Effectiveness of co-cultured Myristica fragrans Houtt. seed extracts with commensal Staphylococcus epidermidis and its metabolites in antimicrobial activity and biofilm formation of skin pathogenic bacteria

Abstract

Background

Skin commensal bacteria (Staphylococcus epidermidis) can help defend against skin infections, and they are increasingly being recognized for their role in benefiting skin health. This study aims to demonstrate the activities that Myristica fragrans Houtt. seed extracts, crude extract (CE) and essential oil (EO), have in terms of promoting the growth of the skin commensal bacterium S. epidermidis and providing metabolites under culture conditions to disrupt the biofilm formation of the common pathogen Staphylococcus aureus.

Methods

The culture supernatant obtained from a co-culture of S. epidermidis with M. fragrans Houtt. seed extracts in either CE or EO forms were analyzed using gas chromatography-mass spectrometry (GC-MS) and liquid chromatography tandem mass spectrometry (LC-MS/MS), in silico investigations, and applied to assess the survival and biofilm formation of S. aureus.

Results

The combination of commensal bacteria with M. fragrans Houtt. seed extract either CE or EO produced metabolic compounds such as short-chain fatty acids and antimicrobial peptides, contributing to the antimicrobial activity. This antimicrobial activity was related to downregulating key genes involved in bacterial adherence and biofilm development in S. aureus, including cna, agr, and fnbA.

Conclusion

These findings suggest that using the culture supernatant of the commensal bacteria in combination with CE or EO may provide a potential approach to combat biofilm formation and control the bacterial proliferation of S. aureus. This may be a putative non-invasive therapeutic strategy for maintaining a healthy skin microbiota and preventing skin infections.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12906-024-04675-z.

Background

The human skin microbiome comprises a diverse range of commensal microorganisms, including bacteria, fungi, viruses and archaea [1]. One of the common commensal bacteria found on the human skin is Staphylococcus epidermidis, which helps to maintain health-associated skin microbiota, protecting against infections by producing antimicrobial agents [2]. S. epidermidis has also been shown to produce antimicrobial peptides (AMPs) that kill competing pathogens [3], particularly the well-known bacterial pathogen Staphylococcus aureus, which is a causative agent of numerous infectious diseases, representing a significant public health burden [4, 5]. This organism also produces biofilms associated with chronic infections and antimicrobial resistance [6]. However, commensal S. epidermidis is able to disrupt S. aureus biofilm formation through the production of small molecules with anti-biofilm activity, thereby providing a potential therapeutic alternative for combatting drug-resistant bacteria [6]. Given that the currently available antibiotics are becoming increasingly ineffective against them [7], novel antimicrobial agents, including bacteriophages, microbiome-modulating agents, antibodies, and immunomodulating agents, may provide novel therapeutic alternatives [8].

Currently, AMPs possess certain unique characteristics, including the rapid killing of target cells, broad-spectrum activity against antibiotic-resistant pathogens, and their relative difficulty in selecting resistant mutants in vitro. They have been proposed as potent candidates for a novel class of antibiotics [9]. The physicochemical properties that determine the activity of AMPs include their length [10], net charge [11], helicity [12], hydrophobicity, amphipathicity, and solubility [13–15]. The majority of antibacterial peptides are cationic AMPs, which target cell membranes, causing a breakdown of the lipid bilayer structure. These AMPs inhibit important pathways, including the DNA replication, RNA and protein synthesis pathways, and biofilm formation in both Gram-positive and Gram-negative bacteria [15, 16]. Short-chain fatty acids (SCFAs) possess antimicrobial activity, and inhibit bacterial competitors. The most important SCFAs are acetate, propionate, butyrate, isobutyrate and isovalerate, found as fermentation metabolites in Cutibacterium acnes and S. epidermidis isolates [17, 18].

Myristica fragrans Houtt. (nutmeg), a fruit that has been used as a traditional medicine for centuries in various Asian countries, is natively found in the Maluku Province of Indonesia [19, 20]. Different parts of the plant have been used in traditional medicine to cure a range of diseases, including diarrhea, mouth sores and insomnia [21]. The vendors of herbal remedies, healers and midwives have served as the primary sources of information regarding the description of the fruit and seed, as well as their medicinal properties. That study also revealed how M. fragrans is still utilized for culinary and medicinal purposes in its area of origin [21]. The major products of M. fragrans, nutmeg and mace, are increasingly being used in the cosmetics and pharmaceutical industries [22]. The main constituents of M. fragrans are alkylbenzene derivatives, terpenes, α-pinene, β-pinene, myristic acid and trimyristin. Nutmeg contains approximately 10% essential oil (EO), which is mostly composed of terpene hydrocarbons, terpene derivatives and phenylpropanoids [23, 24]. The pharmacological potential of M. fragrans crude extract (CE) and various organic chemical extracts has been reviewed and published by several different research groups. These studies reported on their various antimicrobial, antioxidant, antiinflammatory, antiparasitic, aphrodisiac and hepatoprotective properties [19, 21, 25–28]. However, to the best of the authors’ knowledge, there is a relative lack of studies that have explored the effects of secondary metabolites produced by commensal bacteria co-cultured with M. fragrans on the human skin microbiome. Therefore, the present study aimed to investigate the potential benefits and efficacy of secondary metabolites obtained from M. fragrans seed extracts (CE and EO), which were co-cultured with commensal S. epidermidis, on the prevention of biofilm formation by pathogenic S. aureus of human skin.

Materials and methods

Preparation of nutmeg seed extracts (CE and EO)

CE and EO were obtained from nutmeg seeds, as previously described in our study from 2021 [29]. Briefly, nutmeg seeds were extracted using a maceration technique to obtain the CE, and a hydrosteam distillation method was employed to obtain the EO [30]. For CE extraction, a fine powder of nutmeg mixed with acetone was added to the flask for 72 h at room temperature. After filtering, the supernatant was subsequently dried and stored at -20 °C until further use. The extraction of EO was performed using the Clevenger apparatus (PYREX, Germany) and stored in sterile vials. After filtering the EO through anhydrous sodium sulfate (Na₂SO₄, KemAus, NSW, Australia), it was collected in tightened vials and kept at 4 °C until further use.

Bacterial strains

The bacterial strains used in the present study included S. aureus ATCC 29213, a pathogenic strain, and S. epidermidis ATCC 35984, a commensal strain, both obtained from the Division of Clinical Microbiology, Faculty of Associated Medical Sciences, Khon Kaen University, Thailand. Bacteria strains were sub-cultured on Mueller Hinton agar (MHA) (HiMedia Leading BioSciences, Mumbai, India) and incubated for 24 h at 37 °C. Following the incubation on agar, single colonies from the plate were injected into separate tubes containing sterile Mueller Hinton broth (MHB) (HiMedia Leading BioSciences, Mumbai, India) and cultured at 37 °C for 24 h.

Antimicrobial activity of nutmeg seed extracts

The antimicrobial efficacy of CE or EO was evaluated using minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) tests on S. aureus ATCC 29213 and S. epidermidis ATCC 35984 in MHB. The tests were performed according to the recommendations of the Clinical & Laboratory Standards Institute [31]. Serial two-fold dilutions of CE (concentrations ranging from 8000 to 15.6 µg/mL) or EO (50–0.09%, v/v) in 5% DMSO were utilized in 96-well microtiter plates, with bacterial concentrations adjusted to a final inoculum size of 5 × 10⁵ colony forming units (CFU/mL). The control contained ampicillin for positive and inoculated broth only for negative and was incubated at 37 °C for 24 h. MIC endpoints were determined as the lowest concentrations of either CE or EO that elicited no visible growth in the 96-well microplate. The MBC values were measured by subculturing the broths used for MIC determination (i.e. those that showed no visible bacterial growth), seeding them on to MHA plates, and incubating the bacterial cells for 24 h at 37 °C. The MBC endpoint was considered to be the concentration at which 99.9% of the bacterial population was killed in the presence of the lowest concentration of CE or EO. All experiments were performed in triplicate.

Effects of CE and EO on commensal S. epidermidis growth

The impact of CE and EO on the growth of S. epidermidis cells was assessed using the plate count method [32]. The bacterial cultures were prepared in MHB with a McFarland standard of 0.5, obtaining a bacterial suspension concentration of 10⁸ CFU/mL, and then used as the bacterial starter cultures. Afterwards, a 96-well microplate was seeded with an S. epidermidis inoculum of 5 × 10⁵ CFU/mL, and two-fold serial dilutions were performed, of CE with different concentrations ranging from 2.438 to 78.016 µg/mL (1/1024 MIC to 1/32 MIC), and of EO with those 0.048–1.536%, v/v (1/256 MIC to 1/8 MIC). The control group was inoculated with MHB alone, followed by incubation at 37 °C for 24 h. Finally, the viability of S. epidermidis was determined using the plate count method, with triplicates for each concentration of CE or EO.

Measurement of secondary metabolites in the cell-free supernatant (CFS) derived from co-cultures of CE or EO with S. epidermidis

SCFA analysis using gas chromatography-mass spectrometry (GC–MS)

S. epidermidis cells were cultured in trypticase soy broth (TSB) (HiMedia Leading BioSciences, Mumbai, India) with either CE (1/1024 MIC) or EO (1/256 MIC) at 37 °C for 24 h. The broth was centrifuged for 5 min at 3578×g and 4 °C to collect the supernatant, which was subsequently filtered using a sterile syringe and a 0.22 μm pore size sterile Millipore^® polyethersulfone membrane filter (MilliporeSigma, Darmstadt, Germany). The CFS obtained from CE-treated S. epidermidis was defined as CFS: T-1, whereas that from EO-treated S. epidermidis was defined as CFS: T-2. GC-MS was used to analyze the production of SCFAs using an HP-5 ms ultrainert capillary column (30 m×0.25 mm, i.d.×0.25 µL film thickness HP-5 ms column; Agilent Technologies, CA, United States). The helium carrier gas flow rate was set at 1.0 mL/min, and the oven temperature was maintained at 70 °C for 1 min after injection, with subsequent programming to 25 °C/min and 290 °C, at which the column was maintained for 13.2 min. The split ratio was 1:4, and the mass detector electron ionization voltage was 70 eV. Finally, the identification of volatile compounds was performed using a mass spectral library search, and compared with the mass spectral data from the literature.

Classification of peptides using liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis

In the present study, peptides derived under the five investigated sample conditions i.e., (i) CE; (ii) EO; (iii) CFS of S. epidermidis-only; (iv) CFS: T-1 (see above for definition) and (v) CFS: T-2, were classified. The total peptide concentrations were determined using the Bradford protein assay (BioRad Laboratories, California, United States). Then, five micrograms of total protein was mixed with a solution containing 40% acrylamide/bisacrylamide, 1.5 M Tris-HCl (pH 8.8), 10% SDS, 10% ammonium persulfate, and tetramethylethylenediamine (TEMED). After a 5-minute incubation at room temperature, the gel formed, and the pieces were dehydrated in 100% acetonitrile. They were then reduced with 5 mM DTT in 10 mM ammonium bicarbonate (AMBIC) and alkylated with 15 mM iodoacetamide (IAA) in 10 mM AMBIC. Tryptic digestion was performed overnight at 37 °C. The digested peptides were extracted, dried, and stored at − 80 °C according to Roytrakul et al. [33].

The peptides were analyzed using an Ultimate 3000 Nano/Capillary LC System (Thermo Fisher Scientific) coupled with a ZenoTOF 7600 mass spectrometer (SCIEX). The samples were enriched on a µ-Precolumn C18 PepMap 100 (300 μm i.d. × 5 mm, 5 μm, 100 Å) and separated on a 75 μm I.D. × 15 cm Acclaim PepMap RSLC C18 column (2 μm, 100 Å). Solvent A (0.1% formic acid in water) and Solvent B (0.1% formic acid in 80% acetonitrile) were used in the analytical column. A gradient of 5–55% Solvent B at 0.3 µl/min over 30 min was used to elute the tryptic peptides. DDA method selection of the top, most abundant top 50 precursor ions per survey MS1 for MS/MS at an intensity threshold exceeding 150 cps. Sampled precursor ions were dynamically excluded for 12 s after two incidences of MS/MS sampling occurrence (MS/MS sampling with dynamic CE for MS/MS enabled). The MS2 spectra were collected from 100 to 1,800 m/z with a 50-ms accumulation time and Zeno trap enabled. The raw mass spectral data were processed using MaxQuant software (version 2.1.4.0) for peptide quantification and identification. Finally, the identified peptides in each group were classified via the construction of a Venn diagram [34]. Each sample was performed in triplicate to ensure the accuracy of the results. The MS/MS raw data and analysis have been deposited in the ProteomeXchange Consortium via the jPOST partner repository with the data set identifier JPST003351 and PXD055409 (https://repository.jpostdb.org/preview/100406378266d46f20562a7, Access key 2102).

In silico analysis of biological activity

The biological activity of the peptides from the CFS: T-1 and CFS: T-2 cultured with S. epidermidis against different types of microorganisms was predicted using multiple online servers (accessed on 16 January, 2024). To determine the antimicrobial activity, the online server CAMPR3 (http://www.camp3.bicnirrh.res.in/prediction.php; accessed on 16 January, 2024) was used with the prediction option, random forest (RF). A peptide sequence was predicted to be antimicrobial if the probability score was ≥ 0.5. This score provides a balance between sensitivity and specificity in the predictions [35]. The helicity region of the peptides was analyzed using the online server HeliQuest (https://heliquest.ipmc.cnrs.fr/cgibin/ComputParams.py; accessed on 16 January, 2024), which also provided a visual representation of the results. The algorithm examines whether a segment contains an uninterrupted hydrophobic face, which is composed of at least five hydrophobic residues adjacent when represented on a helical wheel. This server was also able to calculate the hydrophobic moment, denoted by the symbol ‘H’ (<µH>), which ranged from 0 to 3.26. A high value for < µH > indicated that the helix was amphipathic in the direction that is perpendicular to its axis.

Effect of CFS: T-1 and CFS: T-2 on S. aureus

Viability of S. aureus

In the present study, four experimental groups were established, according to the following conditions: (i) co-culture of S. aureus with CFS of S. epidermidis alone, (ii) co-culture of S. aureus with CFS: T-1, (iii) co-culture of S. aureus with CFS: T-2, and (iv) culture of S. aureus alone. The culture of S. aureus alone was used as a control. The bacteria were allowed to grow in MHB with a McFarland standard of 0.5 for subsequent experiments. A cell suspension containing approximately 1 × 10⁸ CFU/mL S. aureus cells in MHB was seeded into a sterile 96-well plate at 37 °C for 24 h under the various conditions, as described above. The inhibitory ability was subsequently evaluated by calculating the viability of the S. aureus bacteria using the plate count method [32].

Biofilm eradication assay

The crystal violet method was used to perform the biofilm removal assay on S. aureus, as described by Yu et al. [36]. To evaluate the effectiveness of CFS: T-1, CFS: T-2, and CFS alone in removing preexisting biofilm activity, 100 µL of S. aureus (10⁸ CFU/mL) was cultured in TSB containing 4% (w/v) glucose and 1% (w/v) sodium chloride in a sterile 96-well plate. The plate was subsequently incubated at 37 °C for 24 h to allow the attachment and growth of the biofilm. Following the incubation, nonadherent cells were removed from each well, and the adhered biofilm was rinsed once with 1% phosphate-buffered saline. Subsequently, 100 µL of the treatment mixture containing CFS: T-1, CFS: T-2, and CFS alone in TSB was applied to the respective wells, whereas the control wells were S. aureus cultured alone. The plate was further incubated at 37 °C for 24 h. Finally, the biofilm was assessed using crystal violet staining, and the eradication levels were determined by measuring the absorbance at 585 nm.

Relative gene expression using reverse transcription-quantitative real-time PCR (qRT-PCR) analysis

To investigate the effect of CFS: T-1 and CFS: T-2 on the expression levels of genes involved in biofilm formation and the dispersal of S. aureus. The bacterial cells were harvested after 24 h of incubation, and RNA was extracted using TRIzol™ Reagent assay (Invitrogen, Waltham, MA, USA), following the method provided in a previous study [29]. The purity of the RNA was then assessed by measuring the ratio of absorbance at 260 nm to that at 280 nm, and the values obtained for the ratio were within the range of 1.8–2.0. Following RNA extraction, cDNA synthesis was performed using Maxime™ RT PreMix (iNtRON Biotechnology DR, Gyeonggi-do, Korea), following the manufacturer’s protocol. The oligonucleotide primers necessary for the detection of 16S rRNA and the fnbA, fnbB, icaA, icaD, agr, and cna genes were synthesized by Ward Medic Ltd., Thailand and their sequences are shown in Table 1. qRT-PCR was performed using SsoAdvanced Universal SYBR Green Supermix (2X; cat no. 10000076382; BioRad Laboratories, CA, United States), following the manufacturer’s protocol. An Applied Biosystems^® PCR instrument (a QuantStudio™ 6 Flex RealTime PCR System; Thermo Fisher Scientific, Singapore) was used to perform qPCR. The annealing temperatures of cna, agr, and fnbA primers were set at 58 °C. The amplification products were confirmed using specific melting curve analyses. The relative expression of genes was calculated using the 2^∆∆Ct formula where 16S rRNA was used as an internal control gene, and the S. aureus growth-only condition was used as the reference. Each experiment was performed in triplicate.

Table 1.

List of the oligonucleotide sequences used in this study along with their references

Genes	Primer sequences (5′-->3′)	References
16S rRNA	Forward: CCTGGCTCAGGATGAACG Reverse: AATCATTTGTCCCACCTTCG	[37]
fnbA	Forward: GATACAAACCCAGGTGGTGG Reverse: TGTGCTTGACCATGCTCTTC	[38]
fnbB	Forward: TGTGCTTGACCATGCTCTTC Reverse: AGTTGATGTCGCGCTGTATG	[38]
icaA	Forward: TCTCTTGCAGGAGCAATCAA Reverse: TCAGGCACTAACATCCAGCA	[39]
icaD	Forward: ATGGTCAAGCCCAGACAGAG Reverse: CGTGTTTTCAACATTTAATGCAA	[39]
agr	Forward: ATGCACATGGTGCACATGCA Reverse: CATAATCATGACGGAACTTG	[37]
cna	Forward: AAAGCGTTGCCTAGTGGAGA Reverse: AGTGCCTTCCCAAACCTTTT	[38]

Statistical analysis

All experiments were repeated independently three times in triplicate, and the data are expressed as the mean ± standard deviation. Data were analyzed using a one-way analysis of variance (ANOVA) with Dunnett’s post-hoc test (for comparison of > 2 groups) or Student’s ttest (comparison of 2 groups) with GraphPad Prism software (version 7.04; Dotmatics). P < 0.05 was considered to indicate a statistically significant value.

Results

Antimicrobial activity of nutmeg seed extracts

The antimicrobial activities of CE and EO derived from nutmeg seeds in terms of MIC and MBC were investigated on the pathogenic bacterium S. aureus ATCC 29213 and on the commensal bacterium S. epidermidis ATCC 35984. Table 2 shows the different susceptibilities of these two bacterial strains to the CE and EO extracts. The antibacterial activity against S. aureus was found to be greater compared with that against S. epidermidis, with inhibition occurring at concentrations of 1250 µg/mL and 0.39% (v/v) for CE and EO, respectively. These results indicated that both CE and EO had the potential to inhibit and kill pathogenic S. aureus, although they were both less effective against commensal S. epidermidis at the same concentration. Evaluation of the growth-promoting activity of the CE and the EO on commensal S. epidermidis by the viability cell counting method revealed that the growth of S. epidermidis was promoted up to 10⁸ CFU/mL when cultured with the final concentrations of 2.438 µg/mL CE (1/1024 MIC) and 0.048%, v/v EO (1/256 MIC) as compared with the S. epidermidis culture alone condition (Fig. 1).

Table 2.

MIC and MBC values of CE and EO derived from nutmeg seeds against S. aureus and S. epidermidis

Bacterial groups	Bacterial strains	CE (µg/mL)		EO (%, v/v)
		MIC	MBC	MIC	MBC
Pathogenic	S. aureus ATCC 29213	1250	2500	0.39	0.78
Commensal	S. epidermidis ATCC 35984	2500	> 8000	12.50	25.00

CE, crude extract; EO, essential oil; MIC, minimal inhibitory concentration; MBC, minimal bactericidal concentration

Fig. 1.

Effect of nutmeg seed CE and EO on commensal S. epidermidis growth. Growth promoting activities of CE (µg/mL) and EO (%, v/v) on commensal S. epidermidis are shown. The viability of S. epidermidis is shown, as cultured with various concentrations of (A) CE (2.438–78.016 µg/mL or 1/1024 MIC to 1/32 MIC) and (B) EO (0.048–1.536% or 1/256 MIC to 1/8 MIC). The viable cell count (log CFU/mL) was determined by culturing the bacteria with various concentrations of CE (1/1024 MIC to 1/32 MIC) and EO (1/256 MIC to 1/8 MIC). The results are presented as the mean ± standard deviation of three biological replicates. Statistical analysis was performed using one-way analysis of variance (ANOVA), with significant values of P (P ≤ 0.05) measured against the control. The symbols used to indicate statistically significant differences are: P < 0.05 (^*), P < 0.01 (^**) and P < 0.001 (^***). CFU, colony forming units; CE, crude extract; EO, essential oil

SCFA production derived from commensal S. epidermidis co-cultured with nutmeg seed extracts

GC-MS analysis of the CFS produced by S. epidermidis co-cultured with CE or EO led to the detection and quantification of SCFA profiles. The identified SCFAs were formic acidbutyl ester, acetic acidbutyl ester, acetic acid, lactic acidbutyl ester, propanoic acid, butanoic acid, and 3methyl butanoic acid, and their levels were expressed as percentages of the peak area (Fig. 2). The data indicated that the production of acetic acidbutyl ester, acetic acid and lactic acidbutyl ester was higher than that of the other SCFAs in both the CFS: T-1 and CFS: T-2 treatment groups. These experiments demonstrated that these three compounds may have the potential to disrupt S. aureus biofilm formation, and this potential was associated with their antibacterial activity.

Fig. 2.

SCFA production derived from commensal S. epidermidis co-cultured with nutmeg seed extracts. SCFA profiles of CFS produced by S. epidermidis treated with CE (CFS: T-1) and EO (CFS: T-2) are shown, with detection and quantification via GC-MS analysis. SCFA, short-chain fatty acid; CE, crude extract; EO, essential oil; CFS, cell-free supernatant

Classification and identification of peptides using LC-MS/MS analysis combined with the bioinformatic tool “Heliquest”

Peptide sequence identification was performed using LC-MS/MS analysis. The total number of detected peptides for each condition was categorized by constructing a Venn diagram (Fig. 3A). The peptides were classified into four groups: 25 peptides in the CE-only group (Fig. 3B), 28 peptides in the CFS: T-1 group (Fig. 3C), 31 peptides in the EO-only group (Fig. 3D), and 17 peptides in the CFS: T-2 group (Fig. 3E). Initially, the antimicrobial activity of the peptides was predicted using the online server CAMPR3 with the prediction option RF (accessed on 16 January, 2024). A peptide sequence with a probability score of ≥ 0.5 was predicted to possess antimicrobial properties. Consequently, each peptide segment was analyzed to predict its biological properties using the HeliQuest server (accessed on 16 January, 2024). Helical wheel projection of the identified AMPs revealed the net charge ranged from + 2 to + 3, with a hydrophobic moment, <µH>, of 0.138–0.666 (Fig. 4). However, only peptide Sequence 5 (Seq5; sequence: KKLIVGLLGITLLLTACNTK) contained the hydrophobic face (LGCILLL), which was oriented towards the hydrophobic core of the peptide, as shown in Table S1.

Fig. 3.

Classification and identification of peptides using LC-MS/MS analysis combined with the bioinformatic tool “Heliquest”. Identified peptides in cell-free supernatant obtained from S. epidermidis co-cultured with nutmeg seed extracts (CE and EO) are shown. Intensity values are represented as log 2-fold and the detectable peptide with expression level > 1.0 was considered among groups with different infection statuses. (A) A Venn diagram of detectable peptides; (B) the level of peptide expression in the CE-only group; (C) the level of peptide expression in the CE + S. epidermidis group; (D) the level of peptide expression in the EO-only group; and (E) the level of peptide expression in the EO + S. epidermidis group. CE, crude extract; EO, essential oil

Fig. 4.

Helical wheel projection of α-helices in the antimicrobial peptide. Residues in yellow are hydrophobic, whereas residues whose color is blue are cationic. The amine group containing residues (N) are colored in pink, hydroxyamino acids (S and T) are colored in purple, and alanine (A) and glycine (G) residues are colored in grey. The black arrow indicates the orientation of the hydrophobic moment, <µH>. The length of the arrow represents the magnitude of the hydrophobic moment, while the direction points toward the side of the helix with the highest concentration of hydrophobic residues

Effects of CFS: T-1 and CFS: T-2 on cell survival and adhesion during biofilm formation of S. aureus

The present study showed that both CFS: T-1 and CFS: T-2 could affect cell survival and adhesion during the biofilm formation of S. aureus (Fig. 5). The absorbance of S. aureus co-cultured with cell-free supernatant of S. epidermidis-only at OD 585 nm was observed to be 0.38 ± 0.04 after 16–24 h, indicating a higher level of biofilm formation compared with those of the supernatants of CFS: T-1 (0.18 ± 0.03) and CFS: T-2 (0.11 ± 0.02) (Fig. 5A and B). Based on the plate count method, the bacterial concentration of the control was reduced from 2 × 10⁷ CFU/mL to 6 × 10⁶ CFU/mL and 2 × 10⁶ CFU/mL for the CFS: T-1 and CFS: T-2 groups, respectively, allowing the enumeration of viable cells to be made (Fig. 5C, shown by the grey bars). The biofilm inhibition percentage was induced at 40% for the CFS control group, and at 51.72% and 68.92% for the CFS: T-1 and CFS: T-2 groups, respectively (Fig. 5C, shown by the black bars). Taken together, these findings suggested that both CFS: T-1 and CFS: T-2 were able to significantly inhibit biofilm formation in S. aureus cells.

Fig. 5.

Effects of CFS: T-1 and CFS: T-2 on cell survival and adhesion during biofilm formation of S. aureus. (A) Crystal violet staining of the cells; (B) The viable cells at OD 585 nm; (C) The correlation between viable cell count (CFU/mL) and biofilm inhibition (%). The viable cell count (CFU/mL) was determined by culturing the bacteria with CE or EO. The results are presented as the mean ± standard deviation for three biological replicates. Statistical analysis was performed using one-way analysis of variance (ANOVA), with significant (P ≤ 0.05) values measured against the control. The symbols used to indicate statistically significant differences are: P < 0.05 (^*), P < 0.01 (^**) and P < 0.001 (^***). CFU, colony forming units; CFS; cell-free supernatant; CE, crude extract; EO, essential oil

Relative expression of genes associated with biofilm formation in S. aureus

In this study, there were 6 biofilm-associated genes including fnbA, fnbB, icaA, icaD, agr, and cna genes in the experiment. We investigated the relative expression ratio of certain genes in S. aureus when treated with two different CFSs, CFS: T-1 and CFS: T-2. Among the genes tested, fnbA showed a significantly higher fold change in expression (0.535 ± 0.080) in CFS: T-1 compared with those in the agr and cna genes (0.250 ± 0.081 and 0.085 ± 0.012, respectively) (Fig. 6A and B). Similarly, in CFS: T-2, fnbA (0.743 ± 0.080fold change) showed a higher relative expression ratio compared with those of agr and cna (0.327 ± 0.024 and 0.157 ± 0.017fold changes, respectively). We also found that the expression levels of fnbB, icaA, and icaD were very low compared with that of the housekeeping gene control for both the experimental groups. Moreover, the treatment of S. aureus with CFS: T-1 or CFS: T-2 may lead to a downregulation of the expression of biofilm-associated genes, including cna, agr, and fnbA, while also repressing the expression of fnbB, icaA, and icaD.

Fig. 6.

The relative expression levels of genes associated with biofilm formation in S. aureus. The relative gene expression levels for S. aureus co-cultured with (A) CFS: T-1 and (B) CFS: T-2 are shown. The expression levels of agr, cna, and fnbA were analyzed by qRT-PCR analysis, which examined the differential modulation of mRNA levels. Relative expression ratios (fold change) were calculated using the 2^−ΔΔCt method, comparing the gene expression levels between the treatment conditions (CFS: T-1 and CFS: T-2) and S. aureus-only (control condition). The results are presented as the mean ± standard deviation for three biological replicates. The statistical analysis was performed using Student’s t-test with significant values (P < 0.05) shown against the expression level of the S. aureus-only group. The symbols used to indicate statistically significant differences are: P < 0.05 (^*), P < 0.01 (^**), and P < 0.001 (^***)

Discussion

Commensal bacteria in the human microbiome are known to prevent infections by producing AMPs, thereby boosting the immune system. S. epidermidis, a species of coagulase-negative Staphylococcus, is frequently present in the nasal microbiome, where it fulfills a crucial role in wound healing and combating pathogens [40–42]. Extensive research on the human microbiome has emphasized the importance of these bacteria in disease prevention through AMP secretion and immune system enhancement.

M. fragrans Houtt. (nutmeg) is one of the medicinal plants that is considered to be a good candidate for the production of small molecules as agents that may be able to act as alternatives to antibiotics in the treatment of antibiotic-resistant bacteria. Previous studies have demonstrated that both the CE and EO derived from nutmeg exhibit effectiveness against various microorganisms [27, 30, 43]. In the initial phase of the present study, the impact of M. fragrans seed extracts (CE and EO) on inhibiting the growth of two skin pathogens, specifically S. aureus and commensal S. epidermidis, were investigated. The findings obtained revealed that M. fragrans seed extracts were able to significantly reduce the survival of pathogens while promoting the growth of tested commensal bacteria in terms of both CE and EO treatment, as shown in Table 2; Fig. 1. Previous studies have found that nutmeg, along with other plant extracts and metabolites, may possess a high MIC against beneficial commensal bacteria such as S. epidermidis [32, 44]. Taguri et al. [45] examined the antimicrobial effects of polyphenols across various bacterial species, according to MIC analysis. This research group observed that the antimicrobial activity of polyphenols, particularly those containing pyrogallol groups, exhibited greater efficacy compared with those containing catechol and resorcinol rings. However, no clear correlation with the Gram staining of both positive and negative bacterial strains was identified [45]. Considering that the addition of nutmeg extract to the culture medium was found to stimulate the growth of S. epidermidis, this raises the possibility of utilizing this commensal strain in combination with nutmeg extract as a novel and non-aggressive therapeutic approach. This approach may potentially promote the maintenance and restoration of a healthy epithelial microbiota, enhancing its resistance against pathogens and providing protection against skin infections.

In the present study, secondary metabolites in the CFS derived from S. epidermidis co-cultured with nutmeg seed extracts (CE and EO) were investigated via GC-MS and LC-MS/MS analysis. The results obtained from the GC-MS analysis showed that SCFA profiles, including those of acetic acidbutyl ester, acetic acid, and lactic acidbutyl ester, were predominantly found in both the CFS: T-1 and CFS: T-2 groups (Fig. 2). Given this identification, these three compounds may therefore have the potential to disrupt S. aureus biofilm formation, which would be associated with their antibacterial activity. SCFAs produced by S. epidermidis exert a direct antibacterial effect against bacterial infections due to their ability to diffuse across bacterial membranes and to reduce the intracellular pH [46]. The LC-MS/MS analysis, the detected peptides under each experimental condition were classified by constructing a Venn diagram (Fig. 3A). The helical wheel projection revealed that the net charge of the AMPs ranged from + 2 to + 3 (Fig. 4). However, only peptide sequence number 5 (or Seq5; sequence: KKLIVGLLGITLLLTACNTK) contained the hydrophobic face (LGCILLL) oriented towards the hydrophobic core of the peptide (Table S1). The hydrophobic face of this peptide might therefore contribute to the eradication of pathogenic bacteria by disrupting their cell membranes and inhibiting crucial pathways, such as DNA replication, RNA and protein synthesis pathways, and biofilm formation [15, 16]. The present study also disclosed that the CFS: T-1 and CFS: T-2 treatment strategies led to a significant reduction in cell survival and adhesion during the biofilm formation of S. aureus (Fig. 5).

Further experiments using qRT-PCR analysis were subsequently devised to investigate the expression of genes associated with biofilm formation in staphylococcal strains under the conditions of CFS: T-1 and CFS: T-2. Biofilm formation in S. aureus comprises 12 genes, primarily regulated by the icaABCD operon, which synthesizes the staphylococcal exopolysaccharides polysaccharide intercellular adhesion (PIA) and extracellular polysaccharide adhesion or polymeric N-acetylglucosamine (PNAG) [47]. Key regulators within this mechanism include the gene products of icaA and icaD, which are crucial for biofilm regulation [48]. The findings from the present study revealed a significant downregulation of icaA and icaD expression, and this phenomenon has previously been shown to decrease PIA/PNAG production, subsequently reducing biofilm formation [49]. The intercellular adherence gene icaABCD initiates biofilm formation in staphylococci by facilitating cell-to-cell adhesion [50, 51]. In this study, the expression levels of fnbA and fnbB were found to be downregulated in both the CFS: T-1 and CFS: T-2 experimental groups (Fig. 6). Among these, the expression of fnbB was downregulated to very low levels. Interestingly, despite not being directly engaged in adhesion, the fnbA and fnbB genes exert a role in biofilm formation through facilitating the invasion of S. aureus into host cells [52]. The co-expression of fnbA and fnbB has been shown to aid biofilm development [53]. Furthermore, the expression of the cna gene was also found to be downregulated in response to the treatment in both the CFS: T-1 and CFS: T-2 experimental groups. The fib and cna genes in S. aureus are known to encode surface fibrinogen binding proteins and collagen binding proteins, respectively, which help in the process of bacterial adherence [54]. Moreover, the present investigation also revealed a notable downregulation of the agr regulator in both treatment groups. This gene fulfills a crucial role in the dispersal of S. aureus biofilms, a process that is regulated by four genes within the accessory gene regulatory (agr) system [55]. Biofilm dispersal, as regulated by the agr gene, is mediated by the induction of various proteases and phenol-soluble modulins [56], acting as surfactants to facilitate biofilm dispersion [57, 58]. Additionally, S. aureus possesses a distinct agr system that regulates the expression of different toxins and virulence factors, thereby regulating bacterial-host interactions at the infection site [59]. Collectively, these findings suggest that the treatments that have been explored in the present study are also able to inhibit bacterial adhesion and reduce biofilm formation in S. aureus.

SCFAs have been shown to be effective in deactivating E. coli and Salmonella sp. through targeting biofilm formation and exhibiting ant-iquorum sensing properties [60]. Additionally, AMPs, such as buforin II, are known to effectively kill bacteria at low concentrations without compromising the membrane integrity, but through directly interacting with the bacterial membrane. These AMPs can penetrate cells, bind to DNA and RNA, and inhibit DNA replication and protein synthesis without causing membrane damage [15]. The antimicrobial activity of AMPs against biofilms involves disrupting the membrane potential of biofilm-embedded cells, degrading polysaccharides and the biofilm matrix [61, 62], and interfering with bacterial cell signaling pathways [63]. They also cause the downregulation of genes associated with biofilm formation and the transportation of binding proteins [64]. Moreover, a study by Lee et al. [65] revealed that plants potentially employ diverse mechanisms to address biofilm formation and regulate bacterial proliferation. Developing noninvasive therapeutic strategies to maintain healthy skin microbiota is essential for protecting against pathogens and preventing skin infections. The findings of the present study have suggested that the investigated conditions may provide a promising natural and innovative therapeutic approach for preventing and managing skin infections. Moreover, the manipulation of skin microbiota presents a notable challenge for future clinical and cosmetic treatments. However, our study is still an in vitro experiment. Future studies are required to identify which SCFAs or AMPs affect the survival and biofilm formation of S. aureus. Additionally, it is necessary to investigate the cell-free supernatant from co-cultures of S. epidermidis with CE or EO of M. fragrans Houtt. seed to assess its cytotoxicity.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Abbreviations

CFS

T-1:Cell-free supernatant obtained from co-cultured S. epidermidis and crude extract of M. fragrans Houtt. seed

CFS

T-2:Cell-free supernatant obtained from co-cultured S. epidermidis and essential oil of M. fragrans Houtt. seed

Author contributions

PT, KS, BS, and SS conceptualized the study. PT, TO, BS, UM, SS, and SR were involved in developing the methodology. BS, TO, SS, and SR performed the experimental investigations. TO, BS, UM, and SS were responsible for writing the manuscript (original draft preparation), whereas reviewing and editing the manuscript was carried out by UM, TO, BS, AS, SR, RT, AC, AL, KS, and PT. PT was the supervisor of the project. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded and supported by the Fundamental Fund of Khon Kaen University and the Research and Academic Services, Khon Kaen University through Research Program Year 2022 (PR65-1-Immune-001 and PR65-311 1–002).

Data availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request. The MS/MS raw data and analysis have been deposited in the ProteomeXchange Consortium via the jPOST partner repository with the data set identifier JPST003351 and PXD055409 (https://repository.jpostdb.org/preview/100406378266d46f20562a7, Access key 2102).

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.