Cloning, heterologous expression and characterization of β-glucosidase deriving from Moniliophthora perniciosa (Stahel) Aime and Phillips Mora

Abstract

Β-glucosidase (BGLs) act synergistically with endoglucanases and exoglucanases and then are of great interest for biomass conversion into bioethanol. Thus, the aim of the current study is to produce a recombinant β-glycosidase from Moniliophtora perniciosa expressed in Escherichia coli cells. Enzyme coding sequence expression was confirmed through Sanger sequencing after using wheat bran (WB) and carboxymethylcellulose (CMC) as fungal growth media. Synthetic gene betaglyc-GH1 with optimized codons for E. coli expression was cloned in pET-28a. β-glucosidase recombinant (GH1chimera) was purified using a nickel column and its identity was confirmed through mass spectrometry. The recombinant enzyme presented an apparent molecular mass of 53.23 kDa on SDS-PAGE. Recombinant β-glucosidase has shown hydrolytic activity using p-nitrophenyl-β-D-glycopyranoside (pNPG) as substrate and maximum activity at pH 4.6 and 65 °C. Thus, the results indicate that the application of the GH1chimera in the hydrolysis of lignocellulosic materials to obtain glucose monomers can be efficient.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-024-04128-x.

Introduction

Biofuels have been considered the most promising alternative to be used in the future to replace petroleum-based fuels, given the decreased availability of non-renewable resources such as fossil fuels. This scenario led several countries to intensify their production to reduce their expenses, mainly with imported fuels (Sakdasri et al. 2017; Soni et al. 2023). Therefore, biofuels deriving from biomass conversion processes, such as biodiesel, bioethanol and biogas, are sustainable and renewable energy sources capable of significantly reducing CO₂ production (Seboka et al. 2023; Kouhgardi et al. 2023). In addition, biofuels’ burning leads to reduced particles, carbon oxide and sulfur oxide emission levels in comparison to emissions resulting from fossil fuels. Biofuels emerge as renewable and inexhaustible energy sources used to replace fossil fuels in the transport sector. Their greatest political and economic advantage lies in mitigating countries’ dependence on oil and natural gas suppliers (Ogunkunle et al., 2021; Hans and Duraipandian 2023). The use of enzymes as catalysts is an alternative to improving biodiesel production through transesterification. Biocatalysts enable promptly using unrefined raw materials, such as vegetable and animal seed oils, without the need to separate free fatty acids, which can be found in large amounts from the raw material (Lucas et al. 2020; Velvizhi et al. 2023; Cerón-Ferrusca et al. 2023).

Companies use microorganisms to produce enzymes based on their commercial goals. Among them, one finds bacterial genera such as Bacillus, Clostridium, Pseudomonas Streptomyces and Cellulomonas. Fungal genera like Aspergillus, Trichoderma and A. nidulans are also used for this purpose and many of them are known for their biotechnological potential (Yang et al. 2019; Tiwari et al. 2017; Li et al. 2018). However, there are still several obstacles to the process of using enzymes as catalysts for biofuel production purposes, with emphasis on their high cost.

Enzymes, such as amyloses, cellulases, lignins, lipases and phospholipids, are quite promising when it comes to producing 1st and 2nd generation ethanol (Robak and Balcerek 2018; Vasić and Knez 2021). The economic sector in the production and consumption of enzymes accounts for approximately 25–30% of the total cost of producing biofuels from sugars derived from lignocellulose. Enzymes’ trade recorded an annual growth rate of approximately 2.9% from 2017 to 2021 (Patel et al. 2023). Genetic engineering can be used to produce new, more resistant, and highly thermostable enzyme proteins. The introduction of a new generation of inexpensive enzymes with high specific activity under improved conditions can help to increase companies’ purchasing power to use enzymes for biofuel production purposes (Salihu et al. 2015; Singhania et al. 2021). Heterologous enzymes have been expressed in Escherichia coli (E. coli), Bacilli (i.e., Bacillus subtilis) and dairy bacteria (i.e., Lactobacillus lactis) (Liu et al. 2013). Because E. coli’s genome is well-featured and given the wide variety of strains and instruments available for genetic manipulation purposes, this bacterial species is the most common system used to produce recombinant proteins. It is so because of its fast growth ability, high cell density, as well as its ability to synthesize several copies of genes presenting strong promoters based on using economically viable substrates (Yildirim et al. 2017; Yang et al. 2020).

Moniliophtora perniciosa (Aime and Phillips-Mora 2005) produces cellulases by breaking lignocellulosic layers, and this process enables it to infect different Theobroma cacao L. (cacao) organs and trigger cocoa witch’s broom disease. Almeida et al. (2022) studied the production, characterization, and application of β-glucosidase from Moniliophthora perniciosa in the hydrolysis of pretreated sugarcane bagasse and found that the enzyme showed an optimum pH of 4.5 and 60 °C. There is no information in the literature about the characterization process applied to recombinant BGL enzymes from Moniliophtora perniciosa (Meraz-Pérez et al. 2021; García-Peñas and Sharma 2023). β-glucosidases (EC 3.2.1.21) (BGL) act synergistically with both endoglucanases (EC 3.2.1.4) and exoglucanases (EC 3.2.1.91), a fact that turns them into enzymes of great interest to be used for biomass conversion purposes. However, the main obstacles to lignocellulosic material conversion into glucose monomers used for fermentation in alcohol lie in cellulases’ inhibition by oligosaccharides and the lack of their adequate production by certain microorganisms used for biomass decomposition purposes (Pandey et al. 2021). Thus, in the current study, the synthetic gene betaglyc-GH1 β-glucosidase from Moniliophtora perniciosa has been cloned and heterologously expressed in E. coli for the first time.

Experimental

Determining M. perniciosa culture conditions

Moniliophthora perniciosa was obtained at Bahia State’s Microorganism Culture Collection of the State University of Feira de Santana (UEFS) under identification number CCMB257. The reactivation was done in a Potato Dextrose Agar (BDA) medium, with incubation in B.O.D. at 27 °C. Cellulolytic complex induction was carried out based on using liquid medium comprising NH₄H₂PO₄—7 g; K₂HPO₄—1.5 g; MgSO₄—0.5 g; CaCl₂—0.3 g; FeSO₄.7H₂O—0.184 g; ZnSO₄.7H₂O—0.178 g; MnCl₂4H₂O—0.158 g; Carboxymethylcellulose (CMC, as the only carbon source)—5 g; H₂O—1 L q.s.p., as well as WY liquid medium comprising the following constituents: 40 g wheat bran; 6 g yeast extract; 1 g K₂HPO₄; 0.2 g MgSO₄; 0.2 g KCL and distilled water q.s.p. 1 L.

Design of specific primers used to investigate the enzyme genes

Sequence 10942_g was acquired based on its identification in the genome signature of Moniliophthora perniciosa, which was kindly provided by Doctor Gonçalo Amarante Guimarães Pereira from the Genomics and Gene Expression Laboratory—UNICAMP (http://bioinfo08.ibi.unicamp.br/wbdatlas/overview). Sequences of cellulases belong to the GH1 family (Glycosyl Hydrolases 1) of fungal phylogenetically related to M. perniciosa available at CAZYmes (Carbohydrate-Active enzymes Database) and NCBI (National Center for Information on Biotechnology) were aligned with the sequence of M. perniciosa in the BLASTP tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). It was done to identify the observed protein domains, as well as to confirm both the family and function of each enzyme. In addition, the number of residues and protein domains’ positions were also recorded. Domains and conserved regions (active site) as well as their parts and residues involved in the catalysis of the enzyme were analyzed in Prosite Software before obtaining the synthetic gene (Sigrist et al. 2013). Smart Database (Letunic and Bork 2018), Pfam (El-Gebali et al. 2018) and InterPro (Mitchell et al. 2018) tools were used to identify the estimated signal peptide, as well as pI and MW, and also carbohydrate binding and transmembrane helix verification sites, whenever applicable.

To remove RNA, the adopted protocol followed the manufacturer's instructions (Trizol reagent, Invitrogen^®). Complementary DNA (cDNA) synthesis was carried out following the reverse transcription technique based on the use of the enzyme M-MLV Reverse Transcriptase (Promega^®). PCR was performed using the TopTaq Master Mix (Invitrogen^®) enzyme to test the efficiency of GH1-N-Terminal-F primers (5′-CGAGTTACCAGATCGAAGGTTCA -3′- Tm of 56.3 °C)—GenBank: ESK96275.1 (size = 1409 bp). Oligo(dT)12–18 bp was added to the reaction (5′-TTT TTT TTT TTT TTT TTT -3′ Tm at 34.3 °C) instead of the reverse primer (Reverse). The PCR amplification product, purified based on the polyethylene glycol (PEG) cleaning protocol (Hassan and Kala, 2013), was sequenced by the Oswaldo Cruz Foundation (FIOCRUZ), Bahia State, employing the Sanger method (https://plataformas.fiocruz.br/). The electropherogram resulting from this sequencing process was analyzed in Geneious Prime software (version 2020.0.4).

Protein sequence analysis

The nucleotide sequence recovered with good quality was translated into the bioinformatics resource portal known as Expasy (https://www.expasy.org/), which comprises several scientific resources, databases and computer tools. After the translation process was over, the sequence was subjected to a comparative analysis to investigate its similarity to complete sequences of Glycosil Hydrolases belonging to the GH1 family deposited in the NCBI, using blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Subsequently, the sequence was aligned in the Clustal online tool (https://www.ebi.ac.uk/Tools/msa/clustalo/) also used to align the nucleotide sequence deriving from the sequencing, called GH1.1. The sequence derived from the M. perniciosa genome (10942_g) was provided by Professor Gonçalo Amarante Pereira (http://www.lge.ibi.unicamp.br/vassoura) and the sequence ESK96275.1 by NCBI (Moniliophthora roreri) (https://www.ncbi.nlm.nih.gov/genbank/). Complementary DNA (cDNA) viability was investigated through conventional PCR; cDNA amplification reactions were initially tested in conventional thermocyclers (Biocycler^®- MJ96G).

Transforming Escherichia coli bacteria into an optimized synthetic gene

A synthetic gene ‘betaglyc-GH1’ (Genone^®) inserted in the pET-28a (+) plasmid, with NdeI (CATATG) and XhoI (CTCGAG) restriction sites, kanamycin resistance and an insertion size of 1,416 bp was used in the current study. The expression vector pET28a_betaglic-GH1 (Genone^®) presented a total size of 6700 bp. E. coli strains were reactivated in 2 mL of Luria Bertani Broth, Miller (L.B.) (Himedia^®) at 37 °C, 180 rpm, for 16 h, to get electrocompetent cells. Subsequently, samples were centrifuged at 20,379 × g for 2 min, inoculated in 100 mL L.B. and incubated at 37 °C at 180 rpm until reaching optical density (OD) at 600 nm ranging from 0.5 to 0.7 (VersaMax^® Microplate Reader). The culture was incubated on ice for 10 min and centrifuged in 50-mL Falcon tubes at 4,200 rpm at 4 °C for 10 min. The supernatant was discarded, and the bacterial pellet was resuspended using 10 ml of 100 mM magnesium chloride. After this, the samples were centrifuged at 4,200 rpm for 10 min. Sequentially, the precipitate was resuspended in 25 ml of 100 mM calcium chloride. Samples were incubated on ice for 30 min and, after the incubation time, centrifuged for 10 min at 4,200 rpm. The pellet was resuspended in 5 mL of a solution comprising calcium chloride solution (100 mM) added with 15% glycerol. Finally, cells were stocked in 750 μL of 50% glycerol and stored at − 80 °C. A synthetic Gene (pET28a_betaglyc-GH1) was transformed into E. coli using 1 μL of electrocompetent Rosetta strain (DE3) (Thermo Fisher Scientific^®) for long-term storage purposes. Transformed cells were packed in Petri dishes (with the aid of a Drigalski loop) covered with LB-agar medium containing antibiotics, such as kanamycin (50 μg/mL⁻¹) and chloramphenicol (34 μg/mL⁻¹), to enable selecting colonies transformed with PET28a_betaglic-GH1. Subsequently, plates were incubated in an oven at 37 °C, in a reversed way.

Grown colonies were re-inoculated in 3 mL of Luria Bertani Broth Miller broth comprising kanamycin (50 μg/mL⁻¹) and chloramphenicol (34 μg/mL⁻¹) after 16 h of incubation. One (1) mL aliquot was removed from the broth after 16 h of incubation at 37 °C at 180 rpm. Then, the colonies were added with 1 mL of 50% Glycerol and stored at -80 °C. The portion left over from the inoculation was used for Plasmid mini-preparation purposes.

β-glucosidase protein recombinant glycosidase expression, biochemical characterization and SDS-PAGE analysis

Preserved cultures were reactivated in 3 mL of L.B. added with 3 μL kanamycin broth (50 μg/mL⁻¹) and chloramphenicol (34 μg/mL⁻¹), as well as incubated under stirring (at 180 rpm) at 37 °C for 16 h to start the recombinant β-glucosidase expression. The following day, the culture was centrifuged at 5000 rpm (Eppendorf ^® 5810 R) at 4 °C for 10 min to remove the saturated medium. Subsequently, the bacterial pellet was inoculated in 5 mL of L.B. broth based on using the same antibiotics mentioned above; a pET28a colony without an insert was used as a control. All tubes were incubated at 37 °C under constant stirring at 180 rpm until reaching an optical density (D) ranging from 0.7 to 1.0 at 600 nm (VersaMax^® Microplate Reader). An aliquot of the cultured cells was removed (without induction), and another was subjected to permanent storage in glycerol. The culture remainder was added to the broth, along with IPTG (isopropylthio-β-galactoside) (Omega Biotek^®) at a final concentration of 0.4 nmol L⁻¹ to induce gene expression for 4 h. An aliquot of bacterial culture was collected and inoculated with the plasmid at 37 °C to evaluate gene expression. The samples collected were centrifuged at 13,000 g for 2 min. After discarding the supernatant, the bacterial culture pellet was resuspended in 400 μL lysis buffer added with lysozyme (Binding Buffer 1x + lysozyme 50 µg mL⁻¹) and incubated at 30 °C for 30 min. Subsequently, samples were packed in ice and ultrasonicated (3 pulses of 8 s on and 20 s off, at 70% amplitude) in a Sonics Sonicator machine (Vibra-Cell vcx 130^®).

After this procedure was over, 30 μL of each lysed culture was collected and identified, as follows: total extract without IPTG (ET-S) and total extract with IPTG (ET-C), which was added with 90 μL of distilled water and 30 μL of Sample Buffer TA 5 × (10% glycerol, 5% β-mercaptoethanol, 2.3% SDS, and 0.0625 M Tris–HCl at pH 6.8). The remaining 370 μL of sample was used to check centrifuge solubility at 12,000 × g for 15 min (it was done to separate soluble (FS) from insoluble (IF) fractions) and stored at − 20 °C. Electrophoresis was carried out on 12.5% polyacrylamide and sodium dodecyl sulfate gel (SDS-PAGE) to qualitatively assess gene expression as described by Laemmli (Laemmli 1970). The amino terminal of the recombinant protein expressed with the herein adopted vector has a 6-histidine tag. Fractions containing enzyme were initially purified by layer chromatography on a nickel column (HisTrap™ HP^®). Pellets of the soluble (FS) and insoluble (FNI) fractions were resuspended in 10 mL of lysis solution and incubated at room temperature for 30 min. Samples were sonicated in a Sonics Sonicator machine (Vibra-Cell vcx 130^®) for 20 min, based on a 6-mm probe (in diameter) at 70% amplitude. Sonication was carried out based on using 10 cycles of 10 pulses (8 s), which were interspersed with 25-s resting in ice for cooling purposes. Protein extract derived from lysed cells was centrifuged at 14,000 rpm at 4 °C for 30 min.

After these procedures were over, the soluble fraction (FS) was maintained at − 20 °C, for further analysis. The insoluble fraction pellet (FNI) was re-suspended with binding buffer 1X buffer comprising urea (6 M) and sonicated again for 3 min using a Sonics Sonicator machine (Vibra-Cell vcx 130^®) at 10 pulses (30 s) and 70% amplitude. The supernatant was used for purification purposes. Initially, the column was sanitized with 10 mL of strep buffer and 5 mL of ultrapure water and after, it was loaded with 5 mL of buffer charge buffer 1X. The elution of the retained protein recombinant fractions (FS) and (FNI) was assessed as the imidazole concentration increased (from 50 to 500 mmL⁻¹). Samples collected throughout the process were subjected to 12.5% SDS-PAGE analysis.

Protein Identity Confirmation

Purified enzyme peptides obtained from segmented SDS-PAGE bands were prepared for biomass spectrometry analysis, based on the protocol described by (Marques et al. 2013). Triptych peptides were subjected to reverse phase chromatography in AGILENT 1290^® Infinity II UHPLC and continuously injected into the AGILENT 6545 Q-TOF^® mass spectrometer, where peptide spectra were produced (Dewapriya et al. 2018). MS/MS spectra were analyzed in Agilent spectrum mill MS Proteomics Workbench Rev B.06.00.203 and the protein sequence of the recombinant β-glucosidase enzyme was compared to the NCBIprot database (https://www.ncbi.nlm.nih.gov/protein/).

Detecting and determining the activity of recombinant β-glucosidase

Specific enzyme activity (U/mg) was determined according to the method described by (Matsuura et al. 2021), with some modifications. 500 μL of enzyme extract and 2 mL of chromogenic p-nitrophenyl-β-D-glucopyranoside (pNPG) substrate—at the concentration of 4 mM and prepared in 50 mM sodium citrate buffer, were incubated for 20 min (temperature and pH were determined based on the central composite experimental design). The reaction was interrupted by adding 2.5 mL of sodium carbonate 0.1 M. The released p-nitrophenol was quantified through spectrophotometry at 420 nm (Spectrophotometer Cary 50 UV–Visible, Varian Inc.). The enzyme activity unit was defined as the number of enzymes required to release 1 μmol of p-nitrophenol per reaction minute. Reaction buffer, rather than enzyme extract, was used for total white. The whole experiment was carried out in triplicate. Total protein amount (mg mL⁻¹) was determined by the method of Bradford (1976) using the Cary 50 UV–Visible spectrophotometer (Varian Inc ^®) Specific enzyme activity was expressed as U mg⁻¹.

Temperature and pH effects on β-glucosidase activity were investigated using Doehlert experimental planning for two variables. The pH was investigated at 5 different levels (from 4 to 8; the central point was 6.0) using citrate–phosphate buffer (pH 4, 5 and 6) and phosphate buffer (pH 7 and 8), as described in Table 1. The temperature was assessed at 3 different levels (from 30 to 70 °C; the central point was 50 °C). Results observed for enzyme activities were statistically compared to each other through analysis of variance (ANOVA). Mean values were compared to each other through the F test in Statistic software, version 7.0. Analyses applied to means and standard deviations were performed in Prism 5.0 and Microsoft Office Excel software.

Table 1.

Doehlert experimental design for the optimization of recombinant β-glucosidase activity by evaluating different pH and different temperature

Assay	pH	Temperature (°C)	Activity (μmol/min)
1	5 (− 0.5)	70 (+ 0.866)	0.2535 ± 0.0131
2	7 (+ 0.5)	70 (+ 0.866)	0.1788 ± 0.0406
3	4 (− 1.0)	50 (0.0)	0.0630 ± 0.0186
4 (CP*)	6 (0.0)	50 (0.0)	0.3761 ± 0.0153
4 (CP*)	6 (0.0)	50 (0.0)	0.3866 ± 0.0153
4 (CP*)	6 (0.0)	50 (0.0)	0.3795 ± 0.0153
5	8 (+ 1.0)	50 (0.0)	0.1459 ± 0.0361
6	5 (0.0)	30 (− 0.866)	0.0000 ± 0.0106
7	7 (+ 0.5)	30 (− 0.866)	0.0000 ± 0.0073

*CP Central Point, replicated three times

Results and discussion

Determining M. perniciosa culture conditions

Filamentous fungi emerge as good producers of cellulases deriving from carbon sources that have great degradation potential, favorable chemical composition, and physical conditions capable of enabling microorganisms to have more contact with the substrate (Arntzen et al. 2020). Reactive M. perniciosa in potato agar and dextrose (BDA) medium has shown satisfactory growth in the 7, 14 and 21-day growth periods (Fig. 1, Supplementary Material). M. perniciosa presented satisfactory basidiocarp and basidiospore production after 7-day growth in WY medium, as well as maintaining its life cycle contiguous to the growth profile of commercial medium CMC (Fig. 1). This medium contains carboxymethyl cellulase deriving from cellulase, which is an elementary water-soluble industrial polymer that is easily degraded by fungi (Khoirunnisa et al. 2020; Giwa et al. 2023).

Fig. 1.

M. perniciosa grown in different culture media versus cultivation time: 1- WY (medium with wheat bran); 2- CMC (medium with carboxymethylcellulase); and in natural—growth times: A-7 days; B-14 days; and C-21 days

According to (Zhao et al. 2019), wheat bran is an important carbon source activated by 56 regulatory genes that lead to cellulase production in filamentous fungi. Its composition contains approximately 56% carbohydrates, 13%–18% protein, 12% water, and 3.5% fat, as well as high cellulose, arabinose and xylose levels. It presents high nutritional value, good porosity, adaptation to particle size, and adequate consistency for anchoring and enzymatic excretion purposes. Wheat bran, due to its suitable composition for fungal growth, has been used in many studies with different fungal species: Myceliopthor athermophila BJA, Penicillium sp, Penicillium oxalicum cepa HP7-1, Trichoderma reesei NCIM 1186, Penicillium citrinum NCIM 768, Aspergillus sp., Trichoderma sp. and Penicillium sp and Thermoascus crustaceusem (Phadtare et al. 2017; Zhao et al. 2019; Lodha, et al. 2020; Fadel et al. 2020; Garbin et al. 2021; Santos et al. 2021), cultured in half-solid medium and added with it for 8 days.

Design of specific primers used to investigate the enzyme genes

The direct primer linked to the gene sequence (10942_g SCAF_35 58,049 60,269 1) was defined and selected based on using the OligoAnalyzer online tool, version 3.1—Integrated DNA Technologies^® (https://www.idtdna.com/PrimerQuest/Home/Index)—after the following parameters were checked: ring temperature (Tm), CG content rate and secondary structures’ formation (Hairpin, Self-dimer and Hetero-dimer). Investigations focused on the M. perniciosa genome enabled the identification of a partial GH1 family sequence under GenBank database identification n. EEB95782.1. Searches conducted at Prosite only enabled the identification of GH1 family "signature 2″. "Signature 1″, which is often found in the N-terminal portion, was not herein observed because this part of the sequence was not sequenced (or noticed). Analysis performed in the blast tool enabled the finding of the GH1 family of the fungal species M. roreri (ESK96275.1), which has both signatures and size similar to those of beta-glycosidases belonging to the GH1 family. The N-terminal signature found in the GH1 family of the fungal species M. roreri (ESK96275.1) was used to sequence the N-Terminal region of GH1-Mper (EEB95782.1).

It was possible to see that' signature 1′ was well preserved in the genus Moniliophthora (Alignments’ results are available in Appendix 1) by aligning the M. roreri’s GH1 region (ESK96275.1) with Hypsizygus marmoreus GH1. This region was used to design a new primer (GH1-N-Terminal-F) and, consequently, to enable full protein expression without cuts in its structure. Several amplification attempts were made based on the use of a reverse primer, genetic sequence (10942_g SCAF_35 58,049 60,269 1) and genome with GH1-N-Terminal-F, (5′- CGAGTTACCAGATCGAAGGTTCA -3'- Tm of 56.3 °C), but they were all unsuccessful. Oligo(dT)12–18 bp (5′- TTT TTT TTT TTT TTT TTT -3' Tm 34.3 °C), rather than the reverse primer of 10942_g SCAF_35 58,049 60,269 was added to the reaction later on to take advantage of the initial part of the sequence and to enable amplifying the region of interest. Satisfactory results were observed in both extractions. The 28 S and 18 S bands were intact, although 28 S was more intense. This result has evidenced effective RNA extraction (Fig. 2—Supplementary Material). However, samples extracted from fungi grown in the WY medium presented more intense bands than those extracted from fungi grown in CMC (Fig. 2B—Supplementary Material). Based on sequencing analysis conducted in Geneious Prime software (version 2020.0.4), the sample could retrieve approximately 91.2% of the sequence. Table 1 shows the sequence corresponding to the GH1.1 sequencing.

Fig. 2.

Comparative analysis of amino acid residue identity among GH1.1, 10942_g and ESK96275.1 sequence (sequence deriving from cDNA sequencing, sequence found in the database and sequence deriving from the genome, respectively) highlighted in yellow. Region corresponding to the signature of the active site is highlighted in yellow: (*) Identity of all amino acid residues aligned in the indicated column, (:)Similarity among amino acid residues aligned in the indicated column, (.) Low similarity among amino acid residues aligned in the indicated column, ( −) No similarity among amino acid residues aligned in the indicated column

Protein sequence analysis

The sequencing process resulted in the following sequence, which was translated into the bioinformatics resource portal Expasy (Gasteiger et al. 2003). GH1.1, which is represented in Fig. 2, resulted in a polypeptide of 345 amino acids, whereas the other sequences (ESK96275.1 and 10942_g) presented 467 and 469 amino acid residues, respectively. After translation, the amino acid sequence of GH1.1 was subjected to comparative analysis to check its similarity to complete sequences of Glycosyl Hydrolases belonging to the GH1 family, which was deposited in the NCBI, using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The aforementioned sequence recorded 90.88% similarity to the ESK96275 sequence (beta-glucosidase Moniliophthora roreri MCA 2997).

Alignment among protein sequences GH1.1 (resulting from sequencing), ESK96275 of beta-glucosidase Moniliophthora roreri MCA 2997 (resulting from alignment) and 10942_g SCAF_35 58049 60269 (resulting from the genome) was carried out in the Clustal online tool (https://www.ebi.ac.uk/Tools/msa/clustalo/). Protein sequences presented a high degree of similarity. Comparative analysis between amino acid residues of GH1.1 and sequences “10942_g” and “ESK96275.1” has shown 92.15% similarity, whereas GH1.1 and ESK96275 recorded 87.77% similarity. However, some regions did not align at all, including the signature of the active site highlighted in yellow, which shows four different amino acids. Prosite Software (Sigrist et al. 2013) made it possible to visualize conserved regions in the sequences evaluated in this study (active site). In addition, the sequence was subjected to smart database tools (Letunic et al. 2018) such as Pfam (El-Gebali et al. 2018) and InterPro (Mitchell et al. 2018) to identify signal peptide and other protein domains in it.

The analysis applied to both sequences allowed visualization of the signature pattern of the active site region for all sequences containing nine amino acid residues (IYVTENGFA). Although there was a change in 4 amino acid residues (KLPC), these amino acids aligned in the column (highlighted in green) indicated similarity (Fig. 2); this finding may be associated with incomplete sequencing in this region.

Catalytic reactions of β-glucosidases in GH1 took place based on glycomyomyation and deglycoyllation steps, according to which glutamate (Glu) is the prevalent residue of both the active and preserved sites. Two Glu residues account for acid–base catalysis and Nucleophilic, one of them acts as a nucleophile (conserved as motif I / VTENG), whereas the second residue acts as acid catalyst / general base (conserved as tfnep'motif) (Stepper et al. 2013; Romero-Téllez et al. 2019; Erkanli et al. 2024).

Protein domains were visualized to gather more information about the sequences cited in this study, which were analyzed in the online tool available at (http://pfam.xfam.org/search/sequence). Results have confirmed that the analyzed sequence belonged to Glycosyl hydrolase family 1. Although it does not have a complete domain because it is a partial sequence, it presents proteins of domains previously deposited in the database. Based on the information presented above, complementary sections of the ESK96275.1 and 10942_g SCAF_35 58049 60269 sequences of these proteins included the active site region and GH1.1 to produce a chimeric sequence that has resulted in the corresponding GH1chimera (Fig. 3).

Fig. 3.

GH1chimera amino acid residue sequence (recombinant β-glucosidase)

Again, alignment among the ESK96275 (beta-glucosidase of Moniliophthora roreri MCA 2997), 10942_g SCAF_35 58049 60269 (genome) and GH1chimera sequences was carried out in the Clustal online tool (https://www.ebi.ac.uk/Tools/msa/clustalo/). This alignment has shown high similarity among these three sequences. GH1chimera and ESK96275 recorded 93.79% similarity, whereas GH1chimera and 10942_g SCAF_35 58049 60269 recorded 93.60% similarity. The GH1chimeric sequence corresponding to beta-glucosidase was later reversibly translated in online software available at (https://www.ebi.ac.uk/Tools/st/emboss_backtranseq/). This process resulted in the nucleotide sequence > GH1chimera which was recommended for synthetic beta-glycosidase gene synthesis.

Transforming Escherichia coli bacteria into an optimized synthetic gene

Cloning and heterologous expression are considered as alternatives to increase enzyme production. The use of these enzymes makes industrial processes less expensive, especially when done in association with low-cost generating substrates.

The Escherichia coli bacterial system has interesting genetic characteristics well described in the literature: ease of obtaining, having an abundance of commercially available strains and vectors, presenting rapid growth kinetics and having a strong capacity to express recombinant genes with high yields (Rosano et al. 2019; Shahzadi et al. 2021; Zhou et al. 2022). According to (Cantoia et al. 2021), when the E. coli bacteria inoculated in a glucose-rich medium has an initial saturated culture dilution of 1/100, it can reach the stationary phase in a few hours. E. coli Rosetta (DE3) was used here as a host for the expression of GH1chimera. Figure 4 shows the electrophoretic profile (in 1% Agarose gel) of plasmid DNA extracted from cells transformed with the synthetic gene PET28a_betaglic-GH1.

Fig. 4.

Reverse-translated GH1chimera sequence corresponding to β-glucosidase

According to the literature, the pET-28a system is currently used for recombinant proteins’ expression in Escherichia coli since it allows the expression of the recombinant protein fused to 6 histidine residues at the amino-terminal (N-terminal) or carboxy-terminal (C-terminal), which in its turn enables purification through affinity chromatography techniques, based on Sepharose resins-nickel combinations (Hassan and Kalam 2013; Ferreira et al. 2018; Ko et al. 2021; Leonhardt et al. 2023). Plasmid DNA was extracted from the cell and quantified; it reached a concentration of 232.3 ng/μL.

Expression, biochemical characterization and SDS-PAGE analysis applied to GH1chimera (recombinant β-glycosidase)

The bioinformatics analysis carried out in the Portals Expasy and ProtParam tools enabled predicting the theoretical molecular mass of β-glucosidase (GH1chimera), which reached 53.23 kDa, as well as estimating its pI and MW, which reached 5.45 and 53,200, respectively. The analyzed β-glucosidase did not present a transmembrane helix. E. coli cells (Rosetta DE₃) presented several proteins (Fig. 5) which were used as parameters in other assessments. Recombinant β-glucosidase protein (GH1chimera) induced by IPTG presented a band corresponding to electrophoretic migration proportional to the theoretical mass predicted in 12.5% SDS-PAGE gel, as well as in soluble and insoluble fractions, where it was possible to see larger bands when it was induced in IPTG and in the insoluble fraction (Fig. 5).

Fig. 5.

Electrophoretic profile of GH1chimera production induction times in 12.5% SDS-PAGE gel stained with bright Coomassie blue, wherein: (M) molecular marker; (pET28a) non-transformed E. Coli cells; cell cultures: (− IPTG) without IPTG induction and (+ IPTG) with IPTG induction; (FS) soluble fraction; (FNI) Insoluble fraction

In this sense, an expression study carried out with the filamentous fungal species Talaromyces emersonii allowed the identification of β-glucosidase with 55.8 kDa from glycosyl hydrolase family 1, which had the potential to be used for cellulose manipulation purposes (Collins et al. 2007). The fungal species Neosartorya fischeri NRRL181 expressed four betaglycosidases from the GH1 family (BGLs). It encoded a polypeptide with 529 amino acid residues the gene was cloned into pET28-a and overexpressed in Escherichia coli, with a molecular weight of ~ 60 kDa (Ramachandran et al. 2012). A cellulolytic fungus (YDJ216) was isolated from a compound and identified as Aspergillus sp. BGL1 and BGL2. BGL1 and BGL2 molecular masses were estimated at 97 kDa and 45 kDa, respectively, based on SDS-PAGE. The two enzymes presented similar enzymatic properties, as well as optimal activity at pH 4.0–4.5 and 60 °C when the p-nitrophenyl-β-D-glycopyranoside (pNPG) substrate was used (Oh et al. 2018). Similar results were described by (Sathe et al. 2017), who obtained stable β-glucosidase derived from Methylococcus capsulatus in E. coli with an expressed protein of 50.7 kDa. The beta-glucosidase gene of Auricularia heimuer, which encodes a likely polypeptide comprising 860 amino acids, was cloned and successfully expressed in E. Coli. This finding evidenced target bands ranging from 100 to 135 kDa (Sun et al. 2020).

The recombinant β-glucosidase (GH1chimera) deriving from the soluble fraction (FS) was eluted on a gradual imidazole concentration increase (from 50 to 500 mm L⁻¹) in affinity chromatography conducted with a nickel column (Fig. 6). It was possible to see the recombinant protein at all tested gradient concentrations, even in small amounts—it was successfully purified. However, it was not possible to identify specific activity in the insoluble fraction, since the enzyme was denatured in this fraction.

Fig. 6.

Electrophoretic profile in 12.5% purification SDS-PAGE gel with elution fractions defined by chromatography—(M): molecular marker; (ET): total extract; (FN): Uninteracted fraction; (50–500 Mm): different elutions for imidazole concentrations of recombinant β-glucosidase

Thus, it is recommended to both apply and obtain the recombinant protein in its soluble form, with its correct structural conformation. To properly analyze the structural properties of a given protein or enzyme, it is necessary to isolate it so it can be assessed in its pure form. The ideal purification strategy to be adopted depends not only on the features of the protein of interest but also on the properties of contaminants found in the crude extract (Pessoa-JR and Kilikian 2005; Sánchez-Trasviña et al. 2021).

The gel band corresponding to the size of the expressed protein was excised from the gel and subsequently subjected to mass spectrometry analysis to identify the GH1chimera sequence. Most studies conducting protein quantification supported by mass spectrometry use analytical methods adjusted for peptides. Consequently, they heavily rely on efficient and impartial protein digestion protocols to prepare samples. MS-based proteomics is an essential technology used to feature complex biological systems, including relative or absolute protein expression levels and post-traditional protein modifications.

The most common method used to analyze medium-to-high-complex protein samples in large-scale proteomics is based on protein digestion using trypsin endoprotease. Triptych peptides were subjected to analysis and sequencing based on liquid chromatography-tandem MS (LC–MS/MS) (Montiel-León et al. 2018). Identification procedures were performed through initial peptide digestion in trypsin, which generated peptides with varying masses. Peptide sequences were compared to the NCBL database. Results have shown an identity rate of 91.53% for Moniliophthora roreri MCA 2997 (ESK96275.1). Supplementary material (Fig. 7) depicts the identified sequence and the location of 470 peptides. Cross-tracking was carried out in the Clustal online tool (https://www.ebi.ac.uk/Tools/msa/clustalo/). This analysis identified 98.72% of highly significant coverage with recombinant enzymes belonging to the GH1-β glucosidase family of the fungal species Moniliophthora perniciosa, which presented 10 peptides different from the GH1chimera sequence in the current study.

Fig. 7.

Recombinant β-glycosidase characterization the M. perniciosa. Contour surface used to determine optimum pH and temperature for the activity of the purified recombinant β-glucosidase enzyme

Detecting and determining recombinant β-glucosidase activity

Reducing costs with enzymatic production by improving fermentation media is a primordial step to enable its industrial application. Optimization is traditionally done by varying one parameter while keeping the other's constant. However, this approach is more time-consuming and cannot detect the best means, mainly due to a lack of analysis applied to interactions among different factors (Damaso et al. 2004). One of the most used strategies to identify the relative significance of different parameters and find the ideal conditions for enzyme occurrence in statistical experiments is factorial design (Uhoraningoga et al. 2018; Boateng et al. 2023).

Table 2 shows total protein values, the amount of enzyme capable of catalyzing the conversion of 1 μmol of substrate per minute, and the specific activity of recombinant β-glucosidase in chromogenic p-nitrophenyl-β-D-glycopyranoside (pNPG) substrate after purification. Total protein values in the LB medium of the soluble fraction subjected to different elutions ranged from 0.196 mg/mL to 0.065 mg/mL, in comparison to the crude extract produced by the fungus, which recorded a total protein value of 0.057 mg/mL.

Table 2.

Enzyme activity of crude extract and recombinant β-glucosidase

Fraction	Imidazole concentration	Total protein (mg/mL)	Enzyme activity (μmol/min)	Specific activity (U/mg)
Soluble LB Medium	Crude extract	0.057 ± 0.004	0.07 ± 0.0004	1.23 ± 0.01
	50 mM	0.196 ± 0.01	0.04 ± 0.004	0.18 ± 0.02
	75 mM	0.126 ± 0.02	0.06 ± 0.004	0.46 ± 0.03
	150 mM	0.095 ± 0.02	0.04 ± 0.002	0.47 ± 0.02
	250 mM	0.081 ± 0.007	0.02 ± 0.003	0.27 ± 0.04
	500 mM	0.065 ± 0.009	0.003 ± 0.003	0.05 ± 0.04

An amount of recombinant enzyme capable of catalyzing the conversion of 1 μmol of substrate per minute to the same medium ranged from 0.003 μmol/min to 0.06 μmol/min compared to the total extract fermented to crude extract by the fungus 0.07 μmol/min. Specific activity varies from 0.05 U/mg to 0.47 U/mg in the first minute. The crude extract showed a specific activity value of 1.23 U/mg.

The optimization of the recombinant β-glucosidase enzyme from Moniliophthora perniciosa aims at obtaining cellulase to be used for industrial applications focused on lignocellulosic biomass hydrolysis processes. Table 1 describes enzymatic activity results observed for recombinant β-glycosidase obtained under pH and temperature conditions tested at full factorial arrangement 2², using Doehlert experimental design.

The results (Table 1) have shown optimum activity at 50 °C and pH 6.0 Moniliophthora perniciosa is a strong candidate for use in cellulase production. The production of the carboxymethylcellulase enzyme was investigated by Santana et al. (2023), who described the optimum pH and temperature at 7.2 and 47 °C, respectively. The CMCase retained 88.66% of residual activity after 30 min of incubation at 90 °C. The CMCase retained 88.66% of residual activity after 30 min of incubation at 90 °C. Due to the characteristic of thermal stability, this enzyme will be studied to be expressed in recombinant microorganisms.

In the studies of Almeida et al. (2022), crude extract containing β-glucosidase was used to determine pH and temperature optimum. The optimal values of enzymatic activity were pH 4.5 and 60 °C, and the authors reported that BGL was a stable enzyme at all observed temperatures (50–90 °C). Then, the same experimental design was used in this study to compare crude enzyme with recombinant enzyme.

The production of CMC enzyme was higher in the concentration of 7.0 g L⁻¹ of yeast extract and 19 days fermentation time. CMCase showed optimum pH and temperature at 7.2 and 47 °C, respectively. The carboxymetilcellulase retained 88.66% of its residual activity after 30 min of incubation at 90 °C. Due to the characteristic of thermal stability, this enzyme will be studied to be expressed in recombinant microorganisms.

Furthermore, recombinantly produced enzymes are highly specific and capable of functioning under mild temperature conditions (Periyasamy et al. 2023). The optimum pH ranging from 4.5 to 5.5 is a common characteristic of β-glucosidase, in addition to favoring its use for biofuel production purposes (Benevides et al. 2022; Ribeiro and Assis 2023).

Both pH and temperature values have influenced enzyme activity, which was lower in citrate–phosphate buffer at pH 5.0 and 30 °C—critical values were presented by the model. The model expressed by the Equation below was generated by following the association between pH and temperature in enzymatic activity, based on regression analysis applied to experimental data.

$$\begin{array}{cc}\hfill A\left(\mu \text{mol}/\text{min}\right)& =-4.1234+0.8641\times \left(\text{pH}\right)-0.0690\times {\left(\text{pH}\right)}^2\hfill \\ \hfill & +0.0689\times \left(\text{Temperature}\right)-0.0006\times {\left(\text{Temperature}\right)}^2\hfill \\ \hfill & -0.0006\times \left(\text{pH}\right)\times \left(\text{Temperature}\right).\hfill \\ \hfill \end{array}$$

This model was subjected to an analysis of variance (ANOVA) (Table 3). Data were analyzed through the Fischer test, according to which the F value is defined as quadratic regression mean: quadratic error mean ratio. The F value calculated based on ANOVA results (26.3584) was much higher than the tabled F value observed under these conditions (9.01), and it indicated its 95% significance level. R² = 0.977 indicated that 99.5% variation was explained by the model. The variation observed in the model was significantly higher than likely random variations. Therefore, the model is reliable and appropriate to represent effects, correlations and interactions among temperature, pH and enzymatic activity.

Table 3.

Analysis of variance (ANOVA) of optimization of recombinant β-glucosidase activity evaluating different pH and different temperature

Variation source	Sq	df	MQ	Calculated F	Tabled F
Regression	0.2510	5	0.0502	26.3584	9.01
Residue	0.0057	3	0.0019
Lack of adjustment	0.005655	1	0.005655	0.0000	0.00
Pure error	0.000057	2	0.000029
Total SQ	0.256665	8
r2 = 0.9777

SQ quadratic sum, df degree of freedom, MQ quadratic mean, CI confidence interval

Contour and response surfaces generated from the analyzed data, adopted reaction conditions and maximum enzymatic activity were observed in a wide range of temperature (35–65 °C) and pH (4.2–6.7) values. It covered the central point of the experiment (Fig. 7). The combination of temperature and pH conditions set for the central point (50 °C and pH 5.5) was satisfactory for this enzyme’s performance. This wide range of maximum performance enabled exploring several temperature and pH combinations, and it emphasized the potential versatility of the enzyme to be used in several specific processes (Fig. 8).

Fig. 8.

pH and Temperature Optimization: Response surface observed for temperature and pH effects on recombinant β-glucosidase activity and purified recombinant β-glucosidase

Most fungal BGLs have activity temperatures ranging from 40 to 50 °C, as well as significant pH values ranging from 4.0 to 6.0 (Yang et al. 2023). Thermophilic fungal species Myceliophthora thermophila M.7.7 cultivated a in solid state with optimal enzymatic activity at 60 °C and pH 5.0, on substrate 4 nitrophenyl β-D-glucopyranoside (pNPG) (Bonfá et al. 2018). Parietal or intracellular BGLs generally have an ideal pH closer to neutrality, while extracellular BGLs show good catalytic activity at lower pH values. The fungal species Penicillium verruculosum expressed the β-glucosidase gene rPvBGL and showed maximum enzymatic activity at pH 4.6 and 65 °C, in a study carried out by (Volkov et al. 2020).

Fungal BGLs cloned and expressed in a heterologous way and in model organisms are strong candidates to be used for industrial purposes. Among them, one finds Aspergillus sp., Trichoderma sp. and Penicillium sp. (Fadel et al. 2020). BGL1 in Aspergillus sp. YDJ216 extracellular β-glucosidase has shown optimally active enzyme properties at pH 4.0–4.5 and 60 °C (Oh et al. 2018). Heterologous expression of a new β-1,4-glucosidase deriving from the Aspergillus fresenii and its enzymatic characters, and the bgl T2 gene expressed in E. coli, recorded the highest activity at 55 °C and pH 5.5 (Yang et al. 2019).

According to Santa-Rosa et al. (2018), β-glucosidase deriving from Penicillium sp. recorded higher enzyme activity at pH rates ranging from 0 to 7.0, as well as optimal activity at pH 6.0. Cassia Pereira et al. (2015), observed that β-glycosidase deriving from Myceliophthora thermophila recorded optimal enzyme activity at 70 °C and that the enzyme kept more than 93% of its original activity when it was incubated at 55 °C.

The optimal temperature observed for β-glucosidase deriving from fungal species M. heterothallica was within the optimum temperature range of enzymes produced by different fungi. Several fungal β-glucosidases remain stable for a short period-of-time at high temperatures, although they denature at high temperatures for long exposure times (Liu et al. 2013). Although enzymes from different organisms show significant changes in properties and functions, economic production, high hydrolytic efficiency, and high tolerance to unfavorable conditions are essential features required by industrial processes. Enzyme activity was optimal at pH 4.5 and 65 °C (Garbin et al. 2021).

With respect to Talaromyces pinophilus, the recombinant protein presented optimal pH 4.0, as well as good thermostability, since 70% of maximum enzymatic activity was maintained after 1 h at 60 °C (Trollope et al. 2018). β-glucosidase deriving from Aspergillus aculeatus (BGLA) was herein expressed, featured and had the molecular mechanism of its acid denaturation thoroughly investigated. BGLA presented maximum activity at pH 5.0–6.0. Its optimum temperature was 70 °C (Li et al. 2018).

β-glucosidase production through solid-state cultivation of the fungal species Thermoascus crustaceusem in low-cost culture medium (comprising agro-industrial residues) recorded optimal enzyme activity at pH 4.5 and 65 °C. β-glucosidase maintained its catalytic activity when it was incubated at a pH ranging from 4.0 to 8.0 and at a temperature ranging from 30 to 55 °C (Garbin et al. 2021). Recombinant enzymes have been a viable alternative for commercialization, due to their high specificity and production quantity. It is possible to observe in the works of Dadwal and Sharma (2023), in which a β-glucosidase from the fungus Myceliophthora thermophila (MtBgl3c) was cloned and expressed heterologously in E. coli with optimum pH and temperature of 5.0 and 55 °C, respectively. In studies with the fungus Trichoderma harzianum it was possible to develop a recombinant β-glucosidase with substantial catalytic activity in the pH range of 3.0–5.0 and at temperatures of 40–60 ℃ (Sun et al. 2022).

Based on the Pareto chart, temperature and pH had a significant influence on the activity of the BGL enzyme as well as on the interaction between these pH and temperature variables (Fig. 9). These features are essential to enabling enzymatic synthesis. According to Yang et al. (2020), featuring a new β-glucosidase heterogeneously deriving from Aspergillus fresenii has contributed to its application in biotechnology and, subsequently, in industrial fields, such as bioethanol production from lignocellulosic materials. These results are like those observed for M. perniciosa extract in the present study, which evidenced this enzyme’s preference for temperatures higher than 50 °C, as well as for more acidic pH values since it did not present maximum activity at pH levels above neutrality.

Fig. 9.

Pareto chart plotted to determine pH and temperature influence on the activity of the recombinant β-glucosidase

Conclusions

The present study has successfully grown the fungal species M. perniciosa in agro-industrial materials to produce extracellular β-glucosidase. The molecular identification of this enzyme enabled synthesizing the synthetic gene betaglyc-GH1 (Genone^®) inserted in the plasmid pET-28a (+), which was cloned and successfully expressed in E. coli with a size of 53.23 kDa. This protein has a domain of the preserved glycosyl hydrolase family 1, besides being an intracellular enzyme without a signal peptide. Partially purified β-glucosidase presented optimum activity in pNPβG substrate at 50 °C and pH 6.0. Future studies will establish a set of genetic transformation procedures for M. perniciosa, based on using genetic engineering in association with bioinformatics and methods focused on improving or suppressing β-glucosidases expression. It will be done to further explore its functions since this enzyme has great potential to be used in cellulose saccharification processes, as well as to contribute to the use of lignocellulosic residues and to reduce the accumulation of this material in the environment.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

Data availability

Data will be made available on request.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethical approval

This article does not contain any studies with human participants. Animal model was used and the study protocol for the experimental use of the animals was approved by the by the Animal Ethics Committee of the State University of Feira de Santana (006/2013) according to the standard operating procedures (SOPs).