Exploring the Acetobacteraceae family isolated from kombucha SCOBYs worldwide and comparing yield and characteristics of biocellulose under various fermentation conditions

Abstract

Bacterial cellulose (BC) is a cellulosic biopolymer produced by specific acetic acid bacteria during kombucha fermentation. In this study, bacterial cellulose-producing strains were isolated from four different global kombucha SCOBY samples obtained from markets in the Netherlands, America, China, and Iran. The strains were identified using biochemical and molecular techniques. The ability of species to produce BC was evaluated under both static and stirred fermentation conditions. Seven dominant strains from the Acetobacteraceae family and the genus of Komagataeibacter and Gluconacetobacter were identified and submitted to NCBI gene bank archives: K. xylinus CH1, K. sucrofermentans IR2, K. intermedius IR3, K. cocois AM2, K. sucrofermentans NE4, K. cocois NE6, and G. liquefaciens NE7. Among these, K. intermedius IR3, isolated from local Iranian SCOBY, exhibited the highest BC production yield at 5.733 ± 0.170 gL⁻¹ under static fermentation conditions. On the other hand, K. xylinus CH1, from Chinese SCOBY, had the highest yield under stirred conditions, producing 12.689 ± 0.808 gL⁻¹ of BC. The BC production yield of both K. xylinus CH1 and K. intermedius IR3 under stirred conditions was 3 and 1.3 times more than static conditions, respectively. Despite the yield differences, static fermentation demonstrated superior physicochemical characteristics; such as moisture content, water holding capacity, and crystallinity degree, compared to stirred. Therefore, depending on the intended application in industry and specific criteria, both products could serve as functional substitutes in food and medicine sectors.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-77305-w.

1. Introduction

Bacterial cellulose (BC) is a biopolymer with the formula (C₆H₁₀O₅)_n, synthesized by certain types of bacteria, especially the Acetobacteraceae family^1–5. It is a linear homopolymer with nanofibrils of β (1,4)-D-glucose linked together by glycosidic bridges. In the process of forming these fibers, polymerization, and crystallization occur simultaneously, leading to the creation of regular intra- and intermolecular hydrogen bonds^6,7. In terms of biomolecule applications, BC is an ultrafine, nano fibrillar material with an exclusive combination of properties such as high purity, high crystallinity, great polymerization degree, wide surface area, excellent tensile strength and flexibility, high water-holding capacity, hydrophilicity, and biocompatibility^4,8. Because of its unique properties, the use of this eco-friendly exopolysaccharide has been considered in various fields, including medicine, food industry, textile, etc^2,5,9,10. Due to its suitable mechanical, thermal, and rheological properties, BC can be used as a thickening agent, gelling agent, flavor carrier, stabilizer, and a substitute for fat and carbohydrates in a wide range of food products, including low-calorie foods. Since 1992, BC has been introduced by the US Food and Drug Administration (FDA) as a GRAS dietary fiber^1,6,7,11,12.

According to various research, one of the rich sources of the Acetobacteraceae family is kombucha;^13,14. Kombucha is a traditional fermented drink produced by fermentation of sweetened tea leaf extract using a symbiotic culture of bacteria and yeast (SCOBY) in a cellulosic biofilm layer. Today, kombucha SCOBY is readily available in the commercial market world wide. Within the SCOBY consortium, there are numerous symbiotic interactions between microorganisms and the fermentation environment. Kombucha SCOBY is considered a reservoir of specialized microorganisms that vary depending on different cultural practices in each country. Depending on the region of the world, the raw materials used, and the fermentation conditions, different genera, species, and strains of acetic acid bacteria, lactic acid bacteria and yeasts are identified in SCOBY^15–17. The most abundant strains in kombucha SCOBY belong to the Acetobacter, Gluconacetobacter, and Komagataeibacter genera. Komagataeibacter xylinus (formerly Gluconacetobacter xylinus) is considered one of the most important species associated with kombucha^18–20. The genus Komagataeibacter was described in 2013 by redefinition of the genus Gluconacetobacter which resulted in the reclassification; of the species from the G. xylinus to a new genus Komagataeibacter. The genus Komagataeibacter gained immense interest among researchers due to the pure and efficient production of nano cellulose by members of the species; K. xylinus, K. medellinensis, K. hansenii, K. nataicola, K. oboediens, K. rhaeticus, K. saccharivorans and K. pomaceti^4,14,21–25.

Static and stirred fermentation conditions are two basic methods used for the production of BC¹. Few studies have compared BC yield under different fermentation conditions²⁶. Based on the fermentation technique, the yield, appearance, physicochemical and rheological properties of produced BC is differ, which can specialize its application in the food or medicine industries^8,10,27.

This study primarily focused on the diversity of BC-producing strains associated with four different globally commercialized kombucha SCOBYs from various geographical locations, utilizing both general and molecular techniques. The study also compared BC yield under static and stirred fermentation conditions. Furthermore, the physicochemical and morphological properties of the both produced BCs were examined and compared (Fig. 1).

Fig. 1.

Graphical abstract of biocellulose production by identified strains under static and stirred fermentation conditions.

Materials and methods

Kombucha SCOBY samples

Four different samples of kombucha SCOBY were provided from four different countries: the Netherlands (Purasana Co.), America (Fermentaholics Co.), China (Joshua Tree Kombucha Co.), and Iran (Medicinal Plants Co.). The kombucha SCOBY samples in original commercial packaging, were transported to the laboratory using isotherm containers under a cold chain maintained at 4^◦C. Then the SCOBYs were removed from the packages under sterile conditions and immediately tested in order to isolate and identify BC producer microorganisms.

Isolation and primary characterization of bacteria

First, the kombucha SCOBY samples were homogenized on the stomacher machine (Model 400 Circulator Lab Blender, UK) under sterile conditions, the microbial extraction was serially diluted and used to isolate Acetic acid bacteria (AAB) on GYC-A medium (included 50 gL⁻¹ D-glucose, 10 gL⁻¹ yeast extract, 5 gL⁻¹ Calcium Carbonate, and 20 gL⁻¹ Agar; pH = 6) using the Quadrant Streak Isolation technique. Briefly, 1 ml of prepared samples were inoculated onto the culture media and the plates were incubated at 30 °C for 72 h in an incubator (Memmert, Germany)^28–30. To determine the biochemical characteristics of the AAB isolates, after differentiation of the colony and cell morphology by direct observation and Gram staining, oxidase and catalase activity were evaluated on the Gram-negative isolates. Catalase activity was confirmed by the rapid formation of air bubbles on young colonies after the addition of 1 drop of 3% H₂O₂ (vv⁻¹) (Merck, Germany). Oxidase test was done by addition of 1 drop of 1% Tetramethyl-p-phenylenediamine (vv⁻¹) (Merck, Germany), and examining the color change of the young colonies to purple³¹.

DNA extraction and sequencing of the isolates

DNA was extracted from fresh colonies of isolates using the DNA extraction kit (Gene Transfer Pioneers, Iran) following the manufacturer’s instructions. The purity of the DNA was quantified using Nanodrop (BOECO, Germany), UV-visible double beam spectrophotometry (Shimadzu UV 1800, Japan), and Gel-Electrophoresis method, and finally, the DNA was stored at -20°C until the analytical experiments. The absorbance wavelengths used to assess the purity of DNA and RNA was 260 and 280 nm respectively. A ratio of 1.7–2.0 is considered pure for DNA. 16S rRNA fragment (1500 bp) have amplified using universal oligonucleotides with following forward (5’ AGAGTTTGATCCTGGCTCAG 3’) and reverse (5’ GGTTACCTTGTTACGACTT 3’) primers. Each PCR reaction mixture (20 µL) contained 10 µL Red Master Mix (20 X) (dNTPs, Taq DNA polymerase, PCR buffer, magnesium chloride (MgCl₂)) (Ampliqon, Denmark), 1 µL of the template DNA, 0.5 µL of each primer at a concentration of 10 Pmol.µL⁻¹, and 8 µL DNase-free distilled water. The PCR program was carried out in a thermal cycler (Bio-Rad, America) as 180 s of initial denaturation at 94 °C, followed by 10 amplification cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30s with decreasing 0.5 °C per cycle and extension at 72 °C for 90 s. Then, 20 cycles were set as denaturation at 94 °C for 30 s, annealing at 49 °C for 30 s, and extension at 72 °C for 90 s. The final elongation was set at 72 °C for 10 min. The PCR products were analyzed via 1% agarose gel electrophoresis, stained with DNA Gold Viewer Dye (Dena Zist Asia, Iran), using molecular marker (100 bp) as positive control, and blank (not loaded PCR product) as negative control, then visualized under UV light using a gel documentation device (Sony, Japan). To purify and sequence the amplified DNA fragments, amplicons were loaded on 1% agarose gel; the bands were then cut off and extracted using a gel extraction kit (Genet Bio, Korea) before being conveyed to a sequencing machine (ABI3730xl sequencer, Macrogen, Korea) that Sanger sequencing was employed to investigate the closest homologous species. The obtained nucleotide sequences of 16 S rRNA were blasted in Gene Bank (National Centre for Biotechnology Information, Rockville Pike, Bethesda, USA), for search similarity with sequences in the database^32,33. The 16 S rRNA of representative species were used for multiple sequence alignment with ClustalX software, and the phylogenetic tree was constructed by MEGA software (Version 7.0.26; https://www.megasoftware.net/) based on the Neighbor-Joining method with bootstrapping 1000 times.

BC production under static and stirred fermentation conditions

The identified strains from kombucha SCOBY, and G. xylinus ATCC 10,245 (reference strain), were incubated in Hestrin-Schramm (HS) medium (containing 10 gL⁻¹ D-glucose, 10 gL⁻¹ glycerol, 5 gL⁻¹ yeast extract, 5 gL⁻¹ peptone, 2.7 gL⁻¹ Na₂HPO₄, 1.15 gL⁻¹ citric acid, pH = 6),(Merck, Germany), at 30 °C for 72 h, to produce pre-cultures (about 12 log CFUmL⁻¹). Then 3% VV⁻¹ of pre-culture of all strains inoculated in 30 ml HS medium at pH = 6, in 100 ml sterilized Erlenmeyer flasks. The flasks were incubated at 30 °C for 10 days in static fermentation conditions in an incubator (Memmert, Germany) and at 30 °C for 7 days at 120 rpm in continuously stirred fermentation conditions in a shaking incubator. BC produced as white sheets or pellicles under static and white granules under stirred fermentation conditions^{1,10,31,34,35}.

Purification of BC and freeze drying

After separating BC pellicles and granules using filtration, they were washed three times with deionized water. Then they were boiled in a 0.5 M aqueous solution of NaOH, (Merck, Germany) at 80 °C for 15 min using bain-marie (Memmert, Germany) for removing microbial cells and medium components residue. The obtained BC pellicles and granules were washed several times with deionized water until reaching neutral pH, then BCs were soaked in deionized water overnight until achieved cream-like color. Finally, both two kinds of BCs were freeze-dried at -60 °C for 48 h by a freeze dryer (Operon, Korea). The dry weight of BCs was reported as yield by grams per liter^1,36.

Characterization of BC

Moisture content

The BC gels (BC pellicles and BC granules) were weighed, placed in an oven (105 °C) (Memmert, Germany), and dried until the samples reached equilibrium. The weight loss was calculated as moisture content according to the Eq. (1)^1,35:

1

Water holding capacity (WHC) and ratio of cellulose fibers in the gel (Rcf)

The weight of purified BCs (BC pellicles and BC granules) was measured before (wet weight) and after freeze-drying (dry weight), then WHC was calculated by the Eq. (2)¹ and Rcf by the Eq. (3)^1,37.

2

3

Fourier transforms infrared spectroscopy (FTIR)

Dried BC was ground and mixed with potassium bromide (KBr) powder; 20 mg of the combination was pressed into a tablet. FTIR spectrum was investigated using a Thermo Nicolet AVATAR 370 (USA) in the transmittance mode in the wavenumber range of 4000 to 400 cm⁻¹ with a resolution of 4 cm⁻¹¹.

X-ray diffraction (XRD)

Dried BC was ground for X-ray diffractometry (XRD) analysis. The diffractograms were recorded at room temperature, using radiation of Ni-filtered Cu (Copper), and X-ray radiation (λ = 1.54056 A°). The operating voltage and the current were 40 kV and 40 mA. Data were scanned in reflection mode in the 10 to 60°2θ range with a step of 0.05°2θ intervals. The scans proceeded at 1 s per step (Model Explorer 01, GNR, Italy). HIGH SCORE PLUS software (Version 4.9; https://panalytical-highscore.software.informer.com/) was used to process the diffraction pattern and calculate the crystallinity, 2θ peak positions, and d-spacing of the dried BC^1,37. The degree of crystallinity (Xc), was calculated by the ratio of the area in a diffractogram corresponding to the crystalline region to that of both crystalline (Scr) and amorphous regions (Sa) by Eq. (4)², The crystal sizes (D), and The crystallinity index (CI) of the cellulose samples were calculated by Scherrer equation, Eq. (5)², and Segal method, Eq. (6) respectively³⁸:

4

5

6

Scanning electron microscopy (SEM)

The morphology of fibril dried BC was studied by SEM. A thin layer of BC samples was coated with gold using an ion sputter coater and observed at 20 kV, by microscope (LEO, VP 1450, Germany) operated under 100×, 1000×, 5000×, and 10,000× magnification³⁴.

Statistical analysis

The experiments were performed in triplicate and the values were reported as the mean ± standard deviation. Analyses of BC yield produced by different isolates under static or stirred fermentation condition analyzed by ANOVA and followed by a Bonferroni post-hoc test to identify significant differences between the means at a probability of 95%. Also, student’s t-test was employed to compare selective samples characteristics of two fermentation technique (static and stirred). Statistical analysis of the data was carried out using Minitab software (Version 19; https://minitab.informer.com/19/). Charts were drawn using the Microsoft Excel software (version 2019, https://www.microsoft.com/en-us/microsoft-365/previous-versions/microsoft-office-2019), and OriginPro 2023 (Version 10; https://www.originlab.com/demodownload.aspx).

Results and discussion

Screening BC species in kombucha SCOBY by conventional and molecular methods

In total, 15 colonies with respect to the ability in BC production with differences in cell morphologies were isolated from the 4 different Kombucha SCOBY samples. Out of the 15 isolates, 8 isolates belonged to the Kombucha SCOBY sample from the Netherlands (Ne1, Ne2, Ne3, Ne4, Ne5, Ne6, Ne7, and Ne8). Also, 3 isolates (Ir1, Ir2, and Ir3) from Iranian, 2 isolates (Am1, Am2) from American, and 2 isolates (Ch1, Ch2) from Chinese samples were obtained. The isolates were screened using some biochemical determination assay for bacterial classification. All the isolates featured Gram-negative bacteria; 7 colonies were coccus, and the rest were short or long rods. Only the Ne7 produced brown pigment on the GYC-A culture medium. All the isolates were oxidase negative and catalase positive, except Ne4 and Ne5 which demonstrated as catalase negative (Table 1).

Table 1.

Some physiological and biochemical characteristics of bacterial isolates.

Isolates Codes	Cells Shape	Gram-Stain	Oxidase activity	Catalase activity	Production of cellulose	Production of water-soluble pigment
Ne1	Cocci	-	-	+	+	-
Ne2	Cocci	-	-	+	+	-
Ne3	Cocci	-	-	+	+	-
Ne4	Cocci	-	-	-	+	-
Ne5	Cocci	-	-	-	+	-
Ne6	Short Rod	-	-	+	+	-
Ne7	Short Rod	-	-	+	+	+
Ne8	Short Rod	-	-	+	+	-
Am1	Short Rod	-	-	+	+	-
Am2	Short Rod	-	-	+	+	-
Ch1	Long Rod	-	-	+	+	-
Ch2	Long Rod	-	-	+	+	-
Ir1	Cocci	-	-	+	+	-
Ir2	Cocci	-	-	+	+	-
Ir3	Long Rod	-	-	+	+	-

Due to the difficulty of identification at the species level by conventional morphological and biochemical techniques, molecular methods are indispensable for the unambiguous identification of species²³. In total 7 isolates with different morphological characteristics were subjected to molecular techniques and identified at the species level after comparing the sequences obtained from the 16 S rRNA gene with the data available in the NCBI database (Amplification of 16 S rRNA gene of the isolated AAB strains (Supplementary Fig. 1), and also, the original, uncropped full-length gel (Supplementary Fig. 2) has been presented in Supplementary Information file). The species accommodated to the Gluconacetobacter genus are divided into two groups named G. liquefaciens group and G. xylinus group, on the basis of results obtained by 16 S rRNA gene sequence analyses and by phenotypic characterization. Due to reclassification, 12 species of the G. xylinus group were transferred to the new genus, Komagataeibacter as new combinations. There are differences between the genera Komagataeibacter and Gluconacetobacter. The genus Komagataeibacter is characterized morphologically by a lack of motility and a lack of flagellation, however the Gluconacetobacter strains have peritrichous flagella and good motility^22,23. So, all of the identified species accommodated to the Gluconacetobacter group however based on the latest re-classification except G. liquefaciens, the other identified strains belonged to the genus of Komagataeibacter.

According to sequencing results, 2 isolates were identified as K. sucrofermentans, 2 isolates were matched with K. cocois, and 3 other isolates were classified as K. intermedius, K. xylinus, and G. liquefaciens (Table 2). All 7 identified strains have submitted to NCBI gene bank repository with new exclusive accession numbers. The constructed phylogenetic tree of identified isolates is shown in Fig. 2. The constructed Neighbor-joining tree showed the phylogenetic positions of the Acetobacteraceae family based on the 16 S rRNA gene sequences. It demonstrated the G. liquefaciens and Komagataeibacter strains are belong to two groups of Gluconacetobacter.

Table 2.

The identified AAB isolates using sequencing the 16S rRNA genes method.

Isolates Codes	Genomes	SCOBY origin	Accession number
Ne4	Komagataeibacter sucrofermentans NE4	Netherlands	PP716809.1
Ne6	Komagataeibacter cocois NE6	Netherlands	PP716810.1
Ne7	Gluconacetobacter liquefaciens NE7	Netherlands	PP716811.1
Am2	Komagataeibacter cocois AM2	USA	PP716812.1
Ch1	Komagataeibacter xylinus CH1	China	PP716813.1
Ir2	Komagataeibacter sucrofermentans IR2	Iran	PP716814.1
Ir3	Komagataeibacter intermedius IR3	Iran	PP716815.1

Fig. 2.

The constructed Neighbor-joining tree showing the phylogenetic positions of the family Acetobacteraceae based on the 16 S rRNA gene sequences using MEGA 7 (Escherichia coli was used as the out group).

The microbiota of the SCOBY mostly depends on its origin and is greatly varied²⁰. With respect to the current research, Komagataeibacter is the most dominant identified as the largest bacterial genus present in kombucha biofilm as reported by³⁹ and ⁴⁰. The study by³⁹ which applied molecular techniques (metagenome, ITS1, and 16srRNA sequencing) to identify of bacterial kombucha starter, showed that 99% of the sequences assigned to Komagataeibacter genus and classified as K. rhaeticus. According to⁴¹ the two dominant acetic acid bacteria isolated from the New Zealand Kombucha samples were identified as G. potus LMG1764 and A. musti Bo7. Also, K. cocois sp. nov, isolated from coconut milk, was reported as a novel cellulose-producing strain by⁴². Due to literature survey, the other identified Komagataeibacter strains, as cellulose-producing are K. kombuchae⁴³, K. saccharivorans³¹, K. xylinus^4,44, K. sucrofermentans, K. hansenii⁴⁵, K. intermedius²⁴, K. rhaeticus⁴⁶, G. liquefaciens, G. europaeus, G. oxydans, G. saccharivorans, and A. peroxydans⁴⁷. The various results obtained in different research are due to the vast diversity of the species, origin, frequency, and different identification methods, which can be seen in the current research.

Evaluation of bacterial cellulose production yield under static and stirred fermentation conditions

Due to data extracted from analyses variance and comparison of means, the BCs yield significantly influenced the strains and fermentation conditions. Under the static model, among of all identified strains, K. intermedius IR3, showed the highest BC production yield of 5.733 ± 0.170 gL⁻¹ (dry weight), in the HS medium. Meanwhile, the least efficient strain was G. liquefaciens NE7, with the production of 0.989 ± 0.269 gL⁻¹ (Fig. 3). According to the result, under the stirred conditions method, the rate of BCs production based on different species differed between 0.211 ± 0.087 gL⁻¹ and 12.689 ± 0.808 gL⁻¹ (dry weight), namely belonging to G. liquefaciens NE7 and K. xylinus CH1 respectively (Fig. 4). On the other hand, bacterial sources significantly affected the yield; K. sucrofermentans NE4 isolated from Netherland’s SCOBY had a higher yield when compared with the same species isolated from local Iranian SCOBY (K. sucrofermentans IR2), Also in K. cocois AM2; American source, showed more capability in BCs production when compared to same species isolated from Netherlands’s starter (K. cocois NE6) (Figs. 3 and 4). The G. xylinus ATCC 10,245 as a reference starter has been used to compare the yield of BCs production with the isolated species. Under the static conditions except for G. liquefaciens NE7, the yield was significantly lower than the other isolates. However, under the stirred conditions, the BC production yield by reference species was greater than K. sucrofermentans NE4, K. sucrofermentans IR2, and G. liquefaciens NE7 (Figs. 3 and 4).

Fig. 3.

Yield comparison of identified strains in bacterial cellulose production under static fermentation conditions (n = 3, mean ± SD), different letters mean P < 0.05.

Fig. 4.

Yield comparison of identified strains in bacterial cellulose production under stirred fermentation conditions (n = 3, mean ± SD), different letters mean P < 0.05.

Previous studies regarding the BC production yield of Komagataeibacter strains in HS medium under static conditions have been reported in various ranges. For instance, K. intermedius FST213, 1.2 gL⁻¹³⁶, K. intermedius JF2, 1.2 gL⁻¹⁴⁸, K. intermedius ENS15, 1.1 gL⁻¹²⁴, K. intermedius 6 − 5, 5.28 gL⁻¹⁴⁹, K. xylinus LMG 1515, 0.75 gL⁻¹⁵⁰, K. xylinus ATCC 53,524, 0.72 gL⁻¹, K. xylinus ATCC 10,245, 0.18 gL⁻¹, K. xylinus ATCC 700,178, 0.19 gL⁻¹, K. xylinus NBRC 13,693, 0.6 gL⁻¹, K. xylinus KTH 5655, 0.42 gL⁻¹⁵¹, K. xylinus DSM 2325, 1.46 gL⁻¹⁵², K. saccharivorans MGC-N8817, 3.8 gL⁻¹, K. saccharivorans MGC-N8818, 2.7 gL⁻¹⁵³, K. rhaeticus PG2, 4.0 gL⁻¹⁵⁴. The studies which focused on stirred conditions are so limited. In one of the latest works, the amount of bacterial cellulose produced by K. sp. nov. CGMCC, at 160 rpm, achieved 3.22 gL⁻¹⁵⁵. In another study, K. xylinus K975, and K. xylinus K1011 produced 3.54 and 4.69 gL⁻¹ of bacterial cellulose, respectively, at 150 rpm⁵⁶.

The biosynthesis of BC is a complex aerobic process that is regulated by a large number of specific enzymes and proteins and directly linked with cellular catabolism. Different factors such as agitator speed, energy sources, oxygen level, pH, temperature, and types of species are involved in BC production¹⁰. According to previous studies on fermentation methods, BC production under static culture requires longer incubation time and produces less bacterial cellulose; in contrast, stirred fermentation leads to more product in a shorter time. Although static fermentation method occupies a lot of space, most of the commercial bacterial cellulose produced in this way⁵⁷.

The cell density and more availability of oxygen in the medium influence and supported the high productivity in stirred conditions⁵⁶. However, some reports mentioned that the accretion of mutants development due to increasing agitator speed may cause a negative point of BC’s yield^7,58,59 and may explain the low BC production by K. sucrofermentans NE4 and G. liquefaciens NE7, under stirred method in this study. In addition to the above physicochemical conditions, the genotype is also the main parameter to extend the yield²⁵.

Our results have shown that Komagataeibacter genus strains were more efficient in BC production than G. liquefaciens NE7 strain under both static and stirred fermentation conditions. According to previous studies, the strains of the Komagataeibacter genus have been widely recognized as the most efficient BC producers²³. Moreover, due to very diverse strains among the Komagataeibacter genus, the yield and properties of cellulose could be strongly different^23,25; so, a possible explanation of the gained results may lie in the genetic features of Komagataeibacter genus.

Comparison of bacterial cellulose characteristics under static and stirred conditions

Moisture content, water-holding capacity (WHC) and ratio of cellulose fibers in the gel (Rcf)

Physicochemical properties of BCs produced by K. intermedius IR3 under static, and K. xylinus CH1 under stirred fermentation conditions were analyzed. These two strains were the most efficient ones under each fermentation conditions based on the yield results. Under the static method, BC produced as a sheet, while the stirred conditions led to the production of BC in the form of granules. The results showed that the moisture content of BC gel and the water-holding capacity of dried BC under static was more than stirred conditions (Table 3). The high moisture content of BC gel and WHC of dried BC could be explained by its structure, (1,4) glycosidic bond of β-d-glucopyranose biopolymer containing several hydroxyl groups, which make it a hydrophilic material^1,7,26,60. This property also might be related to the reticulated structure and the capillary force of the BC network^7,26. Culture conditions affect the morphological and structural characteristics of bacterial cellulose which led to unique properties such as vast water-holding capacity. BC synthesized under static conditions line up as a crossover dense network and the fibers make the connection between layers which could form a large amount of linear and vertical hole with high water holding capacity⁷. On the other hand, BC synthesized under stirred shows irregular fibrils and is much looser. This BC has a multi-layered three-dimensional network structure, which is determined by the way of microfibrils’ assembling. During the BC formation, in an stirred and dynamic environment assembling of BC microfibrils would be damaged, so it is difficult for BC to form an ordered layer structure and hard and dense network²⁶. Based on the results, the ratio of cellulose fibers in the gel in stirred conditions was more than static as shown in Table 3. The high ratio of cellulose fibers in the gel is related to the high BC yield under stirred fermentation conditions^26,37.

Table 3.

Physicochemical properties of freeze-dried BC produced by K. Xylinus CH1 under stirred and K. Intermedius IR3 under static fermentation conditions.

Sample	Moisture content (%)	Water-holding capacity (%)	Rcf (%)
Dried BC produced under static conditions	98.368 ± 0.040 a*	6032.189 ± 150.501 a	1.632 ± 0.040 a
Dried BC produced under stirred conditions	97.571 ± 0.189 b	4041.052 ± 305.563 b	2.429 ± 0.189 b

*Data are expressed as mean ± SD, n = 3, different small letters in each column indicate P < 0.05.

Fourier transforms infrared spectroscopy (FTIR)

Structural polymorphic analysis of two kinds of BCs carried out by FTIR analyses were shown in Fig. 5. Dried BCs that were produced under static and stirred fermentation conditions, showed several typical slim, weak, broad, and strong bands in the different regions the same as pure cellulose type I (C₆H₁₀O₅) fingerprint^34,54,61. The sharp peaks as OH stretching (3358 cm⁻¹ and 3356 cm⁻¹ for stirred and static respectively) due to the intermolecular hydrogen bonding, and the signature peak as CH2 symmetric (1430 cm⁻¹) in both methods, confirm the property cellulose I in the structure. Also the other complex fingerprint of stirred and static BC is related to weak and broad bands of a β-linked polymer^{1,26,34,54,61}.

Fig. 5.

FTIR spectrum of freeze-dried BC produced by K. intermedius IR3 under static and K. xylinus CH1 under stirred fermentation conditions.

FTIR spectrum of BC produced by K. xylinus CH1 under stirred conditions showed the peaks and stretching as OH stretching (3358 cm⁻¹), CH stretching (2922 cm⁻¹), CH2 stretching (2847 cm⁻¹), OH angular bending (1650 cm⁻¹), HOH angular bending (1545 cm⁻¹), CH2 symmetric (1452 cm⁻¹), CH2 symmetric (1430 cm⁻¹), CH symmetric (1372 cm⁻¹), CH2 symmetric (1316 cm⁻¹), CO/COH stretching (1162 cm⁻¹), CO/COC stretching (1111 cm⁻¹, 1059 cm⁻¹ and 1034 cm⁻¹), CH symmetric (902 cm⁻¹), CH2 symmetric (796 cm⁻¹) and OH symmetric (670 cm⁻¹, 617 cm⁻¹ and 559 cm⁻¹). The peaks of the FTIR spectrum of BC produced by K. intermedius IR3 under static fermentation conditions is similar to stirred one except that some peaks have shifted to the left.

X-ray diffraction (XRD)

X-ray diffractograms of BCs showed crystalline peaks and amorphous haloes in the structures (Fig. 6). The obtained XRD patterns were similar to the native cellulose I pattern, with peaks positions at 2θ of 14.4°, 16.7° and 22.6°¹. According to the results, the crystal type of cellulose would not be influenced by the fermentation conditions, but the crystallinity (crystallinity index and crystallinity degree of BC) decreased under stirred fermentation method. It is probably because of the dynamic environment during the stirred conditions, which damaged the regularity of the BC chain and led to the irregularity of the crystalline structure. The diffractograms confirmed 3 main characteristic peaks standing for crystal planes 101, 10^¯1, and 002, d-spacing (A°) respectively (Table 4) which displayed the typical profile of the cellulose I^10,26,37.

Fig. 6.

X-ray diffractogram of freeze-dried BC produced by K. intermedius IR3 under static and K. xylinus CH1 under stirred fermentation conditions.

Table 4.

Crystallinity characteristics of freeze-dried BC produced by K. Xylinus CH1 under stirred and K. Intermedius IR3 under static fermentation conditions.

Sample	Peak position (°2θ) (1 0 1, 1 0¯1, 0 0 2)	d spacing (°A) (1 0 1, 1 0¯1, 0 0 2)	Crystallite size (°A) (1 0 1, 1 0¯1, 0 0 2)	Crystallinity Index (CI%)	Degree of crystallinity (XC%)
Static method	14.55°, 16.10°, 22.40°) 2θ	(6.08°, 5.50°,3.96°) °A	(89°, 89.1°, 90°) °A	69.52% a*	76.64% a
Stirred method	(14.70°, 16.95°, 22.70°) 2θ	(6.02°, 5.22°, 3.91°) °A	(89°, 89.2°, 90°) °A	63.81% b	73.42% b

*Different small letters in each column indicate P < 0.05.

Scanning electron microscopy (SEM)

Morphology analysis of BCs was carried out by scanning electron microscopy (SEM), under 100×, 1000×, 5000×, and 10,000× magnification. SEM analysis under 100×, and 1000×, were shown fibers synthesized under the stirred conditions method possessed irregular size and shape and their structure is much looser than static ones. Under 5000× and 10,000× magnifications, cellulose ribbon-like fibrils were shown (Fig. 7). The fibrils in cellulose synthesized under static conditions have been lined up as a crisscross dense network and the fibers served connections between layers with a large number of longitudinal holes. On the other hand, BC produced under stirred fermentation conditions had an irregular multi-layered three-dimensional network structure with fewer holes. The morphological changes in BC beads affect their microstructures and various properties such as crystallinity, water-holding capacity, water absorption rate, porosity, and moisture content^34,60. The diversity of the shapes and ribbon sizes of synthesized BCs depends on the fermentation conditions and the type of starter bacteria. Similar observations were reported on the bacterial cellulose produced by other bacterial strains under static and stirred fermentation conditions methods^4,5,34.

Fig. 7.

SEM micrographs of BC produced by K. intermedius IR3 under static fermentation conditions: (a) 100×, (b) 1000×, (c) 5000× (d) 10,000×, magnification and K. xylinus CH1 under stirred fermentation conditions: (e) 100×, (f) 1000×, (g) 5000× and (h) 10,000× magnification.

Conclusion

The unique properties of BC nanofibers are influenced by the distinctive features of the species and the culture conditions. The present study aimed to evaluate the diversity of BC-producing strains found in kombucha SCOBY samples from four different geographical locations available in the global market. In general, seven dominant strains were identified belonging to the Komagataeibacter and Gluconacetobacter genera. Among the identified species, K. intermedius IR3, identified from the local Iranian SCOBY sample, and K. xylinus CH1, isolated from the Chinese SCOBY sample, were the most efficient BC producer strains under static and stirred fermentation conditions, respectively. The yield of BCs of almost all species under stirred fermentation conditions was greater than under static fermentation conditions, providing an obvious advantage to industries for mass production. Examining the physicochemical, mechanical, and thermal characteristics of both types of BC emphasized their ability to be used in various industries, including as additives in food products or medicine.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

Azadeh Khiabani: Investigation, Formal Analysis, Methodology, Data curation, Writing – Original Draft, Reviewing and Editing. Mahboobe Sarabi-Jamab: Investigation, Validation, Writing – Reviewing and Editing, Supervision, Project administration. Monir-sadat Shakeri: Investigation, Validation, Reviewing and Editing. Abolfazl Pahlevanlo: Investigation, Validation, Reviewing and Editing. Bahareh Emadzadeh: Investigation, Validation, Reviewing and Editing.

Data availability

The datasets generated and analyzed during the current study are available in the [NCBI] repository, Prokaryotic 16S rRNA / Identification Acetobacteraceae family from kombucha SCOBY: [https://www.ncbi.nlm.nih.gov/nuccore/?term=PP716809:PP716815[accn] Identified strains are available in the [NCBI] repository separately: [Komagataeibacter intermedius strain IR3 16S ribosomal RNA gene, partia - Nucleotide - NCBI (nih.gov), Komagataeibacter sucrofermentans strain IR2 16S ribosomal RNA gene, pa - Nucleotide - NCBI (nih.gov), Komagataeibacter xylinus strain CH1 16S ribosomal RNA gene, partial se - Nucleotide - NCBI (nih.gov), Novacetimonas cocois strain AM2 16S ribosomal RNA gene, partial sequen - Nucleotide - NCBI (nih.gov), Gluconacetobacter liquefaciens strain NE7 16S ribosomal RNA gene, part - Nucleotide - NCBI (nih.gov), Novacetimonas cocois strain NE6 16S ribosomal RNA gene, partial sequen - Nucleotide - NCBI (nih.gov), Komagataeibacter sucrofermentans strain NE4 16S ribosomal RNA gene, pa - Nucleotide - NCBI (nih.gov)].

Declarations

Competing interests

The authors declare no competing interests.