Description and phylogenetic position of a new species, Chrysospleniuminsularis J.E.Jang, K.H.Lee & H.Y.Gil (Saxifragaceae), from the southern islands of South Korea

Abstract

We describe a new species, Chrysospleniuminsularis J.E.Jang, K.H.Lee & H.Y.Gil, belonging to the family Saxifragaceae, from the southern islands of the Republic of Korea. Chrysospleniuminsularis is morphologically similar to C.japonicum (Maxim.) Makino but can be distinguished by fairly persistent bulbils, green to yellowish-green sepals, four stamens, and cylindrical papillose seeds. Chrysospleniuminsularis is also distinguished from C.alternifolium L., which is distributed in Europe, northern Russia, and the Caucasus, by the absence of stolons and green bracts. Phylogenetic analyses, based on one nuclear ribosomal (ITS) and two chloroplast (rbcL, matK) regions, confirmed that the new species was monophyletic and that C.insularis and C.alternifolium formed a sister relationship with robust support. Herein, we provide a detailed morphological description of C.insularis with its corresponding geographical distribution and comparison table and figures of related species.

Introduction

Chrysosplenium L. is a perennial herbaceous genus of the family Saxifragaceae, consisting of more than 70 species (Kim et al. 2019; Fu et al. 2020). Species of this genus are mainly distributed in temperate regions of the Northern Hemisphere, and their habitats are shady and humid areas in the mountains (Kim and Kim 2015; Kim et al. 2018; Zhao et al. 2022). Biogeographically, Chrysosplenium is known to have originated in East Asia, and several independent lineages have migrated from East Asia to the New World (Soltis et al. 2001; Deng et al. 2015; Liu et al. 2016).

The genus Chrysosplenium is distinguished from other genera in Saxifragaceae by its tetramerous flowers with petaloid sepals and four or eight stamens (Kim et al. 2018). However, species delimitation is often difficult in this genus because of extensive morphological variations owing to differences in growth periods and habitats (Qin et al. 2018; Kim et al. 2019; Choi et al. 2020). The genus is divided into two sections, Chrysospleniumsect.Alternifolia Franch. and C.sect.Oppositifolia Franch., based on the arrangement of the leaves (Franchet 1890). However, Hara (1957) proposed 17 series because of the high variability in the flower, capsule, and seed traits within each section. The infrageneric classification of Chrysosplenium species is based on several criteria, including leaf arrangement, seed surface, pedicel length, sterile branch position, capsule shape, stem surface, ovary position, stamen length, leaf surface, sepal length, and basal leaf size (Hara 1957; Fu et al. 2020). Several phylogenetic studies on Saxifragaceae genera, including Chrysosplenium, have been performed based on the chloroplast matK region, and their results have shown that C.sect.Oppositifolia and C.sect.Alternifolia are monophyletic (Nakazawa et al. 1997; Soltis et al. 2001; Deng et al. 2015). Recently, several new species have been described based on detailed and comprehensive morphological, molecular, and cytological studies (Liu et al. 2016; Kim et al. 2018, 2019; Wakabayashi et al. 2018; Fu et al. 2020, 2021).

Thirteen Chrysosplenium species belonging to seven series have been recognized in the Korean Peninsula to date (Nakazawa et al. 1997; Kim et al. 2019; Choi et al. 2020; Korea National Arboretum 2021). The following are these 13 species [Chrysospleniumser.Pilosa Maxim.: C.flaviflorum Ohwi, C.epigealum J.W.Han & S.H.Kang, C.ramosissimum Y.I.Kim & Y.D.Kim, C.valdepilosum (Ohwi) S.H.Kang & J.W.Han, C.aureobracteatum Y.I.Kim & Y.D.Kim, C.barbatum Nakai; C.ser.Oppositifolia Maxim.: C.ramosum Maxim.; C.ser.Nepalensia Maxim.: C.grayanum Maxim.; C.ser.Sinica Maxim.: C.sinicum Maxim.; C.ser.Macrostemon H. Hara: C.macrostemon Maxim. ex Franch. & Sav.; C.ser.Alternifolia Maxim.: C.japonicum (Maxim.) Makino, C.serreanum Hand.-Mazz.; C.ser.Flagellifera Maxim.: C.flagelliferum F.Schmidt], and among them, C.aureobracteatum, C.barbatum, C.epigealum, C.flaviflorum, and C.ramosissimum are endemic to Korea (Chung and Kim 1988; Korea National Arboretum 2021; Chung et al. 2023).

During a floristic survey in the southern part of Korea in March 2020, we found a new Chrysosplenium species that is restricted to the southern islands of Korea (Jeju-do and Gageo-do Islands). This species is readily distinguished from previously known Chrysosplenium species in Korea by its greenish-yellow to green bracteal leaves at flowering and a cylindrical papillose seed surface. This species is most similar to C.japonicum (Maxim.) Makino, which belongs to the C.ser.Alternifolia, and is distributed throughout Northeast Asia, including Southeast China, Japan, Korea, Russia (Manchuria), and Taiwan (Nakazawa et al. 1997; Pan and Ohba 2001; Hsu et al. 2011). The new species, however, is clearly distinguishable from C.japonicum by the form of bulbils, color of sepals, number of stamens, and surface of seeds. Based on thorough literature surveys, extensive field observations, detailed analysis of floral morphology and seed coat characteristics, we designated this new species as C.insularis J.E.Jang, K.H.Lee & H.Y.Gil. Here, we provide a detailed morphological description and phylogenetic position of C.insularis and its geographical distribution.

Materials and methods

Material collection

Field surveys were conducted from March 2020 to March 2023. Voucher specimens were deposited at the herbarium of the Korea National Arboretum (KH, http://www.nature.go.kr/kbi/plant/smpl/KBI_2001_030100.do). Materials preserved in 70% ethanol were used to observe and measure the floral parts. Morphological observations and measurements of the new species were conducted on live and dried specimens, including the materials preserved at KH. Quantitative characteristics were measured based on at least 30 samples. The terminology used for description and comparison was referenced from Choi et al. (2020), Pan and Ohba (2001), Lozina (1939), Wakabayashi (2001), Kim et al. (2018), Kim et al. (2019), Fu et al. (2020), Fu et al. (2021).

Microscopic observation

The seed morphology was observed under a stereomicroscope and a scanning electron microscope (SEM). The seeds were measured using a stereomicroscope (Carl Zeiss Microscopy GmbH, Stemi 508, Zeiss, Göttingen, Germany) with an Axiocam ERc 5s. Before SEM imaging, the seeds were dehydrated using 100% ethanol and sputter-coated with gold in a KIC-IA COXEM ion coater (COXEM Co., Ltd., Daejeon, Korea). SEM imaging was performed using a COXEM EM-30 PLUS+ table scanning electron microscope (COXEM) at 20 kV at the Seed Testing Laboratory of KH.

Phylogenetic analysis

Molecular phylogenetic analyses were conducted to confirm the phylogenetic position of the new putative species of Chrysosplenium. Sixteen accessions of four taxa, including the new and related species, were collected from seven localities in South Korea. Total DNA was extracted from silica gel-dried leaves using the DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA) in accordance with the manufacturer’s instructions. The nrDNA region (ITS) and two cpDNA regions (matK, rbcL) were subjected to polymerase chain reaction (PCR) (Choi et al. 2020) on a ProFlex 96-Well PCR System (Applied Biosystems, Foster City, CA, USA). The primers used and their sequences are listed in Table 1. Each reaction mixture contained AccuPower® PCR PreMix (Bioneer, Daejeon, South Korea), ca. 10 ng (1 μL) of genomic DNA, and 100 pM of primers in a total volume of 20 µL. The PCR conditions included an initial denaturation at 94 °C for 5 min, followed by 35 cycles of amplification at 94 °C for 1 min, 54 °C for 1 min, and 72 °C for 1 min, and a final extension at 72 °C for 7 min. The PCR products were visualized on 1% agarose gels and sequenced on an ABI 3730xl DNA analyzer using the ABI BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). The sequences obtained were manually determined and aligned using MAFFT with Geneious Prime® 2022.1.1. (Biomatters Ltd., Auckland, NZ). The DNA sequences generated in this study have been deposited in GenBank and are indicated with an asterisk (*) in the voucher information in Table 2.

Table 1.

Primers used for phylogenetic analysis.

Fragment	Primer	Sequence 5′ → 3′	Reference
ITS	ITS1	TCCGTAGGTGAACCTGCGG	White et al. (1990)
	ITS4	TCCTCCGCTTATTGATATGC
rbcL	rbcL_1F	ATGTCACCACAAACAGAAAC	Fay et al. (1998)
	rbcL_724R	TCGCATGTACCTGCAGTAGC
matK	3F_Kim_F	CGTACAGTACTTTTGTGTTTA	K.J.Kim, pers. comm.
	1R_Kim_R	ACCCAGTCCATCTGGAAATCT

Table 2.

Voucher information and GenBank number of accessions used in this study (*newly generated sequences).

Taxon	Locality	Voucher information	GenBank number
			ITS	rbcL	matK
C.alternifolium	JAPAN: Shimane-ken	DG2019032310003	OK315466	OK315387	OK315343
C.aureobracteatum	KOREA: Gangwon-do, Mt. Gwangdeog	LeeJD et al. 17127-1	MK989508	MK989534	MK989559
	KOREA: Gangwon-do, Mt. Gwangdeog	LeeJD et al. 17127-2	MK989509	MK989533	MK989562
C.barbatum	KOREA: Jeollanam-do, Woldeung-myeon	LeeJD et al. 17008-1	MK989505	MK989538	MK989560
	KOREA: Gyeongsangbuk-do, Mt. Danseok	LeeJD et al. 17020-1	MK989506	MK989536	MK989564
	KOREA: Gangwon-do, Mt. Gwangdeog	LeeJD et al. 17066	MK989507	MK989537	MK989561
C.flagelliferum	KOREA: Gyeongsangbuk-do, Ulleung-gun, Gwanmobong	ESK21-267*	OR809214	PP133187	PP170153
	KOREA: Gyeongsangbuk-do, Ulleung-gun, Gwanmobong	ESK21-268*	OR809215	PP133188	PP170154
	KOREA: Gyeongsangbuk-do, Ulleung-gun, Seonginbong	AP22-025*	OR809213	PP133186	PP170152
	KOREA: Gyeoggi-do, Mt. Cheonma	LeeJD et al. 17014	MK989499	MK989530	MK989585
	KOREA: Gangwon-do, Mt. Cheongtae	LeeJD et al. 17052-1	MK989500	MK989529	MK989583
	KOREA: Gyeongsangbuk-do, Ulleung-do	LeeJD et al. 17122	MK989501	MK989531	MK989584
C.flaviflorum	KOREA: Gangwon-do, Mt. Pokkye	ESK21-182*	OR809216	PP133189	PP170155
	KOREA: Gangwon-do, Mt. Pokkye	ESK21-183*	OR809217	PP133190	PP170156
	KOREA: Gangwon-do, Mt. Pokkye	ESK21-184-1*	OR809218	PP133191	PP170157
	KOREA: Gangwon-do, Mt. Pokkye	ESK21-184-2*	OR809219	PP133192	PP170158
	KOREA: Chungcheongbuk-do, Mt. Gyemyeong	LeeJD et al. 17030	MK989513	MK989542	MK989569
	KOREA: Gyeongsangbuk-do, Mt. Cheonglyang	LeeJD et al. 17039	MK989514	MK989540	MK989567
	KOREA: Gangwon-do, Mt. Chiak	LeeJD et al. 17048	MK989515	MK989541	MK989568
C.grayanum	JAPAN: Hokkaido, Sapporo, Mt. Maruyama	Nakamura 16401	MK989524	MK989554	MK989574
	JAPAN: Hokkaido, Sapporo, Mt. Maruyama	Nakamura 16402	MK989523	MK989553	MK989575
	JAPAN: Hyogo prefecture, Sasayama	Lee JH & JS Shin s. n.	MK989525	MK989551	MK989576
	KOREA: Jeollanam-do, Mt. Cheongtae	LeeJD et al. 17090-1	MK989522	MK989550	MK989579
	KOREA: Jeollanam-do, Mt. Cheongtae	LeeJD et al. 17090-2	MK989520	MK989555	MK989578
	KOREA: Jeollanam-do, Mt. Cheongtae	LeeJD et al. 17090-3	MK989521	MK989552	MK989577
C.griffithii	CHINA	13PXD035	MH809138	MN185317	MN451058
C.insularis	KOREA: Jeju-do, Seogwipo-si, Hogeun-dong	SOK-2022-175*	OR809225	PP133198	PP170164
	KOREA: Jeju-do, Seogwipo-si, Hogeun-dong	J.E.Jang et al. 230322*	OR809226	PP133199	PP170165
	KOREA: Jeollanam-do, Gageodo	K.H.Lee 230514-1*	OR809227	PP133200	PP170166
	KOREA: Jeollanam-do, Gageodo	K.H.Lee 230514-2*	OR809228	PP133201	PP170167
C.japonicum	KOREA: Gyeonggi-do, Mt. Cheonma	J.E.Jang 230325-1*	OR809220	PP133193	PP170159
	KOREA: Gyeonggi-do, Mt. Cheonma	J.E.Jang 230325-2*	OR809221	PP133194	PP170160
	KOREA: Gangwon-do, Wonju-si	S.R.Lee et al. 230420-1*	OR809222	PP133195	PP170161
	KOREA: Gangwon-do, Wonju-si	S.R.Lee et al. 230420-2*	OR809223	PP133196	PP170162
	KOREA: Gangwon-do, Wonju-si	S.R.Lee et al. 230420-3*	OR809224	PP133197	PP170163
	KOREA: Jeollabuk-do, Mt. Chaegye	LeeJD et al. 17022	MK989502	MK989548	MK989586
	KOREA: Chungcheongnam-do, Palbong-myeon	LeeJD et al. 17025-1	MK989504	MK989549	MK989587
C.kamtschaticum	JAPAN: Hokkaido, Sapporo, Mt.Maruyama	Nakamura 16403	MK989516	MK989539	MK989566
C.ramosum	KOREA: Chungcheongbuk-do, Daegang-myeon Goseong	LeeJD et al. 17097-1	MK989517	MK989543	MK989571
	KOREA: Gangwon-do, Mt. Taegi	LeeJD et al. 17147	MK989518	MK989545	MK989573
	KOREA: Gyeongsangbuk-do, Mt. Irwol	LeeJD et al. 17205-1	MK989519	MK989544	MK989572
C.sinicum	KOREA: Jeju-do, Haean-dong	LeeJD et al. 17043	MK989528	MK989557	MK989582
	KOREA: Gangwon-do, Mt. Cheongtae	LeeJD et al. 17051-1	MK989526	MK989556	MK989580
	KOREA: Chungcheongbuk-do, Gagok-myeon	LeeJD et al. 17086	MK989527	MK989558	MK989581
C.valdepilosum	KOREA: Gangwon-do, Mt. Taegi	LeeJD et al. 17053-1	MK989512	MK989535	MK989563
	KOREA: Jeollabuk-do, Mt. Jiri	LeeJD et al. 17057	MK989510	MK989532	MK989565
Peltoboykiniatellimoides	JAPAN: Nagano, Kiso-Fukushima,	Okuyama 035251	AB248847
	CHINA: Zhejiang, Suichang County	XXL170002-1		MZ779205

We also included 32 accessions of 13 Chrysosplenium species deposited in GenBank and selected Peltoboykiniatellimoides (Maxim.) Hara as the outgroup (Soltis et al. 1996). A total of 47 accessions from 14 taxa were used for the phylogenetic analysis. Details of the voucher information and GenBank accession numbers of the species used in this study are provided in Table 2. Phylogenetic analyses were performed using the maximum likelihood (ML) method. For the ML analysis, the best-fit model was identified using ModelFinder in Phylosuite (Kalyaanamoorthy et al. 2017; Zhang et al. 2020). ML phylogenies were inferred using IQ-TREE (Nguyen et al. 2015) under the GTR+ F + R3 model in the ITS regions and the TIM+F+R2 model in the combined chloroplast regions (Minh et al. 2013).

Results and discussion

Taxonomic treatment

. Chrysosplenium insularis

J.E.Jang, K.H.Lee & H.Y.Gil sp. nov.

B5BC1FD3-D041-526D-8B66-D363DFB74D04

urn:lsid:ipni.org:names:77350706-1

Figs 1 , 4A–F

Figure 1.

ChrysospleniuminsularisA habit B bulbils C stem D basal leaf E inflorescence, F bracteal leaves G flower H, I capsule J seed. Photographs by Ju Eun Jang and Kang-Hyup Lee.

Figure 4.

Comparative photographs of the habit (A, G), inflorescence (B, H), bracteal leaves (C, I), surface of bracteal leaves (D, J), and seed (E, F, K, L) of Chrysospleniuminsularis (A–F) and C.japonicum (G–L). Photographs by Ju Eun Jang and Kang-Hyup Lee.

Diagnosis.

Chrysospleniuminsularis differs from C.japonicum in having fairly persistent bulbils, green to yellowish-green sepals, four stamens, and cylindrical papillose seeds.

Type.

Korea • Jeju, Seogwipo-si, Hogeun-dong; 33.25084, 126.54434; elev. 58 m; 25 Mar 2020 [fl]; Kang-Hyup Lee JJ-200325-001 [holotype KH (Fig. 2); isotypes, 3 sheets, KH].

Figure 2.

Holotype of Chrysospleniuminsularis.

Description.

Perennial herbs, hermaphroditic, 5–15 cm tall. Bulbils present near stem base, fairly persistent, pink, turning darkish brown, pilose. Roots fibrous, white. Stems erect, cespitose, light green to green, sparsely hairy, without stolons. Basal leaves of flowering stems 1–6, opposite, simple, estipulate; petiole 3–9 cm long, glabrescent or sparsely hairy; blade reniform, 13–20 mm × 15–25 mm, apex rounded and often retuse, margins dentate to crenate, 13–17 teeth, base cordate, adaxially green, pilose, abaxially pale green, subglabrous. Cauline leaves of flowering stems 1–4, alternate, simple, estipulate; petiole 5–22 mm long, glabrescent or sparsely hairy; blade flabellate to reniform, 7–12 mm × 11–18 mm, apex retuse and often rounded or obtuse, margins dentate to crenate, 9–13 teeth, base cordate to broadly cuneate, adaxially green, pilose, abaxially pale green, subglabrous. Inflorescences terminal, 6–14 flowered cyme, surrounded by leaf-like bracts; peduncles 4.59–18.54 mm long; pedicels 0.5–1.5 mm long, sparsely pilose; bracteal leaves by inflorescence 3, petiole 0.2–4.7 mm long, glabrescent or sparsely hairy; blade subflabellate to orbicular, 2–18 × 2–14 mm, apex truncate and often retuse, margins dentate to crenate, 5–9 teeth, base broadly cuneate to subcordate, adaxially green, sparsely pilose to glabrescent, abaxially pale green, subglabrous. Flowers 4-merous, actinomorphic; sepals petaloid 4, free, erect to subspreading, ovate to broadly ovate, 1.2–2.1 × 1.5–3.1 mm, apex obtuse or rounded, yellowish green to green, glabrous; stamens 4; filaments narrow conical, 0.3–0.4 mm long; anther 0.2 mm long, yellow; pistil 2-carpellate, semi-inferior; ovary 1-locular; styles 2, free, erect, 0.2–0.3 mm long; stigma round; disc present. Capsules 2-lobed, horn shaped, lobes subequal, 2.8–3.7 × 3.8–5.2 mm long, green, glabrous, dehiscent along the adaxial suture. Seeds numerous, ovoid-ellipsoid, 0.7–0.9 × 0.5–0.6 mm, brown to dark brown, cylindrical papillose on smooth surfaces.

Phenology.

Flowering and fruiting from March to May.

Distribution and habitat.

Southern coastal regions of Korea (Jeju-do and Gageo-do Islands). Forests, wet places in forests, shaded places on the riverside (Fig. 3).

Figure 3.

Distribution map of Chrysospleniuminsularis and C.japonicum in Korea (revised from Oh et al. 2016).

Etymology.

The specific epithet “insularis” refers to its distribution on islands.

Vernacular name.

Island golden saxifrage: Seom-gwaeng-i-nun (섬괭이눈).

Morphological assessment.

Among the species distributed in Korea, Chrysospleniuminsularis is morphologically similar to C.japonicum in terms of leaf arrangement, leaf margin, and bracteal leaf color. Despite these similarities, it is clearly differentiated by the form of bulbils [present, fairly persistent (Fig. 1B) vs. present], surface of bracteal leaves [adaxially sparsely pilose to glabrescent, abaxially subglabrous (Fig. 4D) vs. mainly glabrous (Fig. 4J)], color of sepals [green to yellowish green vs. yellowish green to yellow], number of stamens [4 vs. usually 8], and surface of seeds [cylindrical papillose (Fig. 4E, F) vs. papillose (Fig. 4K, L)]. Additionally, this new species is morphologically similar to C.alternifolium, which is distributed in northern Eurasia, but is distinguished by the following characteristics: stolon (absent vs. present), color of bracts (green vs. yellow), color of sepals (green to yellowish green vs. golden yellow), number of stamens (4 vs. 8), and surface of seeds [cylindrical papillose (Fig. 4E, K) vs. smooth (Fig. 4K, L)]. A comparison of the major characteristics of the new species with those of two closely related species, C.japonicum and C.alternifolium, is shown in Table 3.

Table 3.

Major characteristics of Chrysospleniuminsulalis and two closely related taxa (*: data from Lozina 1939; -: none known).

Character		C.insulalis	C.japonicum	C.alternifolia*
Bulbils		present, fairly persistent	present	-
	color	pink, turning to darkish brown	pink	-
Stolon		absent	absent	present
Bracteal leaves	color	green	yellowish green	yellow
	surfaces	adaxially sparsely pilose to glabrescent, abaxially subglabrous	mainly glabrous	mainly glabrous
Sepals	color	green to yellowish green	yellowish green to yellow	golden yellow
Stamens	number	4	usually 8	8
Seeds	surfaces	cylindrical papillose	papillose	smooth
Fl. and fr.		Mar. to May	Apr. to Jun.	Apr. to Jul.

Phylogenetic analysis.

In total, 48 sequences of three regions (ITS, matK, and rbcL) were newly obtained from the 16 accessions of Chrysospleniuminsularis and the three related taxa. We also used 93 sequences from 32 accessions obtained from GenBank (12 species of Chrysosplenium and one Peltoboykiniatellimoides as an outgroup) for the phylogenetic analysis. The aligned matrix of the ITS region and combined chloroplast regions (matK and rbcL) contained 635 and 1407 characters, respectively. We found 242 variable sites and 193 parsimony-informative sites in the ITS regions, whereas 172 variable sites and 104 parsimony-informative sites were found in the combined chloroplast regions. The GC ratios were 46.2% and 37.4% for the ITS and combined chloroplast regions, respectively. The phylogenetic tree (Fig. 5) revealed a topology similar to that obtained in a previous study (Choi et al. 2020). The phylogenetic results showed some topological incongruence between the ITS and combined CP trees. In the ITS tree, the most basal clade (BS = 100%) included the monophyletic C.grayanum and C.sinicum and showed a sister relationship with other Chrysosplenium species. However, the CP tree was divided into two clades, with C.grayanum and C.sinicum sharing the most common ancestors with the C.ser.Pilosa, C.kamtschaticum, and C.ramosum (BS = 94%). The phylogenetic relationships among the three subclades were not fully resolved, and the C.ser.Pilosa. was not monophyletic, embedding C.kamtschaticum. Furthermore, the series Alternifolia was monophyletic in the CP tree but not in the ITS tree. Both trees strongly supported the monophyly of C.insularis (BS = 95% in ITS, BS = 96% in CP), and it shared the most common ancestor with C.alternifolium distributed in Japan (BS = 98% in ITS, BS = 77% in CP). The phylogenetic trees revealed that C.insularis formed an independent monophyletic clade from closely related taxa (i.e., C.japonicum and C.alternifolium), suggesting the newly recognized species of Chrysosplenium (Fig. 5).

Figure 5.

Phylogenetic tree of Chrysospleniuminsularis and related taxa based on ITS regions and combined CP regions (matK and rbcL) A ITS region B combined CP regions (matK and rbcL). The numbers above the branches are bootstrap values (BS > 50%) by the maximum likelyhood method. Newly generated sequences in this study are shown with an asterisk, and the new species are marked with a red box. The voucher information of all samples used in the analysis is indicated after the scientific names.

Additional specimens examined.

Chrysospleniuminsularis (Paratypes): Korea • Jeonnam, Sinan-gun, Heuksan-myeon, Gageodo-ri; 14 May 2023; K.H.Lee 230514-1 (KH). • Jeju, Seogwipo-si, Hogeun-dong; 28 Apr. 2020; PBK0118-001 (KH). • Jeju, Seogwipo-si, Hogeun-dong; 22 Mar. 2022; Hanon-220322-011 (KH) • Jeju, Seogwipo-si, Hogeun-dong; 22 Mar. 2023; J.E.Jang et al. 230322-1 (KH).

Chrysospleniumjaponicum: Korea • Gyeonggi, Gwangju-si, Chowol-eup, Mugap-ri, Mugapsan; 24 Apr. 2007; HNHM-A-158 • Gwangju-si, Toechon-myeon, Cheonjinam; 7 Apr. 2000; KNAH014041 • Gwangju-si, Toechon-myeon, Usan-ri, Aengjabong; 11 Apr. 2004; kjs040141 (KH) • Incheon-si, Ongjin-gun, Jawoldo Isl.; 8 Apr. 2009; NAPI-2009-1214 (KH) • Incheon-si, Ongjin-gun, Deokjeok-myeon, Mungap-ri, Gitdaebong; 9 Apr. 2014; Park140230 (KH) • Incheon-si, Ganghwa-gun, Ganghwado Isl.; 20 Apr. 2006; LeeGH6-35 (KH) • Gyeonggi, Namyangju-si, Onam-eup, Cheonmasan; 17 Apr. 2009; ParkSH90273 (KH) • Gyeonggi, Namyangju-si, Onam-eup, Palhyeon-ri; 25 May 2023; J.E.Jang 230325-1 (KH) • Gyeonggi, Namyangju-si, Joan-myeon, Ungilsan; 11 Apr. 2009; Y.M.Kang s.n. (KH) • Gyeonggi, Gwacheon-si, Makgye-dong, Cheonggyesan; 8 Apr. 2006; KHUS20110475 (KH) • Gangwon, Pyeongchang-gun, Yongpyeong-myeon, Jaesan-ri, Geumdangsan; 17 Apr. 2012; JSY120434 (KH) • Jeongseon-gun, Imgye-myeon; 23 Apr. 2011; 0307013 (KH) • Gangwon, Taebaek-si, Hasami-dong, Deokhangsan; 23 Apr. 2005; kjs050052 (KH) • Gangwon, Wonju-si, Panbu-myeon, Geumdae-ri; 20 Apr. 2023; S.R.Lee et al. 230420-1 (KH) • Chungbuk, Danyang-gun, Danyang-eup, Suchon-ri, Sobaeksan; 17 Apr. 2005; Sobaeksan-050417-070 (KH) • Chungbuk, Chungju-si, Sotae-myeon, Boktan-ri; 12 Apr. 2012; Namhan-548 (KH) • Gyeongbuk, Gunui-gun, Bugye-myeon, Dongsan-ri, Palgongsan; 22 Apr. 2006; CBU-070308 (KH) • Gyeongbuk, Bonghwa-gun, Myeongho-myeon, Bugok-ri, Cheongnyangsan; 27 Mar. 2006; CBU-070519 (KH) • Chungbuk, Cheongsong-gun, Hyeonseo-myeon, Bohyeonsan; 22 Apr. 2006; K.O.Yoo s.n. (KH) • Jeonbuk, Namwon-si, Ayeong-myeon, Gusang-ri, Bonghwasan; 1 May 2007; HNHM-A-283 (KH).

Key to the species of Chrysosplenium in South Korea modified from Choi et al. (2020)

1a	Cauline leaves alternate	2
2a	Leaves heterophyllous; sterile branches developed; caluline and bracteal leaves 2–5 lobed	C.flagelliferum
2b	Leaves isophyllous; sterile branch absent; cauline and bracteal leaves not lobed with 8–12 teeth	3
3a	Sepals green; stamens 4	C.insularis
3b	Sepals yellowish green or golden yellow; stamens 8	4
4a	Stolons present; sepals golden yellow; seed surface smooth	C.alternifolium
4b	Stolons absent; sepals yellowish green; seed surface papillose	C.japonicum
1b	Cauline leaves opposite	5
5a	Sepals green, spreading; capsules cup-shaped	C.ramosum
5b	Sepals yellow, erect; capsules horn-shaped	6
6a	Plants glabrous	7
7a	Stamens 4 (-6); cylindrical papillae with roundish head at the tip on smooth seed	C.grayanum
7b	Stamens 8; cylindrical papillae with truncate tip on scabrous seed surfaces	8
8a	Sterile branches present; plant glabrous except petiole of sterile branches; stamens shorter than the sepals	C.sinicum
8b	Sterile branches absent; plant glabrous; stamens longer than the sepals	C.macrostemon
6b	Plants pubescent	9
9a	Seeds without tubercules	10
10a	Leaves of sterile branches congested at the distal end, with white variegated veins on the upper surface	C.flaviflorum
10b	Leaves of sterile branches distantly arranged, with silvery dotted upper surface	C.epigealum
9b	Seeds with tubercules	11
11a	Seed tubercles arranged on inconspicuous longitudinal ridges	12
12a	Sterile branches highly branched, ca. 30 cm long after fruiting; leaves of sterile branches with silvery dots, upper surface glabrous; bracteal leaves yellowish-green	C.ramosissimum
12b	Sterile branches unbranched, less than 15 cm long after fruiting; leaves of sterile branches without silvery dots, upper surface pilose; bracteal leaves bright yellow	C.valdepilosum
11b	Seed tubercles arranged on prominent longitudinal ridges	13
13a	Leaves of sterile branches distantly arranged after fruiting; bracteal leaves golden yellow, greenish yellow at flowering	C.aureobracteatum
13b	Leaves of sterile branches congested at the distal end after fruiting; bracteal leaves green at flowering	C.barbatum

Citation

Jang JE, Park BK, Lee K-H, Kim H-J, Gil H-Y (2024) Description and phylogenetic position of a new species, Chrysosplenium insularis J.E.Jang, K.H.Lee & H.Y.Gil (Saxifragaceae), from the southern islands of South Korea. PhytoKeys 248: 91–104. https://doi.org/10.3897/phytokeys.248.131291

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This study was financially supported by the research projects of the Korea National Arboretum [KNA 1-1-13, 14-1].

Author contributions

Conceptualization: KL. Resources: BKP. Visualization: KL, BKP, and JEJ. Supervision: HG. Writing the original draft: JEJ. Writing, review, and editing: JEJ, KL, HK, and HG.

Author ORCIDs

Ju Eun Jang https://orcid.org/0000-0002-6229-8477

Beom Kyun Park https://orcid.org/0000-0003-1894-3296

Kang-Hyup Lee https://orcid.org/0000-0002-7189-3235

Hyuk-Jin Kim https://orcid.org/0000-0002-3177-2914

Hee-Young Gil https://orcid.org/0000-0003-3714-0827

Data availability

All of the data that support the findings of this study are available in the main text.