Generation of two familial hypercholesterolemia patient-specific induced pluripotent stem cell lines harboring heterozygous mutations in the LDLR gene

Abstract

Familial hypercholesterolemia (FH) is a genetic disorder affecting the metabolism of lipoprotein, characterized by elevated levels of plasma concentrations of low-density lipoprotein cholesterol (LDLC). The most common FH cause is mutations within the gene that encodes for the LDL receptor (LDLR) protein. Two induced pluripotent stem cell (iPSC) lines were generated from patients with FH, each carrying a single heterozygous mutation in the LDLR gene, one is a missense mutation, c.631C > T, and the other is a splice-site mutation, c.313 + 1G > A. Both iPSC lines exhibited strong expression of pluripotency markers, demonstrated the ability to differentiate into derivatives of the three germ layers, and maintained normal karyotypes. These derived iPSC lines represent powerful tools for in vitro modeling FH and offer a promising platform for therapeutic development.

1. 1 Resource Table

Unique stem cell lines identifier	1) SCVIi108-A 2) SCVIi109-A
Institution	Stanford Cardiovascular Institute, Stanford, CA, USA
Contact information of distributor	Joseph C. Wu, joewu@stanford.edu
Type of cell lines	iPSC
Origin	Human
Additional origin info required for human ESC or iPSC	Age: 54 (SCVIi108-A), 76 (SCVIi109-A) Sex: Female (SCVIi108-A), Male (SCVIi109-A) Ethnicity: Native American (SCVIi108-A), White (SCVIi109-A)
Cell Source	PBMCs (all lines)
Clonality	Clonal
Method of reprogramming	Sendai virus vectors
Genetic Modification	Yes
Type of Genetic Modification	Hereditary
Evidence of the reprogramming transgene loss	RT-qPCR
Associated disease	Familial hypercholesterolemia (FH, OMIM 143890)
Gene/locus	LDLR (19p13.2) SCVIi108-A: LDLR gene; c.631C > T SCVIi109-A: LDLR gene; c.313 + 1G > A
Date archived/stock date	10/25/2022 (SCVIi108-A) 6/14/2023 (SCVIi109-A)
Cell line repository/bank	https://hpscreg.eu/cell-line/SCVIi108-A https://hpscreg.eu/cell-line/SCVIi109-A
Ethical approval	The generation of two lines was authorized by the Administrative Panel on Human Subjects Research (IRB) under IRB #29904 “Derivation of Human Induced Pluripotent Stem Cells (Biorepository)”.

2. Resource utility

If left untreated, FH poses a significant risk of life-threatening cardiovascular consequences. Despite advances in genetic testing in FH and the availability of potent lipid-lowering therapies, FH remains underdiagnosed and undertreated globally. Two iPSC lines were generated from FH patients carrying either a heterozygote missense mutation (c.631C > T) or a heterozygous splice-site mutation (c.313 + 1G > A) in the LDLR gene. These iPSC lines serve as valuable tools for investigating the connection between LDLR and FH and testing candidate drugs for disease treatment.

3. Resource details

Familial hypercholesterolemia (FH) stands as one of the most prevalent inherited disorders, impacting an estimated 1 in 250 individuals. This condition, marked by increased levels of low-density lipoprotein cholesterol (LDLC), significantly raises the risk of premature atherosclerotic cardiovascular disease (ASCVD) (Rader et al., 2003 Jun). The primary cause of FH, accounting for 80–85 % of FH cases, is a mutation in the gene encoding LDL receptor (LDLR) (Iacocca and Hegele, 2017 Jul). As a membrane protein on the surface of liver cells, LDLR plays a pivotal role in LDLC metabolism. The pathogenic LDLR variants may directly lead to protein dysfunction and LDLC metabolic disorders. To date, researchers have identified at least 3,700 variants in the LDLR gene (Leigh et al., 2017). Nevertheless, only a restricted number of LDLR variants have been validated as pathogenic. Investigating the function of LDLR variants is essential for obtaining a better understanding of the molecular mechanism underlying FH. The primary object of managing FH is to decrease plasma LDLC levels and minimize the risk of ASCVD. Currently, a range of lipid-lowering medications are employed in the clinical treatment of FH, such as ezetimibe, statins, and PCSK9 inhibitors (Niman et al., 2020). There are still significant gaps in our understanding of optimal management methods for individuals with FH. In the context of precision medicine, more research is required to evaluate and compare the efficacy of different treatments in the setting of specific pathogenic variants.

In this report, two human iPSC lines (SCVIi108-A, SCVIi109-A) were reprogrammed from peripheral blood mononuclear cells (PBMCs) of patients diagnosed with FH. The line SCVIi108-A was derived from a 54-year-old Native American female carrying a heterozygous missense mutation, c.631C > T (p.His211Tyr) in the LDLR gene. The line SCVIi109-A was obtained from a 76-year-old white male with a heterozygous splice-site mutation, c.313 + 1G > A in the same gene (Table 1). Reprogramming of PBMCs to iPSCs was performed via the transduction of Yamanaka factors encoding genes by using the Sendai virus. The resulting iPSCs exhibited typical morphology (Fig. 1A, Scale bar: 520 μm). To confirm the pluripotency of the two iPSC lines, the mRNA expression of SOX2 and NANOG was measured by reverse transcription-quantitative polymerase chain reaction (RT-qPCR), and both iPSC lines showed comparable expression levels to a previously published control iPSC line (Liu et al., 2023). In contrast, the mRNA expression of SOX2 and NANOG was not detected (N.D.) in the differentiated cardiomyocytes derived from the same control line (Fig. 1B). The protein-level expression of pluripotency markers (OCT3/4, NANOG, and SOX2) was then confirmed using immunofluorescence staining (Fig. 1C, Scale bar: 640 μm). Both iPSC lines were able to successfully differentiate into derivatives of all three germ layers (Fig. 1D, Scale bar: 640 μm). The presence of the heterozygous LDLR mutations (c.631C > T and c.313 + 1G > A) was confirmed by Sanger sequencing (Fig. 1E). Karyotype integrity was assessed as normal with the KaryoStat assay (Fig. 1F). The Sendai virus was absent from line SCVIi108-A and line SCVIi109-A at passage 20, while it was present in early passage 10 for both lines (Fig. 1G). Both cell lines were negative for mycoplasma (Fig. 1H). The origin of the iPSC lines was proven to be from their donors’ PBMCs via short tandem repeat analysis (Table 1).

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography	Visual record of the line: normal	Fig. 1 panel A
Phenotype	Quantitative analysis: RT-qPCR	Positive expression of pluripotency markers NANOG and SOX2 in the two FH iPSC lines and absent in differentiated CMs	Fig. 1 panel B
	Qualitative analysis: Immunofluorescence staining	Positive expression of pluripotency markers: OCT3/4, NANOG, and SOX2 in the two FH iPSC lines	Fig. 1 panel C
Genotype	Whole genome array (KaryoStat™ Assay) Resolution 1–2 Mb	Normal karyotype: 46, XY for line SCVIi108-A and 46, XX for line SCVIi109-A	Fig. 1 panel F
Identity	Microsatellite PCR (mPCR) or	N/A	N/A
	STR analysis	16 loci tested match well	submitted in archive with journal
Mutation analysis (IF APPLICABLE)	Sequencing Southern blot or WGS	Heterozygous mutation N/A	Fig. 1 panel E N/A
Microbiology and virology	Mycoplasma	Mycoplasma testing by luminescence: Negative	Fig. 1 panel H
Differentiation potential	Directed differentiation	Positive IF staining of three germ layer markers	Fig. 1 panel D
List of recommended germ layer markers	Expression of these markers has to be demonstrated at mRNA (RT qPCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer	Ectoderm: PAX6, OTX2 Endoderm: SOX17, FOXA2 Mesoderm: Brachyury, TBX6	Fig. 1 panel D
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

Fig. 1.

Characterization of two iPSC lines derived from FH patients.

4. Materials and methods

4.1. Reprogramming

PBMCs were extracted from whole blood using Percoll density gradient medium (GE Healthcare #17089109) and washed thoroughly with DPBS (ThermoFisher Scientific #14190144). The cells were then cultured in StemPro^®−34 SFM medium (ThermoFisher Scientific #10639011) supplemented with 100 ng/mL SCF (Peprotech #300–07), 100 ng/mL FLT3 (ThermoFisher Scientific #PHC9414), 20 ng/mL IL-3 (Peprotech #200–3), 20 ng/mL IL-6 (ThermoFisher Scientific #PHC0063), and 20 ng/mL EPO (ThermoFisher Scientific #PHC9631). The reprogramming of iPSCs was carried out utilizing the CytoTune^™-iPSC 2.0 Sendai Reprogramming Kit (ThermoFisher Scientific #A16517) based on the provided instructions. Transduced cells were resuspended and plated on Matrigel-coated plates and maintained in StemPro^™−34 medium. Day 7 post-transduction, the media was changed to StemMACS^™ iPS-Brew XF medium (Miltenyi Biotec #130-104-368) until colonies emerged, typically within 10–15 days post-transduction. Subsequently, selected colonies were then picked, expanded, and cryopreserved for experimental usage.

4.2. Cell culture

The iPSCs were cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotec, #130-107-086) with supplement (Miltenyi Biotec, #130-107-087). Once cells reached confluency, they were passaged using 0.5 mM EDTA (Invitrogen #15575–038) and seeded again on Matrigel-coated plates (1:500 coated, Corning, #356231). A 10 μM of ROCK inhibitor (Y27632, Selleck Chemicals, #S1049) was added for 24 h after passage. The medium was replaced the next day and then every two days. Cells were cultured in a humidified incubator at 37 °C with 5 % CO₂.

4.3. RNA extraction and RT-qPCR

The iPSCs in passage number 20 were used to detect the pluripotency markers NANOG and SOX2 and iPSCs in passage number 10 and 20 were used to determine the presence of the Sendai virus genome. Briefly, RNA from two FH iPSC lines, a previously published iPSC line (positive control) (Liu et al., 2023), and differentiated cardiomyocytes from the same published iPSC line (negative control) were collected in Trizol (Thermo Fisher Scientific), followed by extraction with the Direct-zol RNA Microprep Kit (Zymo Research #R2062) according to the manufacturer’s instructions. Subsequently, cDNA was synthesized via reverse transcription using the iScript cDNA Synthesis Kit (BioRad #1708891). Lastly, RT-qPCR analysis was performed using predesigned TaqMan primers (Table 2).

Table 2.

Reagents details.

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency marker	Rabbit Anti-Nanog	1:200	Proteintech Cat #142951-1-AP	RRID: AB_1607719
Pluripotency marker	Mouse IgG2bκ Anti- Oct-3/4	1:200	Santa Cruz Biotechnology Cat #sc-5279	RRID: AB_628051
Pluripotency marker	Mouse IgG1κ Anti-Sox2	1:200	Santa Cruz Biotechnology Cat #sc-365823	RRID: AB_10842165
Ectoderm marker	Goat Anti-Otx2	1:200	R&D Systems Cat #963273	RRID: AB_2157172
Ectoderm marker	Rabbit Anti-Pax6	1:100	Thermo Fisher Scientific Cat #42–6600	RRID: AB_2533534
Endoderm marker	Goat Anti-Sox17	1:200	R&D Systems Cat #963121	RRID: AB_355060
Endoderm marker	Rabbit Anti-Foxa2	1:250	Thermo Fisher Scientific Cat #701698	RRID: AB_2576439
Mesoderm marker	Goat Anti-Brachyury	1:200	R&D Systems Cat #963427	RRID: AB_2200235
Mesoderm marker	Rabbit Anti-Tbx6	1:200	Thermo Fisher Scientific Cat #PA5–35102	RRID: AB_2552412
Secondary antibody	Alexa Fluor 488 Goat Anti-Mouse IgG1	1:1000	Thermo Fisher Scientific Cat #A-21121	RRID: AB_2535764
Secondary antibody	Alexa Fluor 488 Donkey Anti-Goat IgG (H + L)	1:1000	Thermo Fisher Scientific Cat #A-11055	RRID: AB_2534102
Secondary antibody	Alexa Fluor 555 Goat Anti-Rabbit IgG (H + L)	1:500	Thermo Fisher Scientific Cat #A-21428	RRID: AB_141784
Secondary antibody	Alexa Fluor 647 Goat Anti-Mouse IgG2b	1:250	Thermo Fisher Scientific Cat #A-21242	RRID: AB_2535811
	Primers
	Target	Size of band	Forward/Reverse primer (5′−3′)
Sendai virus Plasmids (qPCR)	Sendai virus genome	181	Mr04269880_mr
Genotyping	FH; LDLR, c.631C > T	496	F: tagaatgggctggtgttggg R: ccagggacaggtgataggac
Genotyping	FH; LDLR, c.313 + 1G > A	363	F: ggtctttcctttgagtgacagt R: agcaccatccccactttgta
House-keeping gene (qPCR)	GAPDH	471	Hs02786624_g1
Pluripotency marker (qPCR)	SOX2	258	Hs04234836_s1
Pluripotency marker (qPCR)	NANOG	327	Hs02387400_g1

4.4. Immunofluorescent staining

The iPSCs in passage number 21 were used for immunostaining. Briefly, cells were fixed in a 4 % paraformaldehyde solution (Fisher Scientific #50980487) for 15 min, followed by permeabilization with 0.1 % PBST solution (Sigma-Aldrich #9036-19-5) for 10 min at room temperature (RT). Cells were then blocked for 30 min at RT in a blocking solution (0.1 % PBST with 5 % Donkey Serum [Sigma-Aldrich #D9663] or Goat serum [Sigma, #G9023]) depending on the animal origin of the secondary antibody. After overnight incubation at 4 °C, the cells were exposed to primary antibodies (Table 2) diluted in the blocking solution. The subsequent day, after washing, the cells were subjected to a 30-minute incubation at RT with secondary antibodies, which were also diluted in the blocking solution (Table 2). Nuclei were stained with the Molecular Probes NucBlue Fixed Cell ReadyProbes Reagent (ThermoFisher Scientific #R37606). Images were taken using the ECHO Revolve microscope.

4.5. Trilineage differentiation

The iPSCs in passage number 21 were used for trilineage differentiation. Induction of iPSCs towards endoderm differentiation was performed using the StemDiff^™ Definitive Endoderm Differentiation Kit (STEMCELL^™ Technologies #05110). Ectoderm was inducted with the Human Pluripotent Stem Cell Functional Identification Kit (R&D Systems #SC027B). Mesoderm was induced with the addition of 6 μM CHIR (Selleck Chemicals, #S2924) dissolved in RPMI media supplemented with B27 supplement Minus Insulin (Gibco, #11875–085 and #A18956–01) for 48 h. The differentiations were assessed by the expression of the classical lineage markers in each germ layer by immunofluorescent staining.

4.6. Short tandem repeat analysis

The iPSCs in passage number 20 were used for analysis. The extraction of genomic DNA from iPSCs and PBMCs was performed using the DNeasy Blood & Tissue Kit (Qiagen #69504). Short tandem repeat analysis was performed with the CLA IdentiFiler^™ Direct PCR Amplification Kit (ThermoFisher Scientific #A44661) according to the instructions. Capillary electrophoresis was performed on ABI3130xl by the Stanford Protein Nucleic Acid (PAN) Facility.

4.7. Sanger sequencing

The targeted genomic region was PCR amplified using the KOD One PCR Master Mix (DiagnoCine, #KMM-101) with iPSC genomic DNA extracted as described previously in STR analysis, with the primers listed in Table 2. The PCR reaction was performed under the following conditions: 98 °C for 10 sec; 65 °C for 5 sec; 68 °C for 1 sec for 35 cycles. Sanger sequencing was performed by Azenta.

4.8. Karyotyping

2 × 10⁶ cells were collected from each line at passage 20 and analyzed using the KaryoStat^™ assay (ThermoFisher Scientific).

4.9. Mycoplasma detection

The iPSCs in passage number 20 were used for the mycoplasma test. The test was done with the MycoAlert^™ Detection Kit (Lonza #LT07–318) according to the instructions.

Data availability

Data will be made available on request.