Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Oct 9;103(12):104389. doi: 10.1016/j.psj.2024.104389

Peptide-directed interference of PD-1/PD-L1 binding increases B lymphocyte function after infectious bursal disease viral infection

Qiuyu Zhang *,†, Guopeng Sun §, Feng Yue §, Zhike Liu #, Peng Li §, Yanping Zhu §, Yangzhao Zhu §, Ruiyan Niu †, Zilong Sun †, Xuannian Wang *,‡,1, Gaiping Zhang *,‡
PMCID: PMC11533547  PMID: 39427422

Abstract

Programmed cell death protein 1 (PD-1)/PD-1 ligand 1 (PD-L1) binding contributes to immune evasion mechanisms responsible for B lymphocyte exhaustion and apoptosis. This facilitates immunosuppression in chronic viral infections, including infectious bursal disease virus (IBDV). Our previous study showed that PD-1 and PD-L1 expression increases in the peripheral blood mononuclear cells of chickens infected with IBDV. However, due to their high production costs and immune-related adverse events, monoclonal antibodies targeting PD-1 or PD-L1 are unsuitable therapeutic agents. Thus, in the current study, we designed peptides with optimized binding sites for PD-1 and investigated their ability to disrupt PD-1/PD-L1 binding and restore B lymphocyte function in vitro. The peptide gCK-16 exhibited a high affinity for PD-1 (KD: 3.37 nM) and effectively inhibited the PD-1/PD-L1 interaction in vitro. Moreover, gCK-16 significantly enhanced B lymphocyte proliferation. Remarkably, gCK-16 treatment abrogated the IBDV-induced upregulation of PD-1/PD-L1, NF-κB activation, and B lymphocyte apoptosis. Additionally, IBDV infection attenuated PI3K/AKT pathway activation in B lymphocytes, while gCK-16 treatment increased immunoglobulin M (IgM) production in IBDV-infected B lymphocytes. Together, these results demonstrate that gCK-16 treatment can potentially enhance B lymphocyte function against IBDV infection, guiding the development of vaccine adjuvants to effectively prevent IBDV-induced avian immunosuppression.

Key words: peptide gCK-16, PD-1/PD-L1, infectious bursal disease virus, immunosuppression, B lymphocyte function

INTRODUCTION

Infectious bursal disease virus (IBDV) infection induces severe immunosuppression by directly depleting immature IgM+ B lymphocytes in the bursa of Fabricius (BF), resulting in susceptibility to secondary pathogen infections and reduced vaccination efficacy in chickens, primarily aged 3 to 6 wk (Quan et al., 2017; Huang et al., 2021; Setta et al., 2024). A novel IBDV variant exhibits particularly strong immunosuppressive effects and is responsible for substantial economic losses in the poultry industry worldwide (Wang et al., 2021; Wang et al., 2022).

Programmed cell death protein 1 (PD-1), a critical immunosuppressive molecule, is predominantly expressed on the surface of activated T lymphocytes, B lymphocytes, and monocytes (Xu-Monette et al., 2018; Pauken et al., 2021). The ligand for PD-1, PD-L1, is constitutively expressed by immune cells and lymphoid/non-lymphoid tissues, suggesting that it may regulate inflammatory responses (Goodman et al., 2017; Lu et al., 2022). The interaction between PD-1 and PD-L1 is critical in immune tolerance induction, leading to tissue damage in chronic human immunodeficiency virus, hepatitis B virus, and bovine leukemia virus infection (Day et al., 2006; Dong et al., 2019; Okagawa et al., 2023). However, the overexpression of PD-1/PD-L1 induces immune dysfunction in B lymphocytes by suppressing the phosphoinositide 3-kinases (PI3K)/protein kinase B (AKT) pathway, increasing the progression of immunosuppressive diseases (Pierau et al., 2012). Notably, blocking the PD-L1/PD-1 pathway increases B lymphocyte proliferation and function, enhancing B cell receptor (BCR) signaling and antigen-specific immune responses (Lu et al., 2022).

In veterinary virology, a few studies have investigated the PD-1/PD-L1 pathway in bovines, pigs, and cats, revealing that it interferes with the host immune response after chronic viral infection (Liu et al., 2020; Nishibori et al., 2023; Li et al., 2024). In our previous study, we reported that IBDV infection increases the expression of PD-1 and PD-L1, depending on the viral load in the peripheral blood mononuclear cells of chickens, similar to autoimmune diseases in humans and mice (Wang et al., 2014). Currently, drugs targeting the interaction between PD-1 and PD-L1 include monoclonal antibodies that specifically bind to PD-1 or PD-L1, interrupting the signaling pathway (Vanhersecke et al., 2021). Although these monoclonal antibodies have several advantages in treating autoimmune diseases, their clinical applications remain limited due to their high production costs, complex production processes, and immunogenicity. Moreover, although antibody blockade of either PD-1 or PD-L1 is also applicable in chickens (Reddy et al., 2019), no specific peptides capable of interrupting the chicken PD-1/PD-L1 pathway have been identified.

Peptides are a class of biomolecules comprising amino acids connected by peptide bonds. Peptide-based small-molecule inhibitors have several advantages over monoclonal antibodies as drug candidates, including chemical stability, ease of large-scale synthesis, lower manufacturing costs, superior tumor penetration, and reduced immunogenicity (Liu et al., 2019). Numerous peptides have been reported as checkpoint inhibitors of the PD-1/PD-L1 pathway in cancer immunotherapy development (Pan et al., 2021; Zyla et al., 2021; Fetse et al., 2022). However, no studies have reported the development of peptides that suppress PD-1/PD-L1 in IBDV-infected chickens. Therefore, a need exists for developing small-molecule inhibitors of the PD-1/PD-L1 immune checkpoint in chickens to prevent immunosuppression associated with IBDV infection.

Here, we confirmed the upregulation of PD-1 and PD-L1 expression in the BF of IBDV-infected chickens. Based on the PD-1/PD-L1 complex, we designed a peptide, optimized its binding affinity for PD-1 by amino acid residue truncation and microscale thermophoresis (MST) assays, and assessed its effect on B cell proliferation using a counting kit 8 (CCK-8) assay. Additionally, we examined the effects of the peptide on PD-1/PD-L1 expression and that of PI3K/AKT signaling molecules in response to IBDV infection in vitro. This study provides an alternative candidate for restoring B lymphocyte function and an avenue for developing novel vaccine adjuvants against IBDV infection in chickens.

MATERIALS AND METHODS

Cell Culture, Plasmids, and Virus

The 293T cells and pEGFP-N1 vectors were available in our laboratory. 293T cells were cultured in Dulbecco's modified eagle's medium (DMEM) medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. A chicken B cell line (DT40 cells, a BF stem cell line transformed with avian leukosis virus) was kindly provided by Professor Jun Luo (Henan Academy of Agricultural Science, China). The cells were cultured in DMEM supplemented with 10% FBS, 5% chicken serum, 50 mM β-mercaptoethanol, 2 mM L-glutamine, and 1% penicillin-streptomycin. All cells were cultured at 37°C with 5% CO2. IBDV strain LX (Quan et al., 2017), a vvIBDV strain, was provided by Professor Jue Liu (Yangzhou University, China). The experimental procedures and inoculation dose were determined based on the median effective embryo dose (EID50) described by Quan et al. (2017).

Overexpression Plasmid Transfection Assay

The coding sequence of chicken PD-1 (lacking the intracellular region) was amplified by PCR using specific primers (PD-1F1/R1) and inserted into the EcoRI and SalI sites of the pEGFP-N1 vector to generate the pEGFP-PD-1 fusion construct. The pEGFP-PD-1 plasmid was transfected into 293T cells using Lipofectamine 2,000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions, yielding cells that express chicken PD-1 on their surface.

Animal Experiments

Animal experiments were performed by the animal welfare committee of the Henan Institute of Science and Technology, China (Approval Number: 2020HIST016). Forty one-day-old Jinghong laying chickens without IBDV-specific antibodies were purchased from Henan Yuanfa Poultry Co., Ltd. (Xinxiang, China) and divided randomly into 2 groups (n = 20/group). All chickens were housed in negative-pressure isolators in a pathogen-free animal laboratory. At 21 d of age, the chickens in the experimental group were inoculated with 500 μL of 105 EID50 of IBDV by ocular and intranasal routes, while the mock group was treated with PBS. All chickens were sacrificed under anesthesia by exsanguination 3 d postinfection. The BF was transmitted to the lab on ice and stored at −80°C for further detection.

Peptide Design and Synthesis

The amino acid sequences of PD-1 and PD-L1 were retrieved from the NCBI database, and DNAMAN software was used to exploit their alignments. X-ray crystal structures of the PD-1/PD-L1 complex from other species were retrieved and collected using the RCSB Protein Data Bank (RCSB PDB) database (http://www.rcsb.org/pdb/home/home.do) as a reference structure to predict the binding residues of the chicken PD-1/PD-L1 complex. The peptides were optimized using an amino acid residue truncation strategy (Shen et al., 2017). All peptides (gDK2-3, gLK-19, gCK-16, gEK-13, gGK-10, gDI-19, gDY-16, gDG-13, and gDE-10) were chemically synthesized by Shanghai Gill Biochemical, Ltd. (Shanghai, China).

Affinity Testing

The dissociation constant (KD) of the PD-L1-derived peptides bound to chicken PD-1 protein was determined using MST analyses with a Monolith NT.115 system (NanoTemper Technologies, Munich, Bavaria, Germany) per the manufacturer's instructions. Briefly, PD-1 protein was labeled using the BLUE-NHS protein labeling kit (NanoTemper Technologies, Cat#MO-L003, Munich, Bavaria, Germany). The peptides were diluted using a 2-fold PBS (pH 7.4) gradient from 1800 to 0.054 nM. Equal volumes of successfully labeled chicken PD-1 protein were mixed with the peptide or chicken PD-L1 protein and incubated for approximately 5 min. Chicken PD-L1 (100 nM) served as a positive control. Each mixture was immobilized onto a standard monolith NT capillary (NanoTemper Technologies, Cat#MO-K022, Munich, Bavaria, Germany) and immediately analyzed using an MST instrument. KD values were calculated using NanoTemper analysis v2.3 software.

MTT Assay

DT40 cells were treated with 10, 50, 250, and 500 nM of the 3 peptides (gCK-16, gDK2-3, and gGK-10) for 24 h, and cell viability was analyzed according to the instructions of the 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide (MTT) assay kit (Beyotime, Shanghai, China). Cell viability was calculated using the OD450 value.

CCK-8 Assay

DT40 cells were treated with 250 nM of the 3 peptides (gCK-16, gDK2-3, and gGK-10) for 0, 12, 24, 48, and 72 h; cell proliferation was analyzed using the CCK-8 assay kit (Solarbio, Beijing, China) according to the manufacturer's instructions. The cell proliferation curves were plotted using the OD450 values at different time points.

Cell-based PD-1/PD-L1 Blocking Assay

The blocking ability of the peptides was evaluated using a cell-based PD-1/PD-L1 blocking assay as previously described (Wang et al., 2019; Yin et al., 2021). Briefly, transfected 293T cells were incubated with various peptide concentrations (from 2 to 100 nM) for 30 min and incubated with 20 ng of chicken His-tagged PD-L1 protein for 30 min. Subsequently, the cells were stained with rabbit anti-His tag/AF594 conjugated antibody (1:100, bs-0287R-AF594, Bioss, Beijing, China) for 1 h. The reaction system without peptides served as the positive control, and cells only incubated with rabbit anti-His tag/AF594 conjugated antibody were the negative control. Finally, flow cytometry (Beckman Coulter, Brea, CA) was used to analyze the fluorescence signal using FlowJo software version10.8.1.

Virus Infection and Peptide Treatment

DT40 cells were seeded in 6-well cell culture plates at 80% cell confluence and infected with IBDV at a multiplicity of infection (MOI) of 1 for 1 h at 37°C. Subsequently, the unattached viruses were removed and cultured in DMEM supplemented with 2% FBS for the indicated times. DT40 cells were treated with peptides 24 h after IBDV infection and incubated for 12 h. Cells and culture supernatants were collected for further analysis.

RNA Extraction, RT-PCR, and qRT-PCR Analyses

Total RNA was isolated from infected BF tissues or DT40 cells using TRIzol reagent (Takara, Dalian, China) and reverse-transcribed into cDNA using the PrimeScript RT reagent kit (Takara, Beijing, China), following the manufacturer's instructions. RT-PCR was used to amplify the complete coding sequence of chicken PD-1 and PD-L1. qRT-PCR was performed using SYBR Premix Ex Taq II (Takara, Beijing, China). β-actin acted as the housekeeping gene. Data analysis was determined using the 2–∆∆CT method. The sequences of all primers are listed in Table 1.

Table 1.

The primers used in this study.

Gene GeneBank ID Primer sequences (5′–3′)a Product size (bp)
PD-1 XM_422723.3 F-ATGGCTCTGGGCACCTCGAG 846
R-ACAGCAGGGCTGGGAGGGCA
PD-L1 XM_424811.3 F-ATGATGGAAAAGCTTTTGCT 939
R-CGCATTTATGCTTACATTTCAGC
PD-1 XM_422723.3 F1-GGAATTC1GCCACCATGGCTCTGGGCACCTCGAG 585
R1-ACGCGTCGAC2GATGATGATGTAGCCAAAGAGC
IBDV-VP2 MN464103.1 F-CCAAGGAAGCCTGAGTGAACTGAC 138
R-TGATCATATGATGTGGGTAAGCTGAGG
IκB-α NM_001001472.3 F-CTTCCAGAACAACCTCAGCCAGAC 92
R-CGCAGCCAGCCTTCAGCAG
P65 D13721.1 F-CAGCCCATCTATGACAACCG 152
R-TCAGCCCAGAAACGAACCTC
PI3K NM_001004410.1 F-CGGATGTTGCCTTACGGTTGT 162
R-GTTCTTGTCCTTGAGCCACTGAT
AKT NM_001396387.1 F-CGCCGGAAGTAGCTGAGAAG 142
R-CGGGAATGTCTCTTGGTGGA
IgM FM872305.1 F-GTCAAAGGAGGAGCTGAACG 230
R-TGTGTGTGACCCTGCAGGTG
β-actin NM_205518.1 F-TATTGCTGCGCTCGTTGTTGAC 181
R-GATACCTCTTTTGCTCTGGGCTTC
Open in a new tab

Inserted restriction sites 1EcoRI and 2SalI are italicized.

Western Blot Analysis

The sample was lysed on ice with RIPA lysis buffer and centrifuged at 12,000 rpm for 20 min. A BCA protein quantification kit (Solarbio, Beijing, China) was used to quantify the protein concentrations. Denatured proteins were separated using 10% or 12% SDS-PAGE gel electrophoresis and transferred onto nitrocellulose membranes using the wet blotting method. The membranes containing protein samples were blocked with 5% fat-free milk for 2 h and incubated overnight with primary antibodies: anti-β-actin (1:3000; T40104S, Abmart, Shanghai, China), anti-IBDV-VP2 (1:1,000; M032148S, Abmart, Shanghai, China), anti-Bax (1:000; 50599-2-Ig, Proteintech, Wuhan, China), anti-caspase-3 (1:1000; 66470-2-Ig, Proteintech, Wuhan, China), anti-Bcl-2 (1:1,000; MN50198, Abmart, Shanghai, China), anti-caspase-9 (1:1000; bs-8502R, Bioss, Beijing, China), anti-IκB-α (1:1,000; T55026, Abmart, Shanghai, China), anti-P65 (1:1000; P76367R1S, Abmart, Shanghai, China), anti-p-P65 (1:1000; bs-0982R, Bioss, Beijing, China), anti-p-PI3K (1:1000; TA4371, Abmart, Shanghai, China), anti-PI3K (1:1000; TA5121, Abmart, Shanghai, China), anti-p-AKT (1:1000; TA0016, Abmart, Shanghai, China), and anti-AKT (1:1000; PA1036, Abmart, Shanghai, China). Mouse anti-chicken PD-1 (1:100) and PD-L1 (1:100) monoclonal antibodies were produced and stored in our laboratory. After overnight incubation at 4°C, the membranes were washed and incubated with an appropriate HRP-conjugated goat anti-mouse/rabbit IgG antibody for approximately 2 h. Each protein signal was visualized using an enhanced chemiluminescent kit (Solarbio, Beijing, China). The band intensities of the target proteins were determined using ImageJ software version 5.0.

Flow Cytometry Assay

DT40 cells were seeded into 6-well cell culture plates at 80% cell confluence and infected with IBDV at an MOI of 1 for 24 h. Subsequently, the cells were treated with the unrelated peptide or peptide gCK-16 and incubated for 12 h. The effect of gCK-16 on cell apoptosis was assessed using an Annexin V-FITC/PI apoptosis detection kit (Beyotime, Shanghai, China) per the manufacturer's instructions and analyzed by flow cytometry.

Additionally, the surface expression of IgM on DT40 cells was measured according to a previously described protocol (Vidakovics et al., 2010). Briefly, after treatment with the peptide, IBDV-infected DT40 cells were collected and incubated on ice for 1 h with a rabbit anti-chicken IgM/FITC antibody (1:100, bs-0314R-FITC, Bioss, Beijing, China). Cell surface IgM expression was detected via flow cytometry.

Determination of Cellular Reactive Oxygen Species Levels

Intracellular reactive oxygen species (ROS) levels were measured using a Reactive Oxygen Species assay kit (Solarbio, Beijing, China). The treated DT40 cells were washed thrice with PBS, treated with a diluted dichlorodihydrofluorescein diacetate working solution (10 mM), incubated for 20 min at 37°C, and washed with a serum-free cell culture medium. Fluorescence was immediately measured using a fluorescence microscope (Nikon, Tokyo, Japan).

Enzyme-Linked Immunosorbent Assay

The treated cells were centrifuged at 3,000 rpm for 10 min to obtain the culture supernatants. The production of IgM in the supernatant was measured using a chicken IgM ELISA kit (Cloud-Clone Corp, Wuhan, China) according to the manufacturer's instructions.

Statistical Analysis

All results are presented as mean ± SE of at least 3 replicates per group. The statistical significance between the control and experimental groups was assessed using Student's t-test with GraphPad Prism software version 8.0. Significance was set at P < 0.05.

RESULTS

IBDV Infection Increases PD-1 and PD-L1 Expression in the BF of Chickens

The expression of PD-1 and PD-L1 was assessed in the BF tissues of IBDV-infected chickens 3 d post-infection (dpi). Clear bands were detected at 846 and 939 bp by PCR, corresponding to the coding region of chicken PD-1 and PD-L1, respectively (Figure 1A). Western blotting revealed that VP2, PD-1, and PD-L1 protein levels in the BF tissues were notably induced by IBDV (Figure 1B). Hence, IBDV infection increased PD-1 and PD-L1 protein levels in the BF of chickens.

Figure 1.

Figure 1

Open in a new tab

IBDV infection increases the expression of PD-1 and PD-L1 in the BF after IBDV infection. Three-wk-old chickens were inoculated with IBDV and euthanatized at 3 d postinfection (dpi). (A) Coding region sequences of chicken PD-1 and PD-L1 amplified by PCR. (B) VP2, PD-1, and PD-L1 protein abundance analyzed by western blotting. Mock group: chickens inoculated with PBS. Results are representative of 3 independent experiments and presented as the mean ± SE (*P < 0.05; **P < 0.01).

Peptide Discovery and Optimization

Based on the structure of the murine PD-1/human PD-L1 complex (PDB ID code 3BIK), the PD-1/PD-L1 interface was assembled with a 1:1 receptor-ligand stoichiometry of the extracellular IgV domains, similar to the IgV domains of antibodies (Lázár-Molnár et al., 2008; Lin et al., 2008). Residues A121, D122, Y123, and K124 in the G strand of PD-L1 contribute to the binding of PD-1 and are conserved among orthologs (mammals and birds) (Lin et al., 2008). Therefore, we speculated that the FG region of the extracellular IgV domain of chicken PD-L1 was strongly involved in binding to chicken PD-1. According to the homology alignment analysis and the PD-1 binding peptide published by Abbas et al. (2019), we designed peptide gDK2-3 with the sequence DAGLYHCLIEYGGADYKTINLK corresponding to the PD-1 binding region, predominantly located on the F and G strands of chicken PD-L1 (Figure 2A). Given that the structural diversity of the PD-L1-derived peptide gDK2-3 determines its affinity for PD-1, gDK2-3 was optimized through amino acid residue truncation. Specifically, the amino acid residues of gDK2-3 were truncated at the N- and C-termini to obtain eight homologous peptides (Figure 2B).

Figure 2.

Figure 2

Open in a new tab

Peptide design and optimization. (A) Alignment of the extracellular IgV domains of chicken PD-L1 with their mammalian orthologs using the DNAMAN software. The extracellular IgV domain of chicken PD-L1 comprised the B, C, E, F, and G strands. (B) gDK2-3 was optimized by amino acid residue truncation. Yellow box: residues with peptide gDK2-3; red asterisks: residues that contribute to PD-1 binding.

Binding Affinity of the Peptides for Chicken PD-1 Protein

To assess the affinity of the peptides for chicken PD-1 protein, KD values were determined using MST. The KD values for the affinity of peptides gLK-19, gCK-16, gEK-13, gGK-10, gDI-19, gDY-16, gDG-13, gDE-10, and gDK2-3 were 44.23 nM, 3.37 nM, 19.97 nM, 6.53 nM, 33.33 nM, 44.74 nM, 43.20 nM, 72.97 nM, and, 9.73 nM, respectively (Figure 3). Meanwhile, the affinity of the positive control chicken PD-L1 protein for chicken PD-1 protein was 2.65 nM, similar to that of peptide gCK-16 for chicken PD-1 protein. Hence, peptide gCK-16 has a high affinity for chicken PD-1 protein and was, thus, selected for further evaluation.

Figure 3.

Figure 3

Open in a new tab

Affinity analysis of peptides bound to chicken PD-1 protein using the MST method. Chicken PD-L1 protein (100 nM) is a positive control. KD mean values calculated after repeating 3 independent experiments.

Effect of Peptide on B Lymphocytes Viability and Proliferation

To investigate the effects of the synthesized peptides on B lymphocyte viability and proliferation, DT40 cells were treated with gCK-16, gGK-10, and gDK2-3 peptides. B-lymphocyte viability and proliferation were monitored using MTT and CCK-8 assays, respectively. The 3 peptides, at concentrations ranging from 10 to 500 nM, had no significant effect on cell viability (Figure 4A). However, peptide gCK-16 markedly increased DT40 cell proliferation for up to 72 h (Figure 4B). Hence, the peptides do not reduce B lymphocyte viability but accelerate their proliferation.

Figure 4.

Figure 4

Open in a new tab

Effect of peptides on B lymphocyte viability and proliferation. (A) DT40 cells treated with 10, 50, 250, and 500 nM of gCK-16, gDK2-3, and gGK-10 peptides for 24 h; cytotoxicity of peptides detected by MTT assay. (B) DT40 cells treated with 250 nM of gCK-16, gDK2-3, and gGK-10 peptides for 0, 12, 24, 48, and 72 h; DT40 cell proliferation analyzed by CCK-8 assay. Mock group: DT40 cells treated with PBS; Negative control: corresponding unrelated peptide. Results are representative of 3 independent experiments and presented as the mean ± SE (*P < 0.05; **P < 0.01).

Peptide gCK-16 Efficiently Blocks the PD-1/PD-L1 Interaction

Next, we examined the effect of peptide gCK-16 on the PD-1/PD-L1 interaction using a cell-based blocking assay (Figure 5A). Flow cytometry analysis showed that the fluorescence signals of the anti-His-AF594 antibody increased with increasing peptide concentrations in a dose-dependent manner (Figure 5B). This indicates that peptide gCK-16 can effectively block PD-1/PD-L1 interactions at the cellular level.

Figure 5.

Figure 5

Open in a new tab

Effect of peptide gCK-16 on PD-1/PD-L1 binding. The pEGFP-PD-1 plasmid was transfected into 293T cells and incubated for 48 h. (A) Schematic representation of the cell-based blocking assay. (B) Inhibitory activity of 2 to 100 nM peptides analyzed by flow cytometry; blocking efficacy of peptides calculated based on the fluorescence intensity of anti-His-AF594. Positive control: chicken PD-1-expressing 293T cells stained with 20 ng of His-tagged chicken PD-1; Negative control: cells treated with rabbit anti-His tag/AF594 conjugated antibody. Results are representative of 3 independent experiments and presented as the mean ± SE (*P < 0.05; **P < 0.01).

Peptide gCK-16 Inhibits IBDV-induced PD-1/PD-L1 Expression Levels in B Lymphocytes

To clarify the effect of peptide gCK-16 on PD-1 and PD-L1 expression in IBDV-infected DT40 cells, infected cells were treated with gCK-16. In infected cells, the IBDV load and VP2 protein expression increased gradually from 6 to 24 h postinfection (hpi) and gradually decreased until 72 hpi (Figures 6A and 6B). Moreover, the PD-1 and PD-L1 protein levels increased in IBDV-infected DT40 cells, peaking at 36 hpi (Figure 6B). Compared to the IBDV-infected group, the VP2, PD-1, and PD-L1 protein levels decreased with increasing gCK-16 peptide concentrations (Figure 6C). Hence, gCK-16 treatment decreases the abundance of PD-1 and PD-L1 in B lymphocytes after IBDV infection.

Figure 6.

Figure 6

Open in a new tab

Peptide gCK-16 decreases the expression of PD-1 and PD-L1 in IBDV-infected B lymphocytes. DT40 cells infected with IBDV at an MOI of 1 for 0, 6, 12, 24, 36, 48, and 72 h; (A) IBDV load determined by qRT-PCR. (B) VP2, PD-1, and PD-L1 protein levels determined by western blotting. (C) DT-40 cells infected with IBDV at an MOI of 1 for 24 h and treated with 2–100 nM peptide gCK-16 for 12 h; VP2, PD-1, and PD-L1 protein levels determined by western blotting. Negative control: the corresponding unrelated peptide. Results are representative of 3 independent experiments and presented as the mean ± SE (*P < 0.05; **P < 0.01).

Peptide gCK-16 Suppresses IBDV-Induced Apoptosis and ROS Production in B Lymphocytes

Flow cytometry and western blot assays were performed to evaluate the effect of gCK-16 on apoptosis in IBDV-infected B lymphocytes. The apoptosis rates were notably lower in cells treated with peptide gCK-16 than in the IBDV-infected group (Figures 7A and 7B). Moreover, the abundance of VP2, Bax, caspase-3, and caspase-9 was strongly decreased in the group treated with peptide gCK-16 compared to the IBDV-infected group. In contrast, Bcl-2 protein abundance was upregulated (Figure 7C).

Figure 7.

Figure 7

Open in a new tab

Peptide gCK-16 decreases apoptosis and ROS production in IBDV-infected B lymphocytes. DT40 cells infected with IBDV at an MOI of 1 for 24 h and treated with 50 to 100 nM peptide gCK-16 for 12 h. (A) DT40 cells apoptosis rates analyzed by flow cytometry after Annexin V-FITC/PI double staining. (B) Proportion of apoptotic DT40 cells normalized to the IBDV-infected group. (C) VP2, Bax, Bcl-2, caspase-3, and caspase-9 protein levels assessed by western blotting. (D) Intracellular ROS level detected by immunofluorescence staining (Scale bar: 30 μm). Mock group: DT40 cells treated with PBS; Negative control: corresponding unrelated peptide. Results are representative of 3 independent experiments and presented as the mean ± SE (*P < 0.05; **P < 0.01).

ROS accumulation contributes to B lymphocyte apoptosis after IBDV infection (Ingrao et al., 2013). Immunofluorescence staining showed that peptide gCK-16 reduced ROS production compared with the IBDV-infected group (Figure 7D). Hence, gCK-16 significantly decreases apoptosis and ROS accumulation in B lymphocytes after IBDV infection.

Peptide gCK-16 Inhibits IBDV-Induced NF-κB Activation in B Lymphocytes

We further explored the effect of peptide gCK-16 on NF-κB activity in IBDV-infected B lymphocytes. Peptide gCK-16 significantly reduced P65 mRNA expression while increasing that of IκB-α compared with the IBDV-infected group (Figures 8A and 8B). Additionally, the phosphorylation of P65 was significantly reduced, while IκB-α abundance was notably increased in the gCK-16-treated group compared to the IBDV-infected group (Figure 8C). These results suggest that peptide gCK-16 inhibits NF-κB activation in B lymphocytes after IBDV infection.

Figure 8.

Figure 8

Open in a new tab

Peptide gCK-16 inhibits NF-κB activation in IBDV-infected B lymphocytes. DT40 cells infected with IBDV at an MOI of 1 for 24 h and treated with 50–100 nM peptide gCK-16 for 12 h. (A) IκB-α and (B) P65 mRNA expression detected by qRT-PCR. (C) IκB-α and P65 protein levels evaluated by western blotting. Mock group: DT40 cells treated with PBS; Negative control: corresponding unrelated peptide. Results are representative of 3 independent experiments and presented as the mean ± SE (*P < 0.05; **P < 0.01).

Peptide gCK-16 Reverses IBDV-induced PI3K/AKT Signaling in B Lymphocytes

To evaluate the effect of peptide gCK-16 on PI3K/AKT signaling in IBDV-infected B lymphocytes, IBDV-infected DT40 cells were treated with gCK-16. The PI3K and AKT mRNA expression levels were notably decreased in the group treated with gCK-16 compared with the IBDV-infected group (Figures 9A and 9B). Consistent with the qRT-PCR data, peptide gCK-16 significantly reduced the phosphorylation levels of PI3K and AKT in DT40 cells during IBDV infection (Figure 9C). These results suggest peptide gCK-16 reverses BCR signaling in B lymphocytes after IBDV infection.

Figure 9.

Figure 9

Open in a new tab

Peptide gCK-16 reverses PI3K/AKT signaling suppression in IBDV-infected B lymphocytes. DT40 cells infected with IBDV at an MOI of 1 for 24 h and treated with 50–100 nM peptide gCK-16 for 12 h. (A) PI3K and (B) AKT mRNA expression detected by qRT-PCR. (C) PI3K and AKT protein levels evaluated by western blotting. Mock group: DT40 cells treated with PBS; Negative control: unrelated peptide. Results are representative of 3 independent experiments and presented as the mean ± SE (*P < 0.05; **P < 0.01).

Peptide gCK-16 Inhibits IBDV-induced Downregulation of IgM Levels in B Lymphocytes

Next, we evaluated the effect of peptide gCK-16 on IgM expression in IBDV-infected B lymphocytes. The IgM mRNA expression increased significantly in the group treated with gCK-16 compared with the IBDV-infected group (Figure 10A). ELISA further confirmed that secreted IgM levels were increased in the group treated with gCK-16 compared with the infected group (Figure 10B).

Figure 10.

Figure 10

Open in a new tab

Peptide gCK-16 prevents IgM downregulation in IBDV-infected B lymphocytes. DT40 cells infected with IBDV at an MOI of 1 for 24 h and treated with 50–100 nM peptide gCK-16 for 12 h. (A) IgM mRNA detected by qRT-PCR. (B) Secreted IgM levels detected by ELISA. (C) Surface expression of IgM by DT40 cells measured by flow cytometry. (D) Gluorescence intensity of anti-Chicken-IgM-FITC normalized to the mock group. Mock group: DT40 cells treated with PBS; Negative control: corresponding unrelated peptide. Results are representative of 3 independent experiments and presented as the mean ± SE (*P < 0.05; **P < 0.01).

Considering that IgM is a surface activation marker and a membrane-bound antibody on B lymphocytes, we further assessed surface IgM expression in DT40 cells by flow cytometry. The expression of IgM was notably enhanced in IBDV-infected DT40 cells treated with gCK-16 (Figures 10C and D). Hence, gCK-16 enhances the effector function of B lymphocytes after IBDV infection.

DISCUSSION

PD-1 and PD-L1 are widely recognized as crucial checkpoints for host immunoinhibitory molecules in chronic viral infections (Jubel et al., 2020). Meanwhile, anti-PD-1/PD-L1 antibodies induce PD-1/PD-L1 blockade and activate immune responses (Wu et al., 2022; Okagawa et al., 2023). Additionally, peptides that block PD-1/PD-L1 binding are suitable for treating autoimmune diseases and drug development (Abbas et al., 2019; Liu et al., 2019; Bojko et al., 2022). However, no peptides specific for chicken PD-1/PD-L1 have been reported. Herein, we report a new peptide, gCK-16, that targets PD-1 and interrupts the PD-1/PD-L1 pathway, improving the effector functions of B lymphocytes.

IBDV directly destroys the germinal center of the BF, suppressing host immune responses in infected chickens. Meanwhile, Marek's disease virus (MDV) infection induces immunosuppression by activating the PD-1/PD-L1 pathway and contributes to disease progression in chickens (Matsuyama-Kato et al., 2012). However, information on PD-1/PD-L1 expression in IBDV infection remains largely unknown. Our results show that PD-1 and PD-L1 expression markedly increases in the BF of IBDV-infected chickens.

Synthetic peptides have been extensively reported as effective therapeutics for PD-1/PD-L1 blockade in cancer immunotherapy (Zhai et al., 2021; Shen et al., 2023). In this study, we designed a targeted chicken PD-1 peptide, gCK-16, using a homology alignment analysis. The KD values from the MST assay were evaluated to determine the binding affinity between the peptide and PD-1 (Li et al., 2018). Our findings confirmed that gCK-16 exhibited a high binding affinity for PD-1 (KD: 3.37 nm), similar to that between PD-1 and PD-L1.

The effects of peptides on immune cell viability and proliferation are important indicators for evaluating peptide-based therapeutics for immunotherapy. The peptides designed in this study did not exhibit direct cytotoxicity but increased the proliferation of DT40 cells. Using a cell-based blocking method, we found that the inhibitory activity of the peptide was consistent with the MST results in a dose-dependent manner. Hence, the peptides have a strong affinity for the PD-1 protein and can inhibit the PD-1/PD-L1 pathway in vitro.

B lymphocyte exhaustion can enhance PD-1/PD-L1 signaling during chronic infection; however, senescent cells rarely express these markers, promoting immune escape (Jiang et al., 2019; Lu et al., 2022). Moreover, IBDV infection causes the rapid depletion and apoptosis of IgM-bearing B lymphocytes in the BF of chickens, facilitating viral replication (Zhang et al., 2024). To confirm the effect of the peptides on IBDV-induced PD-1/PD-L1 expression, we measured the PD-1 and PD-L1 protein levels in B lymphocytes treated with gCK-16 after infection with IBDV. Our findings revealed that downregulation of the PD-1/PD-L1 pathway were enhanced by peptide treatment, confirming the immunomodulatory effect of gCK-16 on IBDV-infected B lymphocytes.

Apoptosis is a host defense mechanism initiated against specific pathogens that plays a major role in IBDV pathogenesis (Qin et al., 2017; Li and Zheng, 2020). IBDV directly induces the excessive apoptosis of B lymphocytes, producing more virions (Duan et al., 2020). Our findings demonstrated that peptide treatment significantly reduced the abundances of Bax, caspase-3, and caspase-9 in IBDV-infected B lymphocytes while increasing that of Bcl-2. Furthermore, NF-κB is widely recognized as a target transcription factor in immune response regulation (Guo et al., 2024). IBDV can activate NF-κB signaling via ROS accumulation in chicken B lymphocytes (Ingrao et al., 2013). In vitro, we found that treatment with the peptides markedly decreased ROS accumulation and P65 and IκB-α levels after IBDV infection. These findings suggest that the peptides lessen the degree of IBDV-induced NF-κB activation and apoptosis in B lymphocytes, inhibiting IBDV replication.

BCR signaling is vital for the survival of normal B lymphocytes and largely relies on PI3K-mediated signaling (Xu et al., 2021). PD-1 overexpression reduces B lymphocyte activation by suppressing BCR-mediated PI3K/AKT signaling (Jiang et al., 2019; Li et al., 2024). Similarly, inhibiting PI3K/AKT signaling can reinforce the upregulation of PD-1 expression (Mi et al., 2021). Moreover, PI3K/AKT is believed to negatively regulate apoptosis as the downstream signaling cascade of the BCR in response to viral infection (Xiang and Wang, 2018; Lahon et al., 2021; Vidal et al., 2022). Various viruses have been widely studied for their ability to alter the PI3K/AKT pathway, including duck Tembusu virus and Zika virus (Liang et al., 2016; Zhao et al., 2022). Additionally, IBDV can induce autophagy by suppressing AKT/mTOR signaling cascades in chicken embryo fibroblast cells and inducing apoptosis in B lymphocytes, promoting viral replication (Quan et al., 2017; Liu et al., 2021; Yu et al., 2022). Hence, the repression of the PI3K/AKT/mTOR pathway is largely correlated with apoptotic signaling molecules during IBDV infection. However, whether the PI3K/AKT pathway is positively associated with IBDV-induced B lymphocyte depletion is unclear. Our findings revealed that IBDV infection failed to induce PI3K/AKT activation in B lymphocytes, consistent with previous studies (Hu et al., 2015). Meanwhile, peptide gCK-16 markedly increased PI3K and AKT phosphorylation after IBDV infection. Hence, peptide gCK-16 promotes the proliferation of B lymphocytes and inhibits apoptosis by inhibiting the PI3K/AKT pathway in IBDV-infected B lymphocytes.

Notably, B lymphocyte activation induces IgM expression on the cell surface (Lam et al., 2020). We previously reported that surface IgM acts as a membrane protein that interacts with IBDV and promotes virus binding to B lymphocytes in a virulence-independent manner (Chi et al., 2018). Additionally, PD-1 activation can reduce the capacity of B lymphocytes to recognize antigens and produce corresponding antibodies (Mi et al., 2021; Lu et al., 2022). Notably, IBDV directly affects immune function by destroying IgM+ B lymphocytes and decreasing IgM secretion in the BF of chickens infected with IBDV (Huang et al., 2021). These results are consistent with our current findings, that gCK-16 treatment reverses the IBDV-induced downregulation of IgM secretion by B lymphocytes. Nevertheless, additional studies with a larger chicken sample size are required to confirm the potential clinical application of gCK-16 against IBDV infection. Additionally, the specific molecular mechanisms by which the peptides enhance the activation and function of B cells during IBDV infection warrant further investigation.

In summary, we developed a peptide, gCK-16, using homology alignment and amino acid residue truncation that exhibits a high affinity for PD-1 and effectively inhibits PD-1/PD-L1 binding. Moreover, gCK-16 treatment disrupts the PD-1/PD-L1 pathway and restores B lymphocyte function by activating the PI3K/AKT pathway during IBDV infection. Taken together, our findings provide new avenues for recovering B lymphocyte function during IBDV infection. These results can inform the development of effective vaccine adjuvants against IBDV or other immunosuppressive viruses in chickens.

DISCLOSURES

The authors declare no conflicts of interest.

ACKNOWLEDGMENTS

This study was funded by the National Natural Science Foundation of China (grant numbers 32472992, 31272539, and 31672540). We would like to thank Professor Jinyou Ma of the Henan Institute of Science and Technology for his assistance with the animal experiments.

Authors Contribution: Qiuyu Zhang performed the experiments and wrote the manuscript. Guopeng Sun and Yangzhao Zhu provided guidance and support. Zhike Liu and Peng Li analyzed the experimental data. Ruiyan Niu and Feng Yue contributed to the collection of experimental samples. Zilong Sun and Xuannian Wang conceived and designed the study. Zilong Sun, Xuannian Wang, and Gaiping Zhang supervised the project and revised the manuscript. All authors approved the final manuscript.

REFERENCES

  1. Abbas A.B., Lin B., Liu C., Morshed A., Hu J., Xu H. Design and synthesis of A PD-1 binding peptide and evaluation of its anti-tumor activity. Int. J. Mol. Sci. 2019;20:572. doi: 10.3390/ijms20030572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bojko M., Węgrzyn K., Sikorska E., Kocikowski M., Parys M., Battin C., Steinberger P., Kogut M.M., Winnicki M., Sieradzan A.K., Spodzieja M., Rodziewicz-Motowidło S. Design, synthesis and biological evaluation of PD-1 derived peptides as inhibitors of PD-1/PD-L1 complex formation for cancer therapy. Bioorg. Chem. 2022;128 doi: 10.1016/j.bioorg.2022.106047. [DOI] [PubMed] [Google Scholar]
  3. Chi J., You L., Li P., Teng M., Zhang G., Luo J., Wang A. Surface IgM λ light chain is involved in the binding and infection of infectious bursal disease virus (IBDV) to DT40 cells. Virus Genes. 2018;54:236–245. doi: 10.1007/s11262-018-1535-6. [DOI] [PubMed] [Google Scholar]
  4. Day C.L., Kaufmann D.E., Kiepiela P., Brown J.A., Moodley E.S., Reddy S., Mackey E.W., Miller J.D., Leslie A.J., DePierres C., Mncube Z., Duraiswamy J., Zhu B., Eichbaum Q., Altfeld M., Wherry E.J., Coovadia H.M., Goulder P.J., Klenerman P., Ahmed R., Freeman G.J., Walker B.D. PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression. Nature. 2006;443:350–354. doi: 10.1038/nature05115. [DOI] [PubMed] [Google Scholar]
  5. Dong Y., Li X., Zhang L., Zhu Q., Chen C., Bao J., Chen Y. CD4+ T cell exhaustion revealed by high PD-1 and LAG-3 expression and the loss of helper T cell function in chronic hepatitis B. BMC. Immunol. 2019;20:27. doi: 10.1186/s12865-019-0309-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Duan X., Zhao M., Wang Y., Li X., Cao H., Zheng S.J. Epigenetic upregulation of chicken MicroRNA-16-5p expression in DF-1 Cells following Infection with Infectious Bursal Disease Virus (IBDV) Enhances IBDV-Induced Apoptosis and Viral Replication. J. Virol. 2020;94 doi: 10.1128/JVI.01724-19. e01724-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Fetse J., Zhao Z., Liu H., Mamani U.F., Mustafa B., Adhikary P., Ibrahim M., Liu Y., Patel P., Nakhjiri M., Alahmari M., Li G., Cheng K. Discovery of cyclic peptide inhibitors targeting PD-L1 for cancer immunotherapy. J. Med. Chem. 2022;65:12002–12013. doi: 10.1021/acs.jmedchem.2c00539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Goodman A., Patel S.P., Kurzrock R. PD-1-PD-L1 immune-checkpoint blockade in B-cell lymphomas. Nat. Rev. Clin. Oncol. 2017;14:203–220. doi: 10.1038/nrclinonc.2016.168. [DOI] [PubMed] [Google Scholar]
  9. Guo Q., Jin Y., Chen X., Ye X., Shen X., Lin M., Zeng C., Zhou T., Zhang J. NF-κB in biology and targeted therapy: new insights and translational implications. Signal. Transduct. Target. Ther. 2024;9:53. doi: 10.1038/s41392-024-01757-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hu B., Zhang Y., Jia L., Wu H., Fan C., Sun Y., Ye C., Liao M., Zhou J. Binding of the pathogen receptor HSP90AA1 to avibirnavirus VP2 induces autophagy by inactivating the AKT-MTOR pathway. Autophagy. 2015;11:503–515. doi: 10.1080/15548627.2015.1017184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Huang X., Liu W., Zhang J., Liu Z., Wang M., Wang L., Zhou H., Jiang Y., Cui W., Qiao X., Xu Y., Li Y., Tang L. Very virulent infectious bursal disease virus-induced immune injury is involved in inflammation, apoptosis, and inflammatory cytokines imbalance in the bursa of fabricius. Dev. Comp. Immunol. 2021;114 doi: 10.1016/j.dci.2020.103839. [DOI] [PubMed] [Google Scholar]
  12. Ingrao F., Rauw F., Lambrecht B., van den Berg T. Infectious Bursal Disease: a complex host-pathogen interaction. Dev. Comp. Immunol. 2013;41:429–438. doi: 10.1016/j.dci.2013.03.017. [DOI] [PubMed] [Google Scholar]
  13. Jubel J.M., Barbati Z.R., Burger C., Wirtz D.C., Schildberg F.A. The role of PD-1 in acute and chronic infection. Front Immunol. 2020;11:487. doi: 10.3389/fimmu.2020.00487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jiang X., Wang J., Deng X., Xiong F., Ge J., Xiang B., Wu X., Ma J., Zhou M., Li X., Li Y., Li G., Xiong W., Guo C., Zeng Z. Role of the tumor microenvironment in PD-L1/PD-1-mediated tumor immune escape. Mol. Cancer. 2019;18:10. doi: 10.1186/s12943-018-0928-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Liu Y., Liu S., Wu C., Huang W., Xu B., Lian S., Wang L., Yue S., Chen N., Zhu Z. PD-1-mediated PI3K/Akt/mTOR, Caspase 9/Caspase 3 and ERK pathways are involved in regulating the apoptosis and proliferation of CD4+ and CD8+ T cells during BVDV infection in vitro. Front. Immunol. 2020;11:467. doi: 10.3389/fimmu.2020.00467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lu J., Wu J., Mao L., Xu H., Wang S. Revisiting PD-1/PD-L pathway in T and B cell response: Beyond immunosuppression. Cytokine Growth Factor Rev. 2022;67:58–65. doi: 10.1016/j.cytogfr.2022.07.003. [DOI] [PubMed] [Google Scholar]
  17. Li J., Liu S., Dong Q., Fu Y., Sun Y., Luo R., Tian X., Guo L., Liu W., Qiu Y., Lu Q., Ye C., Zong B., Fu S. PD-1/PD-L1 axis induced host immunosuppression via PI3K/Akt/mTOR signalling pathway in piglets infected by Glaesserella Parasuis. BMC Vet. Res. 2024;20:141. doi: 10.1186/s12917-024-03993-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu H., Zhao Z., Zhang L., Li Y., Jain A., Barve A., Jin W., Liu Y., Fetse J., Cheng K. Discovery of low-molecular weight anti-PD-L1 peptides for cancer immunotherapy. J. Immunother. Cancer. 2019;7:270. doi: 10.1186/s40425-019-0705-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lázár-Molnár E., Yan Q., Cao E., Ramagopal U., Nathenson S.G., Almo S.C. Crystal structure of the complex between programmed death-1 (PD-1) and its ligand PD-L2. Proc. Natl. Acad. Sci. U. S. A. 2008;105:10483–10488. doi: 10.1073/pnas.0804453105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lin D.Y., Tanaka Y., Iwasaki M., Gittis A.G., Su H.P., Mikami B., Okazaki T., Honjo T., Minato N., Garboczi D.N. The PD-1/PD-L1 complex resembles the antigen-binding Fv domains of antibodies and T cell receptors. Proc. Natl. Acad. Sci. U. S. A. 2008;105:3011–3016. doi: 10.1073/pnas.0712278105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li C., Zhang N., Zhou J., Ding C., Jin Y., Cui X., Pu K., Zhu Y. Peptide blocking of PD-1/PD-L1 interaction for cancer immunotherapy. Cancer Immunol Res. 2018;6:178–188. doi: 10.1158/2326-6066.CIR-17-0035. [DOI] [PubMed] [Google Scholar]
  22. Li J., Zheng S.J. Role of MicroRNAs in host defense against infectious bursal disease virus (IBDV) infection: a hidden front line. Viruses. 2020;12:543. doi: 10.3390/v12050543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liang Q., Luo Z., Zeng J., Chen W., Foo S.S., Lee S.A., Ge J., Wang S., Goldman S.A., Zlokovic B.V., Zhao Z., Jung J.U. Zika Virus NS4A and NS4B proteins deregulate Akt-mTOR signaling in human fetal neural stem cells to inhibit neurogenesis and induce autophagy. Cell Stem Cell. 2016;19:663–671. doi: 10.1016/j.stem.2016.07.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liu M., Wei F., Wang J., Yu W., Shen M., Liu T., Zhang D., Wang Y., Ren X., Sun Q. Myeloid-derived suppressor cells regulate the immunosuppressive functions of PD-1-PD-L1+ Bregs through PD-L1/PI3K/AKT/NF-κB axis in breast cancer. Cell Death Dis. 2021;12:465. doi: 10.1038/s41419-021-03745-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lam J.H., Smith F.L., Baumgarth N. B cell activation and response regulation during viral infections. Viral Immunol. 2020;33:294–306. doi: 10.1089/vim.2019.0207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lahon A., Arya R.P., Banerjea A.C. Dengue virus dysregulates master transcription factors and PI3K/AKT/mTOR signaling pathway in megakaryocytes. Front. Cell Infect. Microbiol. 2021;11 doi: 10.3389/fcimb.2021.715208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Matsuyama-Kato A., Murata S., Isezaki M., Kano R., Takasaki S., Ichii O., Konnai S., Ohashi K. Molecular characterization of immunoinhibitory factors PD-1/PD-L1 in chickens infected with Marek's disease virus. Virol. J. 2012;9:94. doi: 10.1186/1743-422X-9-94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mi Y., Han J., Zhu J., Jin T. Role of the PD-1/PD-L1 signaling in multiple sclerosis and experimental autoimmune encephalomyelitis: Recent insights and future directions. Mol. Neurobiol. 2021;58:6249–6271. doi: 10.1007/s12035-021-02495-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nishibori S., Kaneko M.K., Nakagawa T., Nishigaki K., Kato Y., Igase M., Mizuno T. Development of anti-feline PD-1 antibody and its functional analysis. Sci. Rep. 2023;13:6420. doi: 10.1038/s41598-023-31543-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Okagawa T., Konnai S., Goto S., Sajiki Y., Ganbaatar O., Watari K., Nakamura H., Wang C.X., Tachibana T., Kato Y., Kameda Y., Kohara J., Terasaki N., Kubota M., Takeda A., Takahashi H., Suzuki Y., Maekawa N., Murata S., Ohashi K. Development of a high-affinity anti-bovine PD-1 rabbit-bovine chimeric antibody using an efficient selection and large production system. Vet. Res. 2023;54:82. doi: 10.1186/s13567-023-01213-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pan C., Yang H., Lu Y., Hu S., Wu Y., He Q., Dong X. Recent advance of peptide-based molecules and nonpeptidic small-molecules modulating PD-1/PD-L1 protein-protein interaction or targeting PD-L1 protein degradation. Eur. J. Med. Chem. 2021;213 doi: 10.1016/j.ejmech.2021.113170. [DOI] [PubMed] [Google Scholar]
  32. Pauken K.E., Torchia J.A., Chaudhri A., Sharpe A.H., Freeman G.J. Emerging concepts in PD-1 checkpoint biology. Semin. Immunol. 2021;52 doi: 10.1016/j.smim.2021.101480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Pierau M., Na S.Y., Simma N., Lowinus T., Marx A., Schraven B., Bommhardt U.H. Constitutive Akt1 signals attenuate B-cell receptor signaling and proliferation, but enhance B-cell migration and effector function. Eur. J. Immunol. 2012;42:3381–3393. doi: 10.1002/eji.201242397. [DOI] [PubMed] [Google Scholar]
  34. Quan R., Zhu S., Wei L., Wang J., Yan X., Li Z., Liu J. Transcriptional profiles in bursal B-lymphoid DT40 cells infected with very virulent infectious bursal disease virus. Virol. J. 2017;14:7. doi: 10.1186/s12985-016-0668-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Qin Y., Xu Z., Wang Y., Li X., Cao H., Zheng S.J. VP2 of infectious bursal disease virus induces apoptosis via triggering oral cancer overexpressed 1 (ORAOV1) protein degradation. Front. Microbiol. 2017;8:1351. doi: 10.3389/fmicb.2017.01351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Reddy V.R.A.P., Mwangi W., Sadigh Y., Nair V. In vitro interactions of chicken programmed cell death 1 (PD-1) and PD-1 ligand-1 (PD-L1) Front. Cell. Infect. Microbiol. 2019;9:436. doi: 10.3389/fcimb.2019.00436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Setta A., Yehia N., Shaheen M., Shami A., Al-Saeed F.A., Alsamghan A., Amin R., El-Saadony M.T., El-Tarabily K.A., Salem H.M. Continuous clinicopathological and molecular recognition of very virulent infectious bursal disease virus in commercial broiler chickens. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Shen B., Cao Z., Li W., Sabatier J.M., Wu Y. Treating autoimmune disorders with venom-derived peptides. Expert. Opin. Biol. Ther. 2017;17:1065–1075. doi: 10.1080/14712598.2017.1346606. [DOI] [PubMed] [Google Scholar]
  39. Shen W., Shi P., Dong Q., Zhou X., Chen C., Sui X., Tian W., Zhu X., Wang X., Jin S., Wu Y., Chen G., Qiu L., Zhai W., Gao Y. Discovery of a novel dual-targeting D-peptide to block CD24/Siglec-10 and PD-1/PD-L1 interaction and synergize with radiotherapy for cancer immunotherapy. J. Immunother. Cancer. 2023;11 doi: 10.1136/jitc-2023-007068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Vidakovics M.L., Jendholm J., Mörgelin M., Månsson A., Larsson C., Cardell L.O., Riesbeck K. B cell activation by outer membrane vesicles–a novel virulence mechanism. PLoS Pathog. 2010;6 doi: 10.1371/journal.ppat.1000724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Vanhersecke L., Brunet M., Guégan J.P., Rey C., Bougouin A., Cousin S., Moulec S.L., Besse B., Loriot Y., Larroquette M., Soubeyran I., Toulmonde M., Roubaud G., Pernot S., Cabart M., Chomy F., Lefevre C., Bourcier K., Kind M., Giglioli I., Sautès-Fridman C., Velasco V., Courgeon F., Oflazoglu E., Savina A., Marabelle A., Soria J.C., Bellera C., Sofeu C., Bessede A., Fridman W.H., Loarer F.L., Italiano A. Mature tertiary lymphoid structures predict immune checkpoint inhibitor efficacy in solid tumors independently of PD-L1 expression. Nat. Cancer. 2021;2:794–802. doi: 10.1038/s43018-021-00232-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Vidal S., Bouzaher Y.H., El Motiam A., Seoane R., Rivas C. Overview of the regulation of the class IA PI3K/AKT pathway by SUMO. Semin. Cell. Dev. Biol. 2022;132:51–61. doi: 10.1016/j.semcdb.2021.10.012. [DOI] [PubMed] [Google Scholar]
  43. Wang S., Yu M., Liu A., Bao Y., Qi X., Gao L., Chen Y., Liu P., Wang Y., Xing L., Meng L., Zhang Y., Fan L., Li X., Pan Q., Zhang Y., Cui H., Li K., Liu C., He X., Gao Y., Wang X. TRIM25 inhibits infectious bursal disease virus replication by targeting VP3 for ubiquitination and degradation. PLoS Pathog. 2021;17 doi: 10.1371/journal.ppat.1009900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wang W., Huang Y., Zhang Y., Qiao Y., Deng Q., Chen R., Chen J., Huang T., Wei T., Mo M., He X., Wei P. The emerging naturally reassortant strain of IBDV (genotype A2dB3) having segment A from Chinese novel variant strain and segment B from HLJ 0504-like very virulent strain showed enhanced pathogenicity to three-yellow chickens. Transbound. Emerg. Dis. 2022;69:e566–e579. doi: 10.1111/tbed.14336. [DOI] [PubMed] [Google Scholar]
  45. Wang A.G., Sun G., Li B., Yue F., Zhang Y., Zhu Y., Yin M., Yang Y., Guo D., Wang X. An elementary analysis for PD-1, PD-L1 and PD-L2 genes transcription level of peripheral blood lymphocytes in chicken after IBDV infection. Acta Veterinaria et Zootechnic Sinica. 2014;4545:654–660. [Google Scholar]
  46. Wang M., Wang J., Wang R., Jiao S., Wang S., Zhang J., Zhang M. Identification of a monoclonal antibody that targets PD-1 in a manner requiring PD-1 Asn58 glycosylation. Commun. Biol. 2019;2:392. doi: 10.1038/s42003-019-0642-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wu Y.T., Fang Y., Wei Q., Shi H., Tan H., Deng Y., Zeng Z., Qiu J., Chen C., Sun L., Chen Z.J. Tumor-targeted delivery of a STING agonist improvescancer immunotherapy. Proc. Natl. Acad. Sci. U. S. A. 2022;119 doi: 10.1073/pnas.2214278119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Xiang K., Wang B. Role of the PI3K-AKT-mTOR pathway in hepatitis B virus infection and replication. Mol. Med. Rep. 2018;17:4713–4719. doi: 10.3892/mmr.2018.8395. [DOI] [PubMed] [Google Scholar]
  49. Xu-Monette Z.Y., Zhou J., Young K.H. PD-1 expression and clinical PD-1 blockade in B-cell lymphomas. Blood. 2018;131:68–83. doi: 10.1182/blood-2017-07-740993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Xu W., Berning P., Lenz G. Targeting B-cell receptor and PI3K signaling in diffuse large B-cell lymphoma. Blood. 2021;138:1110–1119. doi: 10.1182/blood.2020006784. [DOI] [PubMed] [Google Scholar]
  51. Yin H., Zhou X., Huang Y.H., King G.J., Collins B.M., Gao Y., Craik D.J., Wang C.K. Rational design of potent peptide inhibitors of the PD-1:PD-L1 interaction for cancer immunotherapy. J. Am. Chem. Soc. 2021;143:18536–18547. doi: 10.1021/jacs.1c08132. [DOI] [PubMed] [Google Scholar]
  52. Yu M., Li R., Wan M., Chen J., Shen X., Li G., Ge M., Zhang R. MDA5 attenuate autophagy in chicken embryo fibroblasts infected with IBDV. Br. Poult. Sci. 2022;63:154–163. doi: 10.1080/00071668.2021.1969643. [DOI] [PubMed] [Google Scholar]
  53. Zyla E., Musielak B., Holak T.A., Dubin G. Structural characterization of a macrocyclic peptide modulator of the PD-1/PD-L1 immune checkpoint axis. Molecules. 2021;26:4848. doi: 10.3390/molecules26164848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhai W., Zhou X., Zhai M., Li W., Ran Y., Sun Y., Du J., Zhao W., Xing L., Qi Y., Gao Y. Blocking of the PD-1/PD-L1 interaction by a novel cyclic peptide inhibitor for cancer immunotherapy. Sci. China. Life. Sci. 2021;64:548–562. doi: 10.1007/s11427-020-1740-8. [DOI] [PubMed] [Google Scholar]
  55. Zhang T., Wang S., Liu Y., Qi X., Gao Y. Advances on adaptive immune responses affected by infectious bursal disease virus in chicken. Front. Immunol. 2024;14 doi: 10.3389/fimmu.2023.1330576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zhao J., Zhang T., Chen G., Geng N., Guo Z., Cao S., Yang Y., Liu K., Wang S., Zhao Y., Meng F., Liu S., Jiang M., Li N. Non-structural protein 3 of duck tembusu virus induces autophagy via the ERK and PI3K-AKT-mTOR signaling pathways. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.746890. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES