Abstract
Humans and animals may get Q fever, which is caused by the Gram-negative coccobacillus Coxiella burnetii. The symptoms of Q fever may include a self-limiting febrile illness, pneumonia, endocarditis, or hepatitis. Infections are classified as either acute or persistent. Cattle, sheep, and goats are the most prevalent reservoir animals for this zoonosis. This research was conducted to identify C. burnetii using transposable and isocitrate dehydrogenase genes (IS1111, icd) and QpH1 plasmids. A total of 142 samples of raw buffalo and cow milk were collected from various locations within the West Azerbaijan region (see map). We used "nested" PCR techniques using primers based on the IS1111 and icd genes of C. burnetii, as well as conserved and variable portions of plasmid sequences, to identify C. burnetii and their plasmids in milk samples from buffalo and calves. Out of 142 milk samples that were positive for the chromosomal transposable genes (IS1111 and icd) at a rate of 16.9 percent (95 percent CI: 14.5 percent to 19.6 percent) and 7.1 % (95 percent CI: 5.59 percent to 9.08 percent), respectively, 86 samples were positive for the QpH1 plasmid at a rate of 60.5 percent (95 percent CI: 52.35 percent to 68.2 percent). Based on a phylogenetic study of the icd and QpH1 genes, the majority of the isolates had a similarity of 99.45–99.9 percent. Conclusion: It was determined that the buffalo population in West Azerbaijan province represents a significant epidemiological factor with respect to Q fever and consequently public health.
Keywords: Buffalo, Cattle, Coxiella burnetii, Milk, Nested-PCR, Plasmid
1. Introduction
Q fever is a zoonotic disease that caused by Coxiella burnetii, a Gram-negative bacterium that affects humans and animals. Infections can be transmitted to humans through inhalation of bacteria from infected animals, direct contact with infected animals, or consumption of contaminated products such as milk and dairy items [1,2].
Q fever in humans is mostly transmitted by domestic animals such as sheep, goats, and cattle [3]. C. burnetii is shed in milk, urine, feces and birthing materials [4]. Q fever is an underreported and poorly understood illness that affects people throughout the year. However, the majority of instances occur in the spring and early summer, particularly during calving and lambing season. C. burnetii is found in large amounts in birthing materials from infected animals whether they exhibit symptoms or not. While large amounts of bacteria can sometimes be found in milk, it is not present in urine and feces [4].
However, lipopolysaccharide, restriction fragment length polymorphism [5], and plasmid types are utilized to distinguish between acute and chronic C. burnetii isolates [5]. The techniques used to determine the type of C. burnetii strains include Genome RFLP, PFGE, Sequencing, and PCR-RFLP. More recently, two PCR-based techniques, MLVA and MST, have been developed to specify C. burnetii types without the need for bacterial isolation (OIE). These genotyping methods are essential in distinguishing between strains of the same species, which has significant implications for disease diagnosis, treatment, outbreak investigation, surveying epidemics, and conducting epidemiological studies. Whole genome sequencing is the fundamental technique used to compare different strains. Fortunately, advancements in sequencing technologies have resulted in a considerable reduction in costs. However, it may still present challenges for many laboratories when it comes to strain comparison [6].
Several important genotyping methods have been employed to study C. burnetii, including com1, IS1111 Sequencing, SNP, RFLP, MLST, and MLVA [6]. It's worth noting that acute isolates of C. burnetii possess a 36-kbp plasmid called QpH1. DNA hybridization studies have revealed that QpH1 contains a 6-kbp region of DNA that is not found in the QpRS plasmid from chronic isolates [7].
When epidemics occur, Q fever significantly impacts public health. Each epidemic typically involves up to 415 laboratory-confirmed human cases and these cases are regularly reported globally. Outbreaks of Q fever is usually confined to specific areas and are short-lived, lasting only for one episode. Sheep are the primary source of these outbreaks, with goats being the secondary source. However, the Dutch Q fever epidemic was exceptional due to its duration. Additionally, there have been documented instances of outbreaks associated with the consumption of cow and buffalo (buffalo) milk [8].
Thus, genotyping of the C. burnetii strains implicated is preferred for source identification and confirmation of the connection to human illness. In the investigation by Porten et al. (2006), nine isolates were grouped together with sheep and a human isolate was connected to a Q-fever epidemic that occurred in North Rhine Westphalia in 2003 [9]. Earlier research [10] indicates that Q fever is a problem for public health in several locations in Iran. Additionally, in the study by Mobarez et al. (2022), five genotypes of C. burnetii were identified among ruminants in Iran using the MST method [11]. Data on the prevalence of Q fever in domestic and wild animals also suggest that Q fever is common in Iran. It has been reported that a lack of level 3 diagnostics laboratory infrastructure and a lack of knowledge may make it difficult to quickly identify cases of Q fever, thus endangering public health. The prevalence of C. burnetii in milk from different regions of Iran has been reported to range from 4.22 % to 25.55 % [12]. Urmia city is the center of West Azerbaijan province, located in the northwest of Iran. Iran has approximately 523 thousand buffaloes, 27.7 % of which are Azeri buffaloes, residing in West Azerbaijan province [13]. In this research, our objective was to identify C. burnetii by employing primers designed for IS1111 and icd genes, while also verifying the presence of the QpH1 plasmid to distinguish between acute and chronic forms of the disease.
2. Material and methods
2.1. Stady area
The present study was conducted in West Azerbaijan Province, situated in the northwestern region of Iran. Its geographical coordinates are 37° 33′ 10.08″ N, 45° 4′ 33.24″ E (https://tools.wmflabs.org). The climate of West Azerbaijan is significantly influenced by the moist winds originating from the Atlantic Ocean and the Mediterranean. The province is subject to the influence of cold northern winds during the winter months, resulting in the accumulation of significant snowfall (https://www.britannica.com/place/Azerbaijan-region-Iran) (Fig. 1).
Fig. 1.
The schematic map of the study areas, West Azerbaijan province, Iran.
2.2. Milk sampling
In this investigation, 840 milk samples from 420 cattle and 420 buffaloes from 84 dairy farms were collected over the course of four seasons in 2021 in the north, center, and south of West Azerbaijan province. Three age categories of the sampled animals <6 years, 6–10 years, and older than 10 years were created. All samples were sent in a cold bag to the Microbiology Laboratory.
2.3. DNA extraction from milk samples
In order to extract DNA from milk samples, the steps outlined by Berri et al. were followed. In brief, milk samples were centrifuged to produce pellets [14]. The pellets were periodically washed with sterile PBS. The sample precipitate was mixed with 200 μL of PBS buffer from Merck, Germany. Then it was centrifuged at 13000 rpm. DNA was extracted using a DNA extraction kit (Favorgen, Taiwan). Thermo Scientific's Nanodrop 2000c was utilized for DNA quality checking. To be used in PCR later, extracted DNA samples were stored at −20 °C.
2.4. Primers
All primers applied in present research are summarized in (Table 1). For molecular detection of C. burnetii nested-PCR targeting the transposon IS1111 and isocitrate dehydrogenase icd genes was used. Primer sets of CB5-CB6 and QpH1F-QpH1R were used to target a specific gene of the QpH1 plasmid, cbhE [5,15]. For the second PCR step, the primers QpH1R and QpH1F were designed using the Amplifx software (version 07, 0, 2; France). The specificity of the designed primers was verified using the Blast program on the NCBI website.
Table 1.
The amplification protocol names, thermal program for both touchdown and Trans PCR and primer names and sequences and the size of PCR products [5,15].
| Protocol | Primer Name | Sequence 5'----3' | PCR product size (bp) | PCR condition (Cycle) | Reference |
|---|---|---|---|---|---|
| Trans-PCR | IS-F | CAGAGCCACCGTATGAATCAGCTT | 960 | 95c for 3m, 94 c for 30s, 62–66 (5) for 30s, 72c for 1m, 72c for 10m. (35) | This study |
| IS-R | TCGGACGTTTATGGGGATGGGTAT | ||||
| nested-PCR | IS-NF | CACATTGCCGCGTTTACTAATCCC | 421 | 95c for 3m, 94 c for 30s, 54 for 20s, 72c for 1m, 72c for 10m. (35) | |
| IS-NR | CACGGCGCTGATCAATGAGATTC | ||||
| PCR | icd-F | CGGAGTTAACCGGAGTATCCA | 738 | Touchdown PCR (94 for3m, 94 for2m, 65-55 for1m, 77 for75s, 77 for5m) (3) 93 for4m, 94 for20s, 55 for1m, 77 for75s, 77 for5m. (30) |
This study |
| icd-R | CCGTGAATTTCATGATGTTACCTTT | ||||
| nested-PCR | icd-NF | GATATCGCGCCCGTCATGAAAA | 556 | 94 for2m, 94 for30s, 55 for20s, 75 for75s, 75 for5m. (35) | |
| icd-NR | CGGAATCGCGGTCATTATCAATGG | ||||
| PCR | CB5 | ATAATGAGATTAGAACAACCAAGA | 977 | 94 for 4m, 94 for2m, 53 for1m, 72 for2m, 72/5. (35) | (Zhang et al., 1998) |
| CB6 | TCTTTCTTGTTCATTTTCTGAGTC | ||||
| nested-PCR | QpH1-F | CTCGCTGACGGAAGAGGATCTTTT | 602 | 94 for3m, 94 for45s, 50 for45s, 72 for45s, 72 for5m. (35) | This study |
| QpH1-R | TAACACTGCCCGTCGCTTTACT |
2.5. Nested-PCR for the molecular detection of C. burnetii
Using Taq DNA Polymerase Master Mix RED, the IS1111 and icd genes were the targets of the first step of the nested-PCR (Amplicon, Denmark). The 25 μl reaction volume used for the PCR reaction included 12.5 μl of mater mix, 50 pmol of each primer (ISNF & ISNR and icd-F & icd-F), and 5 μl of extracted DNA. The touchdown PCR was employed to improve the reaction's specificity and sensitivity while lowering contamination and inhibitor levels. The thermal cycler (Quanta Biotech, England) was used to define the touchdown PCR thermal protocols (Table 1) as previously mentioned. Overall, the nested-PCR stage is given with 2.5 μl of the 50:50 diluted PCR product, it should be mentioned. During DNA extraction procedure, elution buffer from the extraction kit was used as Negative Control of Extraction. Positive Control; The C. burnetii isolates used in this study comprised one strain (C. burnetii standard Nine Mile strain RSA 493). Negative control; In this study, in all stages of PCR, a negative control was used, which included master mix, distilled water, and primer.
2.6. Amplification of QpH1
Two sets of modified primers were used to identify the specific plasmid sequence of C. burnetii. The first set of primers, CB6-CB5, was designed to identify the cbhE gene of the QpH1 plasmid. Using nested PCR, the conserved region of plasmids (QpH1) was amplified. 20 μl reaction volume used for the PCR reaction included 12.5 μl of Taq DNA Polymerase Master Mix RED, 50 pmol of each primer, and 5 μl of extracted DNA (Amplicon, Denmark). Used was the touchdown PCR (Table 1). For the nested-PCR step (thermal cycling condition in (Table 1), 3 μl of the first PCR product that had been diluted (1:9) was utilized.
2.7. Electrophoresis
All PCR products were separated in a 2–2.5 % agarose gel and the gel photographed applying ultraviolet trans illumination (Syngene Bio-Imaging, UK).
2.8. Sanger sequencing
Four PCR products from samples, together with the amplified cbhE′ gene fragment (602 bp) for seven samples, were delivered to SinaClon Company in Tehran, Iran, for sequencing. Using the sophisticated BLAST similarity search tool, obtained nucleotide sequences were checked against GenBank (National Center for Biotechnology Information, Rockville Pike, and Bethesda, USA) and compared to the identical sequences of C. burnetii isolates from GenBank. Clustal W was used to align and compare nucleotide sequences to other nucleotide sequences from GenBank, and MEGA software version X was used to create the phylogenetic tree using the neighbor-joining method.
2.9. Statistical analysis
Data were analyzed applying the Chi-square test in SPSS version 22 (IBM Corp. Armonk, NY, USA). Differences with a p-value <0.05 were regarded significant.
3. Results
3.1. Detection of C. burnetii in raw milk of buffalo and cattle
Out of all the milk samples that were examined, 142 samples tested positive, accounting for 16.9 % of the total. Specifically, 81 (19.3 %) of the positive samples were derived from buffalo milk (11 samples for <6, 59 samples for 6–10 and 11 samples for >10 age group), while 61 (14.5 %) were from cattle (9 samples for < 6, 44 samples for 6–10 and 8 samples for >10 age group) milk. Amplifying the IS1111 and the icd genes via nested-PCR produced a fragment of 421 bp and 556bp, respectively. Furthermore, the prevalence rate based on the icd gene was 7.1 % (95 % CI: 5.59%–9.08 %). Additionally, the prevalence rates based on the IS1111 and QpH1 genes were 142 (16.9 %) (95 % CI: 14.5–19.6) and 86 (60.6 %) (95 % CI: 52.35–68.2), respectively (Fig. 2, Fig. 3) and (Table 2, Table 3, Table 4, Table 5).
Fig. 2.
Agarose gel image of amplified fragment of C. burnetii IS1111 gene (421bp) using nested-PCR. Lane 1, 50-bp molecular ladder (Smobio Technology Inc., Taiwan); lane 2 positive control sample, lanes 3, 4, 5, 6 and 7 positive samples for C. burnetii, lane 8, negative control. Positive control (C. burnetii standard Nine Mile strain RSA 493 Nine).
Fig. 3.
Agarose gel image of amplified fragment of C. burnetii icd gene (556bp) using nested-PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); lane 2 positive control sample, lanes 3, 4, 5 and 6 positive samples for C. burnetii, lane 7, negative control. Positive control (C. burnetii standard Nine Mile strain RSA 493 Nine).
Table 2.
Results of detecting different genes in C. burnetii positive milk samples using nested PCR (n = 420).
| Target gene | Animal |
|
|---|---|---|
| Buffalo | Cattle | |
| IS1111 | 81 (19.28 %)a | 61 (14.52 %)b |
| QpH1 | 46 (56.79 %)a | 40 (65.57 %)a |
| Icd | 25 (5.95 %)b | 35 (8/33 %)a |
The data show the number and percentage of positive samples (n = 420). Additionally, a different letter in each row indicates significant differences at the level of p < 0.05.
Table 3.
Results of detecting different genes in C. burnetii positive milk samples using nested PCR in different age groups of animals (years old).
| Target gene | Animal | Age group |
Total | ||
|---|---|---|---|---|---|
| <6 | 6–10 | >10 | |||
| IS1111 | Buffalo | 11Ab (13.58 %) | 59 Aa (72.84 %) | 11 Ab (13.58 %) | 81 |
| Cattle | 9 Ab (14.75 %) | 44 ABa (72.14 %) | 8 Ab (13.11 %) | 61 | |
| QpH1 | Buffalo | 4 Ab (8.7 %) | 38 Ba (82.6 %) | 4 ABb (8.7 %) | 46 |
| Cattle | 4 ABb (10 %) | 30 BCa (75 %) | 6 ABb (15 %) | 40 | |
| Icd | Buffalo | 2 Bb (8 %) | 22 Ca (88 %) | 1Bb (4 %) | 25 |
| Cattle | 3 ABb (8.6 %) | 30 Ba (85.7 %) | 2 Bb (5.7 %) | 35 | |
∗ Different capital letters in each column (each gene separately) indicate significant differences (p < 0.05). Similarly, lowercase letters within in each row also indicate significant differences (p < 0.05).
Table 4.
The results of detection different genes in C. burnetii positive milk samples by nested PCR in different season.
| Target gene | Animal | Season |
Total | |||
|---|---|---|---|---|---|---|
| Spring | Summer | Autumn | Winter | |||
| IS1111 | Buffalo | 12Ab (14.8 %) | 39Aa (48.1 %) | 30 Aa (37.1 %) | 0Ac (0.0 %) | 81 |
| Cattle | 7 ABb (11.5 %) | 31 Aa (50.1 %) | 23 Aa (38.4 %) | 0 Ac (0.0 %) | 61 | |
| QpH1 | Buffalo | 4 Bb (8.7 %) | 23 Ba (50 %) | 19 Ba (41.3 %) | 0 Ac (0.0 %) | 46 |
| Cattle | 5 Bb (12.5 %) | 22 Ba (55 %) | 13 Bb (32.5 %) | 0 Ac (0.0 %) | 40 | |
| Icd | Buffalo | 3 Bb (12 %) | 12 Ca (48 %) | 10 Ba (40 %) | 0 Ac (0.0 %) | 25 |
| Cattle | 4 Bb (11.4 %) | 17 ABa (48.6 %) | 14 Ba (40 %) | 0 Ac (0.0 %) | 35 | |
∗ Different capital letters in each column (each gene separately) show significant differences (p˂0.05). Also, small letters show in each raw show significant differences (p˂0.05).
Table 5.
The results of detection different genes in C. burnetii positive milk samples by nested PCR in different region of the study.
| Target gene | Animal |
Region |
Total | ||
|---|---|---|---|---|---|
| North | Center | South | |||
| IS1111 | Buffalo | 43Aa (53 %) | 26 Ab (32 %) | 12 Ac (15 %) | 81 |
| Cattle | 32 Ba (52.5 %) | 20 ABb (32.3 %) | 9 ABc (15.2 %) | 61 | |
| QpH1 | Buffalo | 25 Ca (54.3 %) | 16 BCb (34.8 %) | 5 BCc (10.9 %) | 46 |
| Cattle | 25 Ca (62.5 %) | 11 CDb (27.5 %) | 4 BCc (10 %) | 40 | |
| Icd | Buffalo | 15 Da (60 %) | 8 Db (32 %) | 2 Cc (8 %) | 25 |
| Cattle | 16 Da (45.7 %) | 14 Cb (40 %) | 5 BCc (14.3 %) | 35 | |
∗ Different capital letters in each column show significant differences (p˂0.05). Also, small letters show in each raw show significant differences (p˂0.05).
The results based on seasons showed that the highest prevalence of C. burnetii was in the summer season. Out of 219 samples, 70 samples (31.1 %) were positive, and the lowest prevalence was in the winter season where none of the 210 samples taken from cow and buffalo milk were positive. The results revealed a statistically significant difference (p < 0.05) in the disease prevalence during different seasons, and the summer season had the highest frequency of contamination by this bacterium compared to other seasons. Furthermore, the results based on geographical regions indicated that the highest contamination rate was in the northern region, where 75 out of 275 milk samples (27.3 %) were positive, and the lowest contamination rate was in the southern region, where 21 out of 284 milk samples (7.4 %) were positive. The results of this study also showed a significant difference (p < 0.05) in the prevalence of the disease in different regions, including the north, central and south of the province. Therefore, we can conclude that the geographical region has a significant effect on the incidence of C. burnetii infection and the elimination of the bacterium from cow and buffalo milk.
Based on animal type, out of the total 420 milk samples taken from cows, 81 samples (19.3 %) were positive, and out of 420 milk samples taken from buffalo, 61 samples (14.5 %) were positive. According to the results, no significant difference was found in the incidence of C. burnetii infection between cows and buffaloes. Additionally, the age group analysis revealed that the highest prevalence was in the age group above 10 years old, where 19 out of 4 milk samples (22.6 %) were positive, and the lowest prevalence was in the 4 to 6-year-old group where 59 out of 794 milk samples (9.9 %) were positive. Finally, the results showed a significant relationship (p < 0.05) between the age of cows and the incidence of C. burnetii infection in cow's milk in West Azerbaijan province. However, no significant relationship was observed between the age of buffalo and the incidence of this bacterium.
3.2. Identification of plasmid in C. burnetii
All of the C. burnetii-positive samples underwent nested-PCR analysis to identify plasmids. Using particular QpH1 plasmid primers, the kinds of plasmids in the affirmative milk samples were directly identified. 68 (60.6 percent) of the 142 milk samples that tested positive for C. burnetii also tested positive for the QpH1 plasmid (Fig. 4).
Fig. 4.
Agarose gel image of amplified fragment of C. burnetii cbhE′ gene QpH1 (602bp) using nested-PCR. Lanes 1 and 10, 100-bp molecular ladder, lanes 2, 3, 4, 5, 6, 7 positive samples, lane 8, negative control, lane 9, positive control (C. burnetii standard Nine Mile strain RSA 493 Nine).
3.3. Phylogenetic analysis
According to a phylogenetic tree built using Maximum Likelihood method analysis of the cbhE partial gene, four isolates were found to be tightly grouped together and to have 99.9 % similarity, which is regarded to be the same (Fig. 5).
Fig. 5.
Phylogenetic inference of C. burnetii by (cbhE partial gene) sequencing.
The nucleotide sequences of the cbhE gene were subjected to comparative analysis both among themselves and against sequences accessible in the NCBI gene bank through Blast analysis. The obtained sequences were then analyzed using the Mega 10 software, and a phylogenetic tree was constructed. The results showed more than 99 % similarity between the obtained sequences and the registered sequences in NCBI. Additionally, for the confirmation of the species, the sequences of four samples were determined after amplification using the IS1111 gene and confirmed to be C. burnetii. After alignment and correction using the Mega 10 software, the sequences were 160 base pairs long. All four sequences showed 100 % similarity to each other, and after Blast analysis, they showed 100 % similarity with more than 50 sequences available in the gene bank from various sources and regions. Therefore, drawing a phylogenetic tree was not necessarily due to the 100 % similarity with other strains from different regions and sources.
The evolutionary history was inferred by using the Maximum Likelihood method and Tamura-Nei model [16]. The tree with the highest log likelihood (−2120.95) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. This analysis involved 26 nucleotide sequences. Codon positions included were 1st+2nd+3rd + Noncoding. There was a total of 562 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [17].
4. Discussion
In the Northwest of Iran, cattle and buffalo have been demonstrated to be susceptible to the common zoonosis known as Q fever [18]. In Iran, research on Q fever in animal hosts like buffalos is uncommon, and C. burnetii molecular research is also uncommon. In the wake of this research, 86 (10.2 %) of the 840 milk samples examined tested positive for the QpH1 plasmid. The bacteria are shed during parturition also in cattle, more pronounced when abortions occur. Shedding in milk is longer and can be intermittent. Buffaloes are a source of red meat for human consumption. Globally, buffalo meat accounts for 12.4 % of total beef production annually. The superior quality of buffalo meat and milk remains unknown to the general public [19,20].
In general, the IS1111 gene was positive in 16 % of samples, while the icd gene was positive in 8 % of samples. Only two samples had the IS1111 and icd genes found in them (ten sample of milk). This suggests that the samples examined had extremely low levels of C. burnetii, which needed a multicopy target to reach the sensitivity required for detection. The existence of samples that test positive just for IS1111 is completely predicted given that C. burnetii strains may contain up to 110 IS1111 elements [21].
As a result, our research is consistent with a report from a systematic review on the prevalence of C. burnetii in milk from various regions of Iran, which ranged from 4.22 percent to 25.55 percent [22]. Recent research in Chile [23] found that C. burnetii was detected in tank raw cow milk at a prevalence of 2.1 percent, which is much lower than the observed frequency in the current study. This difference may be due to geographic location. Infection rates are at their greatest in the spring and early summer. Additionally, some researches have shown that the incidence of Q fever rises significantly during lambing season, which results in the majority of cases of Q fever being recorded in the summer in several European nations [24,25]. According to the earlier research, our research found that C. burnetii prevalence in milk was greatest in the summer [26]. The high prevalence of C. burnetii can be higher in subtropical and tropical compared to that of cooler climates due to tick activity [27].
Among the milk samples that tested positive for IS1111, 47.8 % also exhibited positivity for the QpH1 plasmid, this indicates that the majority of the isolates belonged to the species that causes an acute version of the illness. Five out of eight cow milk samples (62.5 %) from research by Loftis et al. included QpH1 plasmid, producing results that were quite similar to those of the current study [28]. QpH1 and QpRS sequences were found in the serum of human patients in a different study by Zhang et al. [5]. All of the sheep samples tested positive for C. burnetii in research by Hilbert et al. in Germany contained plasmid QpH1 [29]. The majority of the isolates found in pregnant women in the Netherlands had QpH1 plasmids [30]. In the study of Abu Abdullah et al. (2022), demonstrated that C. burnetii exhibits a high genome plasticity and that some of the genomic features are correlated to the clinical outcome, epidemiological characteristics and geographic distribution.
Our research suggests that a specific strain of C. burnetii that mostly carries the QpH1 plasmid infects animals in West Azerbaijan province Iran. However, further isolates need to be analyzed to confirm this hypothesis. Few research has been done so far on the impact of age on C. burnetii's milk excretion. Designing herd-flock level Q fever control and eradication strategies requires knowledge of the times of the production cycle when the risk of C. burnetii transmission is highest and which age groups or stock classes are responsible for infection transmission [31]. This research discovered a substantial correlation between age and C. burnetii excretion via cow's milk. The findings of this study are in line with other publications, which indicate that age has a major role in the risk of C. burnetii excretion from milk in cattle [12].
The results of the current study's phylogenetic analysis of the plasmid QpH1 of four C. burnetii showed that four isolates were grouped together with nearly identical nucleotide sequences, which is consistent with findings from a recently published study that found limited evolution within genomic groups in C. burnetii [32]. RFLP and/or the presence of plasmid DNA may be employed to distinguish C. burnetii isolates despite the highly conserved genome of this organism [33]. PCR is a valuable tool for early detection of C. burnetii in shell-vial cultures, aiding in the diagnosis of both acute and chronic infections, as well as the detection of the bacteria in clinical specimens, including heart valves [34]. Also, nowadays newer and more accurate techniques such as MLVA, SNP and MST are used for the genotyping of C. burnetii and diagnosis of Q fever.
The results of the study by Abou Abdallah and colleagues (2022) indicate that C. burnetii strains that carry QpRS genes cause asymptomatic primary infections. If this hypothesis is substantiated, it would be unfeasible to implement a preventative strategy against endocarditis or other persistent, focal infections in patients who have been infected with such strains. This finding is not confounded by geographical factors, as multiple QpRS strains have been identified in a number of countries. Consequently, based on the findings that have been corroborated by genomic and statistical analysis, it is hypothesized that strain-specific characteristics play a significant role in determining the clinical manifestations of Q fever.
Previous studies have shown a relationship between the presence of QpH1 and QpDV plasmids and acute infections or abortions [30,35]. In our study, we observed that all isolates had the QpH1 plasmids, and none of them had the QpRS plasmid. This is interesting because these plasmid types are not exclusively found in acute Q fever-associated strains [35,36].
Genomic analysis has provided valuable insights into the genomic dynamics of C. burnetii, including its evolution, host adaptation, epidemiology, and clinical profile. Newer techniques such as multi-locus variable-number tandem repeat (VNTR) analysis (MLVA) have also been suggested as sensitive and cost-effective tools for investigating molecular epidemiology [35]. In a study by Tehrani and Ownagh (2023), for example, out of 320 horse serum samples, 26 were found to be infected with C. burnetii, and all of them belonged to QpH1 plasmid strains. None of the samples in this study contained the QpRS gene [37].
Experiments analyzing the function of both the conserved and unique plasmid sections of C. burnetii are crucial for comprehending the biology of this organism. All C. burnetii isolates were discovered to have plasmids or plasmid-homologous sequences incorporated into their chromosomes, indicating that these sequences contain important components and/or perform critical tasks for the organism. Experiments including mutagenesis and transformation may reveal the underlying roles of conserved and unique genes [38]. It was indicated that the great sensitivity of PCR necessitates its use in the diagnosis of Q fever [39].
This phylogenetic analysis study was performed using QpH1 fragments obtained from C. burnetii species isolated from cow and buffalo milk. The results indicated a close evolutionary relationship with the same species reported in China, the USA, Japan, Germany, France and the Netherlands. Phylogenetic analysis of C. burnetii in different milk samples revealed a close evolutionary relationship with C. burnetii strains isolated from humans of the same or different species, suggesting that the observed association is attributable to the close interaction between infected animals and humans. This interaction is likely a significant risk factor for zoonotic infections, including Q fever in humans. The lack of surveillance for C. burnetii in the region highlights the urgent need to address the potential pathogenic consequences of this bacterium and its resulting diseases.
In addition, the measurable findings of PCR may be used to monitor treatment, particularly in chronic cases. Nevertheless, given the plasmid types, PCR might be used to classify the isolates. Consequently, it might be used in epidemiological investigations. Although the plasmids can be studied using the nested PCR technique, C. burnetii may not be detected in milk samples due to the presence of the inhibitors. In a broader sense, these strains may also include plasmids such as QpDG, QpRS, or QpDV. When accessible, the C. burnetii plasmid types in these samples may be determined using PCR using primers specific for other plasmids.
5. Conclusion
To the best of our knowledge, this study represents the inaugural investigation to document the identification of C. burnetii plasmids in milk from cattle and buffalo in Iran. Our research gives more evidence for this significant condition in Iran. Due to the severity of the flu-like symptoms, we feel our data support the notion that the prevalence of animal Q fever in Iran is grossly underestimated. To determine the prevalence of C. burnetii, it will be necessary to conduct more research that include acute Q fever in people and abortion in animals. In the event of temperature and time optimizations, it is important to note that the nested-PCR discovery findings may be accomplished by modifying the extraction procedure.
CRediT authorship contribution statement
Peyman Khademi: Writing – review & editing, Writing – original draft, Software, Methodology, Formal analysis, Data curation. Amir Tukmechi: Writing – original draft. Abdulghaffar Ownagh: Writing – review & editing, Writing – original draft.
Availability of data and materials
The data are available from the corresponding author upon reasonable request.
Competing interests
The authors declare that they have no conflicts of interest. All authors have full control over the primary data and agree to allow the review of their data upon request.
Data
All authors have full control of all primary data and they agree to allow review of their data upon request.
Funding
The authors would like to thank the Vice-Chancellor for Research and Technology at Urmia University for funding the PostDoc project (D10/647).
Declaration of competing interest
The authors declare that they have no conflicts of interest.
Acknowledgments
The authors would like to thank the dean for research and technology of Lorestan University for funding the project.
Handling Editor: Patricia Schlagenhauf
References
- 1.Gale P., Kelly L., Mearns R., Duggan J., Snary E.L. Q fever through consumption of unpasteurised milk and milk products–a risk profile and exposure assessment. Appl Microbiol. 2015;118:1083–1095. doi: 10.1111/jam.12778. [DOI] [PubMed] [Google Scholar]
- 2.Signs K.A., Stobierski M.G., Gandhi T.N. Q fever cluster among raw milk drinkers in Michigan, 2011. Clin Infect Dis. 2012;55:1387–1389. doi: 10.1093/cid/cis690. [DOI] [PubMed] [Google Scholar]
- 3.Szymańska-Czerwińska M., Jodełko A., Zaręba-Marchewka K., Niemczuk K. Shedding and genetic diversity of Coxiella burnetii in Polish dairy cattle. PLoS One. 2019;14 doi: 10.1371/journal.pone.0210244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Guatteo R., Beaudeau F., Joly A., Seegers H. Coxiella burnetii shedding by dairy cows. Vet Res. 2007;38:849–860. doi: 10.1051/vetres:2007038. [DOI] [PubMed] [Google Scholar]
- 5.Zhang G., Hotta A., Mizutani M., Ho T., Yamaguchi T., Fukushi H., Hirai K. Direct identification of Coxiella burnetii plasmids in human sera by nested PCR. Clini Microbiol. 1998;36:2210–2213. doi: 10.1128/jcm.36.8.2210-2213.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Boldis V., Spitalska E., Toman R. Molecular typing in bacterial infections. Springer; 2013. Molecular typing of Coxiella burnetii: a review of available methods with major focus on PCR-based techniques; pp. 457–469. [DOI] [Google Scholar]
- 7.Minnick M.F., Small C.L., Frazier M.E., Mallavia L.P. Analysis of strain-specific plasmid sequences from Coxiella burnetii. Acta Virol. 1991;35:497–502. https://europepmc.org/article/med/1687630 [PubMed] [Google Scholar]
- 8.Ferrara G., Colitti B., Pagnini U., D'Angelo D., Iovane G., Rosati S., et al. Serological evidence of Q fever among dairy cattle and Buffalo populations in the campania region, Italy. Pathogens. 2022;11:901. doi: 10.3390/pathogens11080901. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Porten K., Rissland J., Tigges A., Broll S., Hopp W., Lunemann M., et al. A super-spreading Ewe infects hundreds with Q fever at a farmers' market in Germany. BMC Infect Dis. 2006;6:147. doi: 10.1186/1471-2334-6-147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Heydari A.A., Mostafavi E., Heidari M., Latifian M., Esmaeili S. Q fever endocarditis in northeast Iran. Case Rep Infect Dis. 2021 doi: 10.1155/2021/5519164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mohabati Mobarez A., Baseri N., Khalili M., Mostafavi E., Stenos J., Esmaeili S. Genetic diversity of Coxiella burnetii in Iran by multi-spacer sequence typing. Pathogens. 2022;11 doi: 10.3390/pathogens11101175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Esmaeili S., Mobarez A.M., Khalili M., Mostafavi E. High prevalence and risk factors of Coxiella burnetii in milk of dairy animals with a history of abortion in Iran. Comp Immunol Microbiol Infect Dis. 2019;63:127–130. doi: 10.1016/j.cimid.2019.01.015. [DOI] [PubMed] [Google Scholar]
- 13.Liu Y., Li F., Liu W., Dai R., Tan Y., He D., et al. Prevalence of helminths in water buffaloes in Hunan Province, China. Trop Anim Health Prod. 2009;41:543–546. doi: 10.1007/s11250-008-9219-1. [DOI] [PubMed] [Google Scholar]
- 14.Berri M., Arricau-Bouvery N., Rodolakis A. PCR-based detection of Coxiella burnetii from clinical samples. PCR Detection of Microbial Pathogens. 2003:153–161. doi: 10.1385/1-59259-344-5:153. [DOI] [PubMed] [Google Scholar]
- 15.Halos L. Paris-Grignon, L'Institut National Agronomique; 2005. Détection de bactéries pathogènes dans leur vecteur, les tiques dures (Acarien: Ixodidae) 175pp. [Google Scholar]
- 16.Tamura K., Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993;10:512–526. doi: 10.1093/oxfordjournals.molbev.a040023. [DOI] [PubMed] [Google Scholar]
- 17.Kumar S., Stecher G., Li M., Knyaz C., Tamura K., Mega X. Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Asadi J., Khalili M., Kafi M., Ansari-Lari M., Hosseini S.M. Risk factors of Q fever in sheep and goat flocks with history of abortion. Comp Clin Pathol. 2014;23:625–630. doi: 10.1007/s00580-012-1661-9. [DOI] [Google Scholar]
- 19.Alizadeh R., Amniattalab A. Pathology and prevalence of hepatic lesions of Azeri buffaloes (bubalus bubalis) slaughtered at Urmia Abattoir, Northwest Iran. Journal of Food Safety and Hygiene. 2019;5(1) doi: 10.18502/jfsh.v5i1.3883. [DOI] [Google Scholar]
- 20.Azary M., Manafiazar G., Razagzadeh S., Amini-jabalkandi J. Comparing fattening performance of Azeri buffalo, native and crossbred (native∗ Holstein) male calves in west Azerbaijan-Iran. Ital J Anim Sci. 2007;6:1152–1255. doi: 10.4081/ijas.2007.s2.1252. [DOI] [Google Scholar]
- 21.Basanisi M.G., La Bella G., Nobili G., Raele D.A., Cafiero M.A., Coppola R., et al. Detection of Coxiella burnetii DNA in sheep and goat milk and dairy products by droplet digital PCR in south Italy. Int J Food Microbiol. 2022;366 doi: 10.1016/j.ijfoodmicro.2022.109583. [DOI] [PubMed] [Google Scholar]
- 22.Esmaeili S., Mobarez A.M., Khalili M., Mostafavi E., Moradnejad P. Molecular prevalence of Coxiella burnetii in milk in Iran: a systematic review and meta-analysis. Trop Anim Health Prod. 2019;51:1345–1355. doi: 10.1007/s11250-019-01807-3. [DOI] [PubMed] [Google Scholar]
- 23.Cornejo J., Araya P., Ibáñez D., Hormazabal J.C., Retamal P., Fresno M., et al. Identification of Coxiella burnetii in tank raw cow milk: first findings from Chile. Vector Borne Zoonotic Dis. 2020;20:228–230. doi: 10.1089/vbz.2019.2535. [DOI] [PubMed] [Google Scholar]
- 24.Pexara A., Solomakos N., Govaris A. Q fever and prevalence of Coxiella burnetii in milk. Trends Food Sci Technol. 2018;71:65–72. doi: 10.1016/j.tifs.2017.11.004. [DOI] [Google Scholar]
- 25.Clark N.J., Soares Magalhães R.J. Airborne geographical dispersal of Q fever from livestock holdings to human communities: a systematic review and critical appraisal of evidence. BMC Infect Dis. 2018;18:1–9. doi: 10.1186/s12879-018-3135-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Dalton H.R., Dreier J., Rink G., Hecker A., Janetzko K., Juhl D., et al. Coxiella burnetii-pathogenic agent of Q (query) fever. Transfus Med Hemotherapy. 2014;41:60–72. doi: 10.1159/000357107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sadiki V., Gcebe N., Mangena M.L., Ngoshe Y.B., Adesiyun A.A. Prevalence and risk factors of Q fever (Coxiella burnetii) in cattle on farms of Limpopo province, South Africa. Front Vet Sci. 2023;10 doi: 10.3389/fvets.2023.1101988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Loftis A.D., Priestley R.A., Massung R.F. Detection of Coxiella burnetii in commercially available raw milk from the United States. Foodb Pathog Dis. 2010;7:1453–1456. doi: 10.1089/fpd.2010.0579. [DOI] [PubMed] [Google Scholar]
- 29.Hilbert A., Schmoock G., Lenzko H., Moog U., Diller R., Fröhlich A., et al. Prevalence of Coxiella burnetii in clinically healthy German sheep flocks. BMC Res Notes. 2012;5:152. doi: 10.1186/1756-0500-5-152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Angelakis E., Million M., D’amato F., Rouli L., Richet H., Stein A., et al. Q fever and pregnancy: disease, prevention, and strain specificity. Eur J Clin Microbiol Infect Dis. 2013;32:361–368. doi: 10.1007/s10096-012-1750-3. [DOI] [PubMed] [Google Scholar]
- 31.Canevari J.T., Firestone S.M., Vincent G., Campbell A., Tan T., Muleme M., et al. The prevalence of Coxiella burnetii shedding in dairy goats at the time of parturition in an endemically infected enterprise and associated milk yield losses. BMC Vet Res. 2018;14:1–9. doi: 10.1186/s12917-018-1667-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hemsley C.M., O'Neill P.A., Essex-Lopresti A., Norville I.H., Atkins T.P., Titball R.W. Extensive genome analysis of Coxiella burnetii reveals limited evolution within genomic groups. BMC Genom. 2019;20:1–17. doi: 10.1186/s12864-019-5833-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Willems H., Thiele D., Krauss H. Plasmid based differentiation and detection of Coxiella burnetii in clinical samples. Eur J Epidemiol. 1993;9:411–418. doi: 10.1007/BF00157399. [DOI] [PubMed] [Google Scholar]
- 34.Stein A., Raoult D. Detection of Coxiella burnetti by DNA amplification using polymerase chain reaction. J Clin Microbiol. 1992;30:2462–2466. doi: 10.1128/jcm.30.9.2462-2466.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Abou Abdallah R., Million M., Delerce J., Anani H., Diop A., Caputo A., et al. Pangenomic analysis of Coxiella burnetii unveils new traits in genome architecture. Front Microbiol. 2022;13 doi: 10.3389/fmicb.2022.1022356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Eldin C., Melenotte C., Mediannikov O., Ghigo E., Million M., Edouard S., et al. From Q fever to Coxiella burnetii infection: a paradigm change. Clin Microbiol Rev. 2017;30:115–190. doi: 10.1128/CMR.00045-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Tehrani M., Ownagh A. Genomic detection of Coxiella burnetii based on plasmid genes in horses. Vet Res Forum. 2023;14:317–322. doi: 10.30466/vrf.2022.551663.3443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Jäger C., Lautenschläger S., Willems H., Baljer G. Coxiella burnetii plasmid types QpDG and QpH1 are closely related and likely identical. Vet Microbiol. 2002;89:161–166. doi: 10.1016/s0378-1135(02)00155-4. [DOI] [PubMed] [Google Scholar]
- 39.Lührmann A., Newton H.J., Bonazzi M. Beginning to understand the role of the type IV secretion system effector proteins in Coxiella burnetii pathogenesis. Curr Top Microbiol Immunol. 2017:243–268. doi: 10.1007/978-3-319-75241-9_10. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data are available from the corresponding author upon reasonable request.