasia and craniofacial defects in mice lacking heparan sulfate Ndst1 gene function. Development, 132(16), 3777–3786. 10.1242/DEV.01935 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Grocott, T. , Tambalo, M. , & Streit, A. (2012). The peripheral sensory nervous system in the vertebrate head: A gene regulatory perspective. Developmental Biology, 370(1), 3–23. 10.1016/J.YDBIO.2012.06.028 [DOI] [PubMed] [Google Scholar]
  12. Hardwick, L. J. A. , & Philpott, A. (2015). Multi‐site phosphorylation regulates NeuroD4 activity during primary neurogenesis: A conserved mechanism amongst Proneural proteins. Neural Development, 10(1), 15. 10.1186/S13064-015-0044-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Harland, R. M. (1991). In situ hybridization: An improved whole‐mount method for Xenopus embryos. Methods in Cell Biology, 36, 685–695. [DOI] [PubMed] [Google Scholar]
  14. Heisenberg, C. P. , Houart, C. , Take‐Uchi, M. , Rauch, G. J. , Young, N. , Coutinho, P. , Masai, I. , Caneparo, L. , Concha, M. L. , Geisler, R. , Dale, T. C. , Wilson, S. W. , & Stemple, D. L. (2001). A mutation in the Gsk3‐binding domain of zebrafish Masterblind/Axin1 leads to a fate transformation of telencephalon and eyes to diencephalon. Genes & Development, 15(11), 1427–1434. 10.1101/GAD.194301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hong, C. S. , Park, B. Y. , & Saint‐Jeannet, J. P. (2008). Fgf8a induces neural crest indirectly through the activation of Wnt8 in the paraxial mesoderm. Development, 135(23), 3903–3910. 10.1242/DEV.026229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ikeya, M. , Lee, S. M. K. , Johnson, J. E. , Mc Mahon, A. P. , & Takada, S. (1997). Wnt Signalling required for expansion of neural crest and CNS progenitors. Nature, 389(6654), 966–970. 10.1038/40146 [DOI] [PubMed] [Google Scholar]
  17. Inoue, J. , & Satoh, N. (2019). ORTHOSCOPE: An automatic web tool for phylogenetically inferring bilaterian orthogroups with user‐selected taxa. Molecular Biology and Evolution, 36(3), 621–631. 10.1093/MOLBEV/MSY226 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kiecker, C. , & Niehrs, C. (2001). A morphogen gradient of Wnt/Beta‐catenin Signalling regulates anteroposterior neural patterning in Xenopus. Development, 128(21), 4189–4201. 10.1242/DEV.128.21.4189 [DOI] [PubMed] [Google Scholar]
  19. Kusche‐Gullberg, M. , Nybakken, K. , Perrimon, N. , & Lindahl, U. (2012). Drosophila heparan sulfate, a novel design. The Journal of Biological Chemistry, 287(26), 21950–21956. 10.1074/JBC.M112.350389 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. LaBonne, C. , & Bronner‐Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a two‐signal model. Development, 125(13), 2403–2414. 10.1242/DEV.125.13.2403 [DOI] [PubMed] [Google Scholar]
  21. Litsiou, A. , Hanson, S. , & Streit, A. (2005). A balance of FGF, BMP and WNT signalling positions the future placode territory in the head. Development, 132(18), 4051–4062. 10.1242/DEV.01964 [DOI] [PubMed] [Google Scholar]
  22. Matsukawa, S. , Miwata, K. , Asashima, M. , & Michiue, T. (2015). The requirement of histone modification by PRDM12 and Kdm4a for the development of pre‐placodal ectoderm and neural crest in Xenopus. Developmental Biology, 399(1), 164–176. 10.1016/J.YDBIO.2014.12.028 [DOI] [PubMed] [Google Scholar]
  23. Michiue, T. , Yamamoto, T. , Yasuoka, Y. , Goto, T. , Ikeda, T. , Nagura, K. , Nakayama, T. , Taira, M. , & Kinoshita, T. (2017). High variability of expression profiles of homeologous genes for Wnt, Hh, Notch, and hippo signaling pathways in Xenopus laevis . Developmental Biology, 426(2), 270–290. 10.1016/J.YDBIO.2016.12.006 [DOI] [PubMed] [Google Scholar]
  24. Mii, Y. , Yamamoto, T. , Takada, R. , Mizumoto, S. , Matsuyama, M. , Yamada, S. , Takada, S. , & Taira, M. (2017). Roles of two types of heparan sulfate clusters in Wnt distribution and signaling in Xenopus. Nature Communications, 8(1), 1–19. 10.1038/s41467-017-02076-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nieuwkoop, P. , & Faber, J. (1967). Normal table of Xenopus laevis (Daudin): A systematic and chronological survey of the development from the fertilized egg till the end of metamorphosis. North Holland Publishing. [Google Scholar]
  26. Nitta, K. R. , Takahashi, S. , Haramoto, Y. , Fukuda, M. , Onuma, Y. , & Asashima, M. (2006). Expression of Sox1 during Xenopus early embryogenesis. Biochemical and Biophysical Research Communications, 351(1), 287–293. 10.1016/j.bbrc.2006.10.040 [DOI] [PubMed] [Google Scholar]
  27. Ozair, M. Z. , Kintner, C. , & Brivanlou, A. H. (2013). Neural induction and early patterning in vertebrates. Wiley Interdisciplinary Reviews. Developmental Biology, 2(4), 479–498. 10.1002/WDEV.90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Pallerla, S. R. , Pan, Y. , Zhang, X. , Esko, J. D. , & Grobe, K. (2007). Heparan sulfate Ndst1 gene function variably regulates multiple signaling pathways during mouse development. Developmental Dynamics, 236(2), 556–563. 10.1002/DVDY.21038 [DOI] [PubMed] [Google Scholar]
  29. Park, B. Y. , & Saint‐Jeannet, J. P. (2008). Hindbrain‐derived Wnt and Fgf signals cooperate to specify the Otic placode in Xenopus. Developmental Biology, 324(1), 108–121. 10.1016/J.YDBIO.2008.09.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pegge, J. , Tatsinkam, A. J. , Rider, C. C. , & Bell, E. (2020). Heparan sulfate proteoglycans regulate BMP Signalling during neural crest induction. Developmental Biology, 460(2), 108–114. 10.1016/J.YDBIO.2019.12.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rogers, C. D. , Moody, S. A. , & Casey, E. S. (2009). Neural induction and factors that stabilize a neural fate. Birth Defects Research. Part C, Embryo Today, 87(3), 249–262. 10.1002/BDRC.20157 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rogers, K. W. , & Schier, A. F. (2011). Morphogen gradients: From generation to interpretation. Annual Review of Cell and Developmental Biology, 27, 377–407. 10.1146/ANNUREV-CELLBIO-092910-154148 [DOI] [PubMed] [Google Scholar]
  33. Saint‐Jeannet, J. P. , He, X. , Varmus, H. E. , & Dawid, I. B. (1997). Regulation of dorsal fate in the Neuraxis by Wnt‐1 and Wnt‐3a. Proceedings of the National Academy of Sciences of the United States of America, 94(25), 13713–13718. 10.1073/PNAS.94.25.13713 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Schlosser, G. (2014). Early embryonic specification of vertebrate cranial placodes. Wiley Interdisciplinary Reviews: Developmental Biology, 3(5), 349–363. 10.1002/wdev.142 [DOI] [PubMed] [Google Scholar]
  35. Session, A. M. , Uno, Y. , Kwon, T. , Chapman, J. A. , Toyoda, A. , Takahashi, S. , Fukui, A. , Hikosaka, A. , Suzuki, A. , Kondo, M. , Van Heeringen, S. J. , Quigley, I. , Heinz, S. , Ogino, H. , Ochi, H. , Hellsten, U. , Lyons, J. B. , Simakov, O. , Putnam, N. , … Rokhsar, D. S. (2016). Genome evolution in the allotetraploid frog Xenopus laevis. Nature, 538(7625), 336–343. 10.1038/NATURE19840 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Shigetani, Y. , Sugahara, F. , Kawakami, Y. , Murakami, Y. , Hirano, S. , & Kuratani, S. (2002). Heterotopic shift of epithelial‐mesenchymal interactions in vertebrate jaw evolution. Science, 296(5571), 1316–1319. 10.1126/SCIENCE.1068310 [DOI] [PubMed] [Google Scholar]
  37. Sive, H. L. , Grainger, R. M. , & Harland, R. M. (2000). Early development of Xenopus laevis: A laboratory manual. CSHL Press. [Google Scholar]
  38. Stern, C. D. (2006). Neural induction: 10 years on since the ‘default model.’. Current Opinion in Cell Biology, 18(6), 692–697. 10.1016/J.CEB.2006.09.002 [DOI] [PubMed] [Google Scholar]
  39. Streit, A. , & Stern, C. D. (1999). Establishment and maintenance of the border of the neural plate in the Chick: Involvement of FGF and BMP activity. Mechanisms of Development, 82(1–2), 51–66. 10.1016/S0925-4773(99)00013-1 [DOI] [PubMed] [Google Scholar]
  40. Tamura, K. , Stecher, G. , & Kumar, S. (2021). MEGA11: Molecular evolutionary genetics analysis version 11. Molecular Biology and Evolution, 38(7), 3022–3027. 10.1093/MOLBEV/MSAB120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Thawani, A. , & Groves, A. K. (2020). Building the border: Development of the chordate neural plate border region and its derivatives. Frontiers in Physiology, 11,  608880. 10.3389/FPHYS.2020.608880 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Toyoda, H. , Kinoshita‐Toyoda, A. , & Selleck, S. B. (2000). Structural analysis of glycosaminoglycans in Drosophila and Caenorhabditis elegans and demonstration that tout‐Velu, a drosophila gene related to EXT tumor suppressors, affects heparan sulfate in vivo. Journal of Biological Chemistry, 275(4), 2269–2275. 10.1074/JBC.275.4.2269 [DOI] [PubMed] [Google Scholar]
  43. Tsukano, K. , Yamamoto, T. , Watanabe, T. , & Michiue, T. (2022). Xenopus Dusp6 modulates FGF signaling to precisely pattern pre‐placodal ectoderm. Developmental Biology, 488, 81–90. 10.1016/J.YDBIO.2022.05.009 [DOI] [PubMed] [Google Scholar]
  44. Watanabe, T. , Kanai, Y. , Matsukawa, S. , & Michiue, T. (2015). Specific induction of cranial placode cells from Xenopus ectoderm by modulating the levels of BMP, Wnt, and FGF signaling. Genesis, 53(10), 652–659. 10.1002/DVG.22881 [DOI] [PubMed] [Google Scholar]
  45. Watanabe, T. , Yamamoto, T. , Tsukano, K. , Hirano, S. , Horikawa, A. , & Michiue, T. (2018). Fam46a regulates bmp‐dependent pre‐placodal ectoderm differentiation in Xenopus. Development, 145(20), dev166710. 10.1242/dev.166710 [DOI] [PubMed] [Google Scholar]
  46. Yamamoto, T. , Kambayashi, Y. , Otsuka, Y. , Afouda, B. A. , Giuraniuc, C. , Michiue, T. , & Hoppler, S. (2022). Positive feedback regulation of Frizzled‐7 expression robustly shapes a steep Wnt gradient in Xenopus heart development, together with SFRP1 and heparan sulfate. eLife, 11, e73818. 10.7554/ELIFE.73818 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Yamamoto, T. , Kaneshima, T. , Tsukano, K. , & Michiue, T. (2023). The heparan sulfate modification enzyme, Hs6st1, governs Xenopus neuroectodermal patterning by regulating distributions of Fgf and Noggin. Developmental Biology. 10.1016/j.ydbio.2023.01.011 [DOI] [PubMed] [Google Scholar]
  48. Yan, D. , & Lin, X. (2009). Shaping morphogen gradients by proteoglycans. Cold Spring Harbor Perspectives in Biology, 1(3), 1–17. 10.1101/cshperspect.a002493 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1. ndst1 expression pattern at early neurula stage in Xenopus. Anterior view of ndst1 expression at stage 13 (dorsal to the top). Scale bar = 500 μm.

DGD-65-153-s001.tiff (33.2MB, tiff)

Figure S2.Knockdown of ndst1 reduced the epidermal region, but not the neural plate region. (A) Schematic view of the injection. 2.5 pmol of ndst1 morpholino antisense oligos with a tracer, TMR, were injected into the dorsal blastomere, and specimens were fixed at the neurula stage (st. 17). (B–C) Expression pattern of sox3 and krt12.4. TMR injected cells are colored red (the right side in each figure). This morpholino injection reduced krt12.4‐expressed region (arrowhead; n = 25 [control MO], n = 26 [ndst1 MO]), but not sox3‐expressed region (n = 29/30 [control MO], n = 28/30 [ndst1 MO]). Differences in krt12.4‐expressed region were quantified by the width from the midline to the place where the expression is visible, as shown by double‐headed arrows in the figures. ***p = 4.25 × 10−5 (Student's t‐test). Scale bar = 500 μm.

DGD-65-153-s002.tiff (33.2MB, tiff)

Figure S3. Phylogenetic tree of ndst genes. The tree was constructed with coding sequences of ndst genes using the maximum likelihood method. As the outgroup, we used coding sequences of hs3st genes of Mus musculus, Gallus gallus, and X. tropicalis because these genes showed the lowest E values other than ndst genes. Each branch is labeled with the species name, gene ID, and gene name, in that order. However, if the gene was not annotated, the gene name is not shown in the figure. Green lines indicate genes of cyclostomes. Blue lines indicate cephalochordates. Magenta lines indicate echinoderms.

DGD-65-153-s003.tiff (33.2MB, tiff)

Articles from Development, Growth & Differentiation are provided here courtesy of Wiley

RESOURCES