Upregulation of ACSL, ND75, Vha26 and sesB genes by antiepileptic drugs resulted in genotoxicity in drosophila

Abstract

Clobazam (CLB) and Vigabatrin (VGB) are commonly used antiepileptic drugs (AEDs) in the treatment of epilepsy. Here, we have examined the genotoxic effect of these AEDs in Drosophila melanogaster. The Drosophila larvae were exposed to different concentrations of CLB and VGB containing food media. The assessment encompassed oxidative stress, DNA damage, protein levels, and gene expression profiles. In the CLB-treated group, a reduction in reactive oxygen species (ROS) and lipid peroxidation (LPO) levels was observed, alongside increased levels of superoxide dismutase (SOD), catalase (CAT), and nitric oxide (NO). Conversely, the VGB-treated group displayed contrasting results, with increased ROS and LPO and decreased SOD, CAT, and NO levels. However, both CLB and VGB induced DNA damage in Drosophila. Proteomic analysis (SDS-PAGE and OHRLCMS) in the CLB and VGB groups identified numerous proteins, including Acyl-CoA synthetase long-chain, NADH–ubiquinone oxidoreductase 75 kDa subunit, V-type proton ATPase subunit E, ADP/ATP carrier protein, malic enzyme, and DNA-binding protein modulo. These proteins were found to be associated with pathways like growth promotion, notch signaling, Wnt signaling, neuromuscular junction (NMJ) signaling, bone morphogenetic protein (BMP) signaling, and other GABAergic mechanisms. Furthermore, mRNA levels of ACSL, ND75, Vha26, sesB, and Men genes were upregulated in both CLB and VGB-treated groups. These findings suggest that CLB and VGB could have the potential to induce genotoxicity and post-transcriptional modifications in humans, highlighting the importance of monitoring their effects when used as AEDs.

Graphical Abstract

Graphical Abstract.

Introduction

Epilepsy is a recurring neurological disorder that significantly affects around 1% of the global population. ¹ CLB and VGB are the newly introduced AEDs for epilepsy treatment and their mode of action is not completely understood. CLB is a benzodiazepine, that binds to the GABA receptor to increase the frequency of the chloride channel i.e. responsible for the GABA stimulation, thus enhancing the gamma-amino-butyric acid (GABA) inhibitory neurotransmitter in the brain.^2,3 VGB is an antiepileptic drug that was designed to inhibit GABA-transaminase, by decreasing the levels of GABA, and irreversibly inhibitors enzyme activity in the nervous system.⁴ It is known to change the functional activity in the neurotransmitter pathway and biochemical process which stimulates the GABAergic system.⁵

Various chemical compounds, including phenytoin, Benzopyrene, and Hydroxyurea, are linked to teratogenesis whereas, oxidative stress has been a contributing factor in genotoxicity processes.^6,7 Numerous studies have provided evidence supporting the involvement of oxidative stress in Valproic acid (VPA)-induced teratogenic effects.⁸ Oxidative stress refers to an imbalance between oxidant and antioxidant enzymes, which can lead to DNA, protein and lipid damage in cells, as well as changes in chromosome stability, genetic mutations and modulation of cell growth. These effects may give rise to neurological disorder conditions such as epilepsy, cancer and inflammatory diseases.^8,9 Reactive oxygen species (ROS) are involved in various signalling molecules that regulate the biological and physiological activities of the organism.¹⁰ Antioxidants have a significant role in scavenging ROS, eliminating free radicals, and preventing the generation of ROS.¹¹ The molecular oxygen produces the ROS, which originates from the mitochondria and xanthine oxidase. Catalase, superoxide dismutase, glutathione peroxidase, and glutathione reductase are the well-known enzymes involved in eliminating ROS.^12,13 Reduced glutathione, vitamins C and E are also known to be involved in eliminating ROS as non-enzymatic antioxidants.¹⁴ Chronic exposure to AEDs has been shown to generate ROS and free radicals, resulting in the development of toxic metabolites and genotoxicity in organisms.^15,16

Nitric Oxide (NO), is a secondary messenger and a neurotransmitter. NO influences the excitatory and/or inhibitory neuronal activities during epileptic conditions.^1,17–20 The brain is highly susceptible to oxidative stress due to the abundance of mitochondria, high oxygen consumption, limited antioxidant system, and rich content of polyunsaturated fatty acids and iron that facilitate ROS formation. Catalase, an enzymatic antioxidant defense system, is notably lower in the brain compared to other organs.²⁰ The combination of these factors makes neurons highly vulnerable to oxidative stress, resulting in damage to their structure and function.²¹

DNA is the primary target of oxidative stress, with reactive intermediates causing chemical or structural changes in nucleotides, generating various base oxidation states and modification products including basic apurinic/apyrimidinic (AP) sites, single and double-strand breaks, promoting mutations.^22–24 In a retrospective study, it was discovered that the long-term consumption of phenytoin by a female patient with epilepsy has disrupted the patient’s menstrual cycles.²⁵ Similarly, in an in vitro study, embryonic cells exposed to VPA, reveal the generation of ROS that can lead to oxidative protein alterations and DNA damage, potentially resulting in embryo malformations.²⁶ ROS can stimulate gene expression through various modulated signaling pathways, including cAMP-mediated cascades, calcium-calmodulin pathways, and intracellular signal transducers like nitric oxide.²⁷

The GABA system exhibits both inhibitory and excitatory effects, with alterations in glutamate and GABA neurotransmission levels implicated in seizure activity across various types of epilepsy and brain regions.²⁸ Low doses of PCP display antiepileptic effects, but, can exacerbate seizures at higher doses.^29–31 VGB’s antiepileptic action primarily stems from decreasing GABA levels, the major inhibitory neurotransmitter in the adult central nervous system, thereby counteracting glutamate-mediated excitatory signaling.³² Studies with GABAA receptor point-mutated mice indicate that sedative effects of Benzodiazepine-sensitive drugs are mediated by GABAA receptors containing a1 subunits, while those with a2 and a3 subunits contribute to anxiolytic properties and spinal antihyperalgesic effects of classical benzodiazepines.^33–35

One study has shown that, VGB induced genotoxic effects in the Male Wistar rats.³⁶ Whereas, there are minimal or no data on genotoxic effects reported specifically with CLB. However, a review paper, has mentioned the genotoxic effects of CLB and there were no other in vivo or in vitro reports were found.³⁷ Hence, this is the first novel study conducted to report the genotoxic effects of CLB observed in vivo, i.e. Drosophila as a model organism. The current study focuses on understanding the role of these AEDs in inducing teratogenesis and genotoxicity after exposure in Drosophila. The teratogenic effect of these AEDs have been studied and the results revealed that these AEDs can impact the developmental, reproductive, behavioural and phenotypic anomalies after exposure.²¹ Though the exact mechanism of action of CLB and VGB remains partly known, the existing evidence suggests that administering CLB and VGB to organisms may lead to genotoxicity (cellular proteins, DNA, RNA, and membrane lipids). It is suspected that these AEDs might interact with GABA receptors in the presynaptic to postsynaptic cleft, influencing gene expressions and resulting in changes in oxidative stress levels, including reactive oxygen species, lipid peroxidation, superoxide dismutase, catalase, nitric oxide, and certain proteins. These factors contribute to teratogenesis in organisms. Eventhough, rodent in vivo models were the first priority for genotoxicity studies due to their easy availability but ethical issues are of major concern. We selected Drosophila melanogaster as an in vivo model as it possess many metabolic process and DNA repair mechanism. Similar to the mammals and its majority of genes are homologous to those of humans.^38–40 The main objective is to investigate the impact of two AEDs on oxidative stress (antioxidant and oxidant enzymes), DNA damage, protein profile, and corresponding gene expressions after sub-chronic exposure to D. melanogaster.

Materials and methods

Drosophila stock

Flies were cultured on standard Drosophila medium (SDM), comprising agar, brown sugar, cornmeal, and propionic acid as a preservative against microbial contamination. The stock population was maintained at a temperature of 24 ± 1 °C and a relative humidity of 65%–70%. Third-instar larvae were used in our experiments and exposed to media containing different concentrations of CLB and VGB.

Oxidative stress assays

Protein sample preparation

A group of 25 larvae from CLB or VGB treated for 72 ± 1 h and vehicle control (DMSO or PBS) were homogenized using 100 μL chilled sodium phosphate buffer (pH 7.4) containing protease inhibitors cocktail. The homogenized mixture was centrifuged at 4,000 rpm for 10 min at 4 °C. The resulting supernatant was collected for further assays.⁴¹

Reactive oxygen species (ROS)

Idiomatic expressions of ROS were analysed by using 2′,7′-dichloro-dihydro-fluorescein diacetate (DCFH-DA) dye. The reaction mixture contained 1:10 dilution of the larval sample, Locke’s buffer solution (3.6 mM NaHCO₃, 154 mM NaCl, 5.6 mM KCl, 2 mM CaCl₂, 10 mM Glucose, 3.6 mM HEPES and pH 7.4) and 10 μL of 5 μM DCFH-DA. The reaction mixture was incubated at 24 °C for 30 min in the dark. The fluorescence intensity was measured at 480/530 nm (excitation/emission) in a fluorescence spectrophotometer (Cole Parmer, USA). The value was expressed as a picomole of dichloro fluorescein formed/mg protein/min.⁴²

Lipid peroxidation (LPO)

The concentration of LPO was measured by using malondialdehyde (MDA) analogues of 1, 1, 3, 3-tetramethoxypropane as standard by measuring thiobarbituric acid (TBA)-TBARS.^43,44 To 90 μL of larval homogenized supernatant, 5 μL of 10 mM Butylated Hydroxytoluene (BHT), 200 μL of 0.67% TBA, 600 μL of 1% H₃PO₄, and 105 μL of H₂O were added. This reaction mixture was incubated at 90 °C for 30 min in a dry block heater (IKA, Germany). Absorbance was measured at 532 nm using a UV-spectrophotometer (MultiSkan Sky, Thermo Scientific) and the results were expressed as nmol MDA/mg protein.

Super oxide dismutase (SOD)

SOD activity was assessed using the method as described earlier.⁴⁵ In the spectrophotometer cuvette, 50 μL of larval homogenate and 2.85 mL Tris- EDTA buffer (pH 8.2) were added. 100 μL of 15 mM pyrogallol was then added to initiate the reaction. The rate of pyrogallol was monitored for 3 min with 30 s intervals at 440 nm using a UV-spectrophotometer (MultiSkan-Sky, Thermo Scientific). The amount of protein that inhibits pyrogallol autoxidation by 50% is defined as one unit. The measured value of SOD activity was expressed as units/mg protein.

Where A is the blank solution and B is the test sample.

Catalase (CAT)

The CAT activity was determined as a measure of hydrogen peroxide (H₂O₂) decomposition by the enzyme.^46,47 50 μL of the homogenized sample and 500 μL of 30% H₂O₂ were mixed together and incubated for 1 min. The reaction was stopped by adding 1 mL of potassium dichromate (K₂Cr₂O₇) reagent. The reaction was monitored and the absorbance was read at 570 nm using UV-Spectrophotometer. The activity was expressed as μM of H₂O₂/min/mg protein.

The rate constant (k) equation for a first-order reaction was utilized to measure catalase activity:

Where, t = time

S^o = absorbance of the standard solution

S = absorbance of the sample

Nitric oxide (NO)

The nitrate level was estimated as per the procedure of Eleftherianos et al.,⁴⁸ using nitrate-derivative as a standard. The homogenate or nitrate standard was mixed with 50 μL Griess reagent-A (1% sulfanilamide in 2.5% H₃PO₄), 50 μL Griess reagent-B (0.1% naphthyl ethylene diamine dihydrochloride in 2.5% H₃PO₄) and incubated at 24 °C for 10 min. The absorbance was measured at 595 nm using a UV-Spectrophotometer and the data were presented as amount of nitrite in μMol.

Comet assay

Third-instar larvae were exposed to DMSO, PBS, as well as different concentrations of CLB and VGB for up to 72 ± 1 h and washed with PBS. About 1 g dry weight of larvae was homogenized in 1 mL of PBS, centrifuged at 4,000 rpm for 10 min at 4 °C (Beckman Coulter, Allegra X-30R) and the supernatant was collected for the assay. 80 μL of cell suspension was mixed with the freshly prepared 120 μL of low melting point agarose (LMA) coated on the slide, which had been previously coated (24 h before) with the normal melting point agarose (NMA). The slide was then covered with a coverslip and incubated at 4 °C for 30 min. The cover slip was then removed and the slide was placed in the freshly prepared lysis buffer (1% L-lauryl sarcosine, 100 mM Na₂EDTA, 2.5 M NaCl, 0.25 M NaOH, 10 mM Tris, pH 10), Triton X-100 and dimethyl sulfoxide mixture, incubated for 1 h at 4 °C in the dark.⁴⁹ The DNA was unwounded for 25 min at 4 °C using a horizontal gel electrophoresis chamber containing freshly prepared alkaline electrophoresis buffer (Na₂EDTA 1 mM and NaOH 300 mM). This process was photosensitive and carried out in low light conditions to avoid additional DNA damage⁵⁰ for 45 min at 9 V and 100 mA (Genie, Bengaluru). The slides were then washed at least twice by placing them in a washing buffer (Tris-0.4 M, pH 7.5) for 5 min after electrophoresis. Slides were dehydrated in 100% ethanol for 3 min. After drying, the slides were stained with ethidium bromide (20 μg/mL, 15 μL/slide). Slides were observed using a fluorescent microscope (40X) (Nikon, TS-100) with a green filter (images were captured within 4 h, stored at 4 °C), and tail DNA (%) was analysed by using Comet Score 2.0 software.

Total protein

Total protein was measured using the method of Lowry et al.,⁵¹ using BSA as a standard. About 25 μL of supernatant, 75 μL of Milli-Q water and 25 μL of Lowry’s reagent were mixed together in 96 well plate (Tarsons) and pre incubated for 10 min at 25 °C. After pre incubation, the Folin and Ciocalteu’s phenol reagent was added and incubated for 30 min at 25 °C in the dark. The absorbance was measured at 660 nm and the protein concentration (μg/ml) in test groups was measured by using BSA as standard.

SDS-PAGE analysis

The characterization of larval homogenate proteins was performed by Tris-glycine SDS-PAGE.⁵² Larval homogenized DMSO, PBS, CLB and VGB treated samples were prepared similarly as mentioned in the comet assay. About 50 μg/10 μL of homogenized samples of control (DMSO, PBS) as well as test groups (different conc. of CLB and VGB) were separated using 4% stacking and 12% resolving gel using and electrophoresed at 150 V for 75 min. To determine the molecular weight of our proteins, we used a high range molecular protein ladder (11–245 kDa; Himedia). After electrophoresis, separated protein bands were detected by staining the gel overnight using Coomassie blue followed by destaining using acetic acid-ethanol. The gel band of concern was cut out and placed in a 1% acetic acid solution for further analysis.

Protein identification

In-gel digestion

The piece of gel band was destained with 50 mM ammonium bicarbonate buffer and 50% acetonitrile. Briefly, the mixture was vortexed for 15 min at RT until the stain was completely washed away and the supernatant was discarded. This was followed by the addition of 50 μL acetonitrile (ACN) for dehydration of gel at RT for 15 min. The protein was reduced using dithiothreitol for 20 min at 37 °C and then in 30 μL of 55 mM iodoacetamide for alkylation at 37 °C, 20 min. The supernatant was aspirated and the piece of gel was again dehydrated using ACN at RT for 5 min and aspirated to remove any residues of ACN. 13 ng/mL of trypsin buffer was added until the band was completely covered and incubated at 4oC for 90 min followed by adding 15 μL of 50 mM ammonium bicarbonate and incubated at 37 °C for 4 h. The digestion was halted by the addition of 5% formic acid, followed by vortexing for 15 to 20 min. After centrifugation, the aqueous extract was transferred to a fresh vial. The digested sample was used for the OHRLCMS analysis.

OHRLCMS analysis

The trypsin-digested peptide sample was analyzed using the OHRLCMS system, (Q-Exactive plus Biopharma-High Resolution Orbitrap, Thermo Fisher Scientific Pvt. Ltd). For LC departure, columns like Acclaim PepMap 100, 100 um × 2 cm nano viper and PepMap RSLC C18 2 um, 100 A × 50 cm were used. Two solvents such as solvent A (0.1% FA in Milli-Q water) and Solvent B (85:15 compassion of ACN and Milli-Q water with 0.1% FA) were used as mobile phase in a gradient manner for eluting the tryptic peptides from the nanocolumns. Examination of full-scan MS spectra was conducted using a mass range (m/z) of 50–8,000 amu in the Orbitrap mass spectrometer. The instrument was operated at a high resolution of 140,000 m/z to ensure accurate measurements. The data analysis was carried out using Thermo Proteome Discoverer (version 2.2) software. The resulting data was searched in the UniProt D. melanogaster protein database.

Gene expression analysis

Total RNA extraction and cDNA isolation

Larval exposure (control and test group) and sample preparation were the same as previously mentioned for comet assay and SDS-PAGE. The larval homogenate was centrifuged and the cells were collected from the supernatant. The RNA was extracted using RNAeasy spin column (Qiagen, Germany) by following the manufacturer’s instructions. Finally, the sample was eluted by using nuclease-free water (NFW). Total RNA was collected and quantified at 260/280 nm by using a UV- spectrophotometer (Tecan spark). Total RNA extract was adjusted to 50–100 ng/μL before the cDNA synthesis and stored at −80 °C until use. We used the QuantiTect® Reverse Transcription reagent to perform first strand cDNA synthesis on RNA template as per the manufacturer protocol with random incubation (5 min at 25 °C, 25 min at 42 °C and 10 min at 85 °C) of the 20 μL reaction mixture. This cDNA reaction mixture was used for PCR amplification and stored at −20 °C.

Quantitative RT-PCR

RT-qPCR was carried out using the template cDNA. About 1 μL cDNA, reaction mixture containing 1X SYBR green master mix, forward and reverse primer, was made up of 20 μL with nuclease free water. The sample was analysed in QIAquant 96 RT-PCR cycler with cycle conditions of denaturation for 25 s at 95 °C, initial denaturation for 2 min at 95 °C, and annealing for different genes like ACSL, Men at 55.8 °C, sesB, RPL32 at 57.6 °C, ND75, mod, Vha26 at 59.4 °C and repeated for 35 cycles. Relative quantitative mRNA level was analyzed by normalizing against the control gene and reference gene (RPL32) by using the 2^-ΔΔCT method.⁵³ The primer for targeted genes such as ACSL, ND75, Men, mod, Vha26, sesB and the reference gene RpL32 were designed by using NCBI primer blast⁵⁴ tool and synthesized at Barcode Bioscience Pvt. Ltd Bengaluru. The primer sequences of the targeted and reference genes with their Human orthologous genes are listed in Table 1.

Table 1.

Primer sequences of targeted genes and reference genes used in gene expression analysis.

Fly Gene	Human homologs		Primer sequence (5′–3′)
Acyl-CoA synthetase long-chain (ACSL)	Acyl-CoA synthetase long chain family member 3 (ACSL3)	Forward	GGTTGCGGAAAGTGTGTGTC
		Reverse	CTTACGATCTGCAAAAAGCGT
NADH dehydrogenase (ubiquinone) 75 kDa subunit (ND75)	NADH: ubiquinone oxidoreductase core subunit S1 (NDUFS1)	Forward	CGATCTGTCCTACGACCACG
		Reverse	GGGATGACAAACTTACCGGC
Malic enzyme (Men)	Spermidine synthase (SRM)	Forward	TGGTGACAATGAGGTGGTCG
		Reverse	AAGTTCACGGAACTGGGCAA
Modulo (mod)	-	Forward	GTCGCATTGTTCGCCAAGTT
		Reverse	CGGGTAACCCACCTGAAGTC
Vacuolar H[+]-ATPase 26kD subunit (Vha26)	ATPase H+ transporting V1 subunit E1 (ATP6V1E1) and ATPase H+ transporting V1 subunit E2 (ATP6V1E2)	Forward	CCTCTCTGCTGATACCTGCG
		Reverse	GGATTGCTCTCTCTCCACCG
stress-sensitive B (sesB)	Solute carrier family 25 member 4 (SLC25A4) and solute carrier family 25 member 5 (SLC25A5).	Forward	GAGCGGAAAACACTAACGCC
		Reverse	GCGGTATCGTAGAAGCCGAA
ribosomal protein L32 (RpL32) (Reference gene)	ribosomal protein L32 (RpL32)	Forward	CGTTTTTGGCGGTTTCGAGT
		Reverse	AATCCTCGTTGGCACTCACC

Statistical analysis

One-way ANOVA was performed for ROS, LPO, SOD, NO, CAT, protein, and comet assay followed by Tukey’s multiple comparisons test to record the significant differences. For NO, LPO, and protein analysis, regression analysis was carried out by the method of Goodness fit. Two-way ANOVA was carried out for gene expression to record significant differences. The analysis was performed using the statistical Software Graph Pad Prism (version 8.3).

Results

Effect of CLB and VGB on oxidative stress in Drosophila

Oxidative stress refers to elevated intracellular levels of ROS that cause damage to lipids, proteins, and DNA. For the evaluation of oxidative stress in Drosophila, third-instar larvae were exposed to various concentrations of CLB and VGB for 72 ± 1 h duration. To assess the oxidative stress levels, a series of colorimetric assays were conducted, which included measurements of ROS, LPO, SOD activity, CAT activity, and NO level. These assays were carried out to investigate the changes in oxidative stress enzyme activities during the development.

Reduction of reactive oxygen species

The fluorescent dye 2′-7’-Dichlorodihydrofluorescein diacetate (DCFH-DA) was employed to assess ROS levels following the administration of CLB and VGB to third-instar larvae. The results revealed a significant decrease in ROS generation with increasing treatment concentrations of both CLB and VGB, as compared to control. Specifically, the ROS generation, as compared to control, was found to be 17.2, 7.44, and 10.15%, for CLB treatment, whereas the values were 25.63, 24.38, and 14.79% for VGB treated groups at different concentrations (Fig. 1Ai and ii). These results indicate a notable reduction in ROS generation upon CLB and VGB treatment as compared to the control.

Fig. 1.

Oxidative stress analysis: A) ROS levels of CLB (i) and VGB (ii), B) LPO levels of CLB (i) and VGB (ii), C) SOD activity of CLB (i) and VGB (ii). D) Catalase activity of CLB (i) and VGB (ii) and E) Nitric oxide levels in Drosophila larvae (72 ± 2 h), treated with different concentrations of CLB (i) and VGB (ii). The data were statistically analyzed by using one-way ANOVA and expressed as ^*P < 0.05, ^**P < 0.01, ^***P < 0.001, ^****P < 0.0001, ns- nonsignificant.

Alteration in the lipid peroxidation level

The reactive intermediates produced by oxidative stress can alter the membrane bilayers causing lipid peroxidation. The final product of polyunsaturated fatty acid peroxidation in cells is known as MDA. After exposure to CLB, the MDA level showed a significant reduction of about 17, 20, and 4.5-fold at the different tested concentrations (Fig. 1Bi). In contrast, the VGB treatment groups showed significantly increase of about 3.5, 2.5, and 2-fold MDA levels as compared to the control group (Fig. 1Bii). These findings suggest that CLB exposure resulted in reduced lipid peroxidation, while VGB exposure led to an increase in lipid peroxidation levels in a concentration-dependent manner.

Altered superoxide dismutase activity

The SOD constitutes a very important antioxidant defense against oxidative stress in the body. During exposure to CLB and VGB, SOD activates stress molecules like oxygen free radicals. The SOD level was observed to increase after exposure to the medium concentrations of CLB (Fig. 1Ci). Conversely, in the VGB exposure groups, there was a significant increase in SOD levels at the median and higher concentrations (Fig. 1Cii) compared to the control group. Specifically, the SOD level was about 2.9-fold higher in the medium dose of CLB, whereas, it was 1.6 and 1.4-fold higher in the medium and higher doses of VGB, respectively.

Effect of CLB and VGB on the catalase activity

Catalase is one of the crucial antioxidant enzymes that mitigates oxidative stress to a considerable extent by destroying cellular hydrogen peroxide to produce water molecules. In the CLB exposure group, catalase activity showed a significant increase (1.0, 1.8, and 2.0-fold) in both higher and medium doses. On the other hand, the VGB exposure to medium and higher doses showed significantly decreased (0.75, 0.6, and 0.6-fold) catalase activity as compared to the control (Fig. 1Di and ii).

Effect of CLB and VGB on the nitric oxide levels

In the state of inflammation, nitric oxide production by the vasculature increases considerably in conjunction with other ROS contributing to oxidative stress. In the CLB exposure group, there was a significant 2.34-fold increase as compared to the control at 0.25 μg/mL concentration (Fig. 1Ei). Conversely, when VGB was exposed to a concentration of 44 μg/mL, there was a reduction in the NO level by 0.5-fold as compared to the control group (Fig. 1Eii).

CLB and VGB induced DNA damage

Exposure to both CLB and VGB caused significant DNA damage in comparison with the control group. The results indicate a statistically significant enhancement in DNA migration from the nucleus, as measured by the percentage of tail DNA in a dose-dependent manner (Fig. 2a and c). This indicates that both CLB and VGB induce genotoxicity, as evidenced by the increased DNA migration in the Comet parameter. Specifically, in the CLB treated groups, there was about 5.8, 8.4, and 8.2-fold increase, while in the VGB treated groups, the increase was about 4.4 and 7.5-fold increase as compared to the control group (Fig. 2b and d). Overall, the results demonstrate a significant rise in percentage tail DNA when exposed to CLB and VGB, as compared to the control, suggesting potential genotoxic effects of these drugs.

Fig. 2.

Representation of DNA damage induced by CLB (a) and VGB (b) in comparison with control DNA at 40X magnification. DNA damage was measured by the in vivo comet assay in Drosophila larvae (72 ± 2 h), treated with different concentrations of CLB (b) and VGB (d). The data was statistically analysed by using one-way ANOVA and expressed as ^*P < 0.05, ^**P < 0.01, ^***P < 0.005.

Total protein estimation

The ROS can target and damage any biomolecule such as proteins, lipids, and DNA in the cell. The total protein concentration in CLB and VGB treated groups was measured by Folin-Ciacolteu’s method using BSA as a standard. At a concentration of 0.312 μg/mL of CLB, there was a significant increase in protein concentration as compared to the control group, with a 2.0-fold rise (Fig. 3a). On the other hand, among the VGB exposure groups, there was no significant difference in the protein concentration as compared to the control group (Fig. 3b).

Fig. 3.

The total protein estimation in Drosophila larvae (72 ± 2 h), treated with different concentrations of CLB (a) and VGB (b). The data were statistically analyzed by using one-way ANOVA and expressed as ^****P < 0.0001, ns- nonsignificant.

SDS-PAGE analysis of CLB and VGB treated Drosophila third instar larvae reveals upregulating the expression of certain proteins

The protein expression pattern in Drosophila third instar larvae in the presence of vehicle control and exposure to CLB and VGB was analysed by Tris-glycine SDS-PAGE. The results showed several protein bands in the molecular weight range of 11–242 kDa. The densitometric analysis supported the results of the SDS-PAGE analysis and revealed that certain proteins are over/under expressed upon exposure to CLB and VGB as compared to the control (Fig. 4b and d). Specifically, in the CLB treated group, the bands at 75, 69, 63, and 35 kDa were found to be overexpressed, while in the VGB treated group, bands at 75, 69, 63, and 25–35 kDa showed increased expression as compared to the control (Fig. 4a and c). Based on the densitometry analysis, the significantly overexpressed bands at 75 and 63 kDa upon CLB treatment and at 63 and 28 kDa upon VGB treatment were selected for further analysis. These selected protein bands were subjected to OHRLCMS analysis for further investigation.

Fig. 4.

Tris-glycine SDS-PAGE analysis of proteins from Drosophila larvae (72 ± 2 h) treated with different concentration of CLB (a-M = protein marker, lane 1: DMSO, lane 2: 0.156, lane 3: 0.25, and lane 4: 0.312 μg/mL CLB treated larval samples) and VGB (c-M = protein marker, lane 1: PBS, lane 2: 17.6, lane 3: 22, and lane 4: 44 μg/mL VGB treated larval samples) and its densitometry analysis (b and d). ^* = differentially upregulated proteins.

OHRLCMS analysis has identified secreted proteins

In the Thermo Proteome Discoverer 2.2 search against the UniProt-D. melanogaster database, the gel bands obtained after treatment with CLB and VGB were subsequently examined using OHRLCMS which showed the presence of different proteins. Specifically, the proteins identified were Acyl-CoA synthetase long-chain, isoform J, NADH–ubiquinone oxidoreductase 75 kDa subunit (ND75), V-type proton ATPase subunit E (Vha26), ADP/ATP carrier protein (sesB) with a molecular weight of 25–35 kDa, malic enzyme (Men), and DNA-binding protein modulo (mod) with molecular weight of 63 kDa. The sequence coverage of these proteins was determined to be 30, 12, 47, 29, 21, and 3%, respectively (Table 2 and Fig. 5). Based on the UniProt and Flybase databases, the responsible genes corresponding to these identified proteins are, ACSL, ND75, Vha26, sesB, Men and Mod^55,56. The genes that are associated with the identified proteins further provide insights into the molecular basis of the observed changes upon CLB and VGB treatment.

Table 2.

Protein identification using Thermo proteome discoverer 2.2. The search of corresponding gel bands from CLB and VGB treated D. Melanogaster.

Source of protein	Identified protein in OHRLSMS	Observed Mass (kDa)	Uniprot accession no.	OHRLCMS mass (kDa)	Sequence Coverage (%)	Gene (UniproteKB)	Flybase ID
Drosophila melanogaster	Acyl-CoA synthetase long-chain, isoform J	75	A0A0B4KFE4	79.4	30	ACSL	FBgn0263120
	NADH–ubiquinone oxidoreductase 75 kDa subunit, mitochondrial	75	Q6NP42	78.6	12	ND75	FBgn0017566
	Malic enzyme	63	Q9NIW2	64	21	Men	FBgn0002719
	DNA-binding protein modulo	63	P13469	60.3	3	mod	FBgn0002780
	V-type proton ATPase Subunit E	25–35	P54611	26.1	47	Vha26	FBgn0283535
	ADP, ATP carrier protein	25–35	Q26365	34.2	29	sesB	FBgn0003360

Fig. 5.

OHRLCMS chromatogram of 75 kDa (a), 63 kDa (b & c), and 25–35 kDa (d) protein bands from Drosophila larvae (72 ± 2 h), treated with different concentrations of CLB (a and b) and VGB (c and d).

CLB and VGB exposure upregulate the expression of targeted genes

Based on the SDS-PAGE and LCMS data, we identified specific proteins related to GABA receptors, JNK pathway, wing senseless pathways, synaptic vesicles, and neurotransmitter transporters. The genes associated with these proteins are ACSL, ND75, Men, mod, Vha26, and sesB. To further investigate the gene expression, we selected the higher dose for the exposure studies. As shown in Fig. 6a, the gene expression analysis revealed the remarkable upregulation of ND75, Men, Vha26, and sesB in the CLB exposure group at 0.312 μg/mL, as compared to the control. The mRNA expression for ND75, Men, Vha26, and sesB genes increased by about 4.6, 6.6, 4.8, and 5.5-fold, respectively.

Fig. 6.

Gene expression profile of CLB (a) and VGB (b and c) as analyzed by RT-PCR, the mRNA was normalized to that of reference gene (RPL32). The data was statistically analysed by using one-way ANOVA and expressed as ^*P < 0.05, ^**P < 0.01, ^***P < 0.005 and ns-nonsignificant.

Similarly, VGB treatment at 44 μg/mL concentration showed upregulation of ACSL, Men, Vha26, and sesB genes. The mRNA expression of ACSL and sesB genes increased by 263 and 452-fold, respectively, upon VGB exposure (Fig. 6c). However, the expression of Men and Vha26 genes increased by about 7.2 and 6.6-fold, respectively (Fig. 6b), which is relatively to a lesser extent as compared to the other two genes in the VGB exposure group. Interestingly, there was no significant difference in the gene expression profile of ND75, exhibiting a modest increase of about 2.5-fold. These findings provide insights into the potential impact of CLB and VGB exposure on the differential expression of genes associated with GABA receptors, JNK pathway, wing senseless pathways, synaptic vesicles, and neurotransmitter transporters, shedding light on their regulatory roles in the context of these compounds.

Discussion

As of now, the research efforts are limited to the assessment of genotoxic effects and the underlying mode of action of the two most commonly used third-generation AEDs, namely, CLB and VGB. The main concern lies in their potential to cause damage to a developing foetus when administered as preventive therapy for epilepsy. Keeping this in view, in this study, we aim to explore the possible mechanisms through which AEDs may induce genotoxicity. To accomplish this, we analysed gene expression, oxidative stress markers, DNA damage and protein profiles in Drosophila larvae. Based on the life cycle, the sub-chronic exposure period chosen was 72 ± 2 h, using different concentrations of CLB (0.156, 0.25 and 0.312 μg/mL) and VGB (17.6, 22 and 44 μg/mL), which are known to induce teratogenesis.²¹ At these concentrations, we conducted our research study to understand the effects of these AEDs. We investigated the genotoxic effects of these third-generation AEDs by delineating the genes associated with GABA neurotransmitters and its receptors as well as role of oxidative stress in inducing protein and DNA damage. Overall, we tried to shed light on the potential risks associated with their use during foetal development. The results obtained here could be crucial in guiding safer therapeutic strategies for pregnant women with or without epilepsy.

Chronic exposure to AEDs can increase oxidative stress in epileptic patients, leading to various health risks such as infertility, cancer, and neurodegenerative diseases.^57–59 ROS is known to cause damage to cellular components, resulting in cell dysfunction and death.^60–62 The imbalance between antioxidants and ROS can lead to the accumulation of harmful free radicals, causing damage to DNA, proteins, and lipids.⁶³ Oxidative stress is commonly associated with endoplasmic reticulum (ER) stress during pathological conditions.^64,65 In our study, we observed a reduction in ROS levels, possibly attributable to the effects of antioxidant enzymes, which may alleviate ER stress induced by ROS exposure to CLB and VGB.⁶⁶ This observation was supported by assessments of LPO and SOD activity, indicative of ER stress caused by ROS.

Lipids play important roles in cell signaling, proliferation, metabolism, signal transduction, apoptosis and gene expression regulation.^67,68 Omega-3 fatty acids are known to counteract oxidative stress by breaking down the oxidative stress biomarker malondialdehyde.⁶⁹ The increase in LPO levels observed in response to VGB exposure may be due to the increased cellular oxidative stress.⁴¹ However, CLB exposure appears to reduce LPO levels, possibly pointing to the exact opposite mode of action of these AEDs. Notably, such variations in LPO levels may cause genotoxic effects in humans.⁷⁰

SOD plays a crucial role in preventing cells from oxidative stress by detoxifying harmful H₂O₂ into harmless substances like water and oxygen. However, an excessive increase in SOD levels can have adverse effects on brain health, including conditions like epilepsy.⁷¹ The present study observed that exposure to CLB and VGB increased SOD levels, possibly through changes in enzyme signaling and ER stress. A similar mechanism was observed with the treatment of mitochondrial division inhibitor 1, which reduced ROS production and MDA levels by enhancing SOD activity and subsequently mitigating ER stress in hippocampal neuronal cultures.⁷² Interestingly, while overexpression of SOD can lead to neuroprotection, it can also have the opposite effect, exacerbating brain disorders such as epilepsy.¹² The delicate balance of SOD levels is crucial for maintaining cellular health and preventing detrimental effects on brain function.

The CAT enzyme functions by catalyzing the breakdown of H₂O₂ into free radicals.⁷³ The present study demonstrates that exposure to CLB enhances CAT activity, which may affect the cells’ ability to eliminate intracellularly generated H₂O₂. Increased levels of antioxidant enzymes can neutralize ROS,⁷⁴ but an overabundance of such enzymes may lead to ROS damage due to a deficiency in antioxidant defenses and repair mechanisms, ultimately resulting in neuronal death and gliosis.⁷⁵ On the other hand, VGB exposure reduces CAT activity, possibly due to enzyme depletion caused by cellular stress from ROS, leading to oxidative damage in the organisms. Overall, CAT plays a critical role in decomposing H2O2 and preventing the buildup of ROS. However, imbalances in CAT activity can have adverse consequences, either by excessive ROS scavenging or reduced enzyme levels, both of which can contribute to oxidative damage in cells.

NO plays a vital role in coordinating blood flow and tissue oxygenation, contributing to overall physiological balance.⁷⁶ Our study observed that exposure to CLB resulted in increased NO levels.⁷⁷ However, when NO reacts with excessive ROS and reactive nitrogen species (RNS), it can lead to the formation of peroxynitrite, which possesses a strong affinity for sulfhydryl groups and may cause oxidation of unsaturated lipids and DNA.⁷⁸ On the other hand, VGB exposure was associated with reduced levels of NO. These alterations in NO metabolism may contribute to epileptic illness.⁷⁹

Exposure to AEDs is known to elevate ROS and LPO, causing cellular DNA damage and it has been shown that ROS actively gets released during epilepsy (seizures) leading to cell death.^80,81 The comet assay, used in this study, revealed that both VGB and CLB induced strand breaks and increased the tail moment in a dose-dependent manner, indicating genotoxic effects.⁸² Specifically, CLB and VGB treatment significantly increased the percentage of tail DNA. These results align with the previous studies, which found a significant increase in percentage of tail DNA after VGB exposure in blood, central nervous system, and hippocampus of Wistar rats.³⁶ Sub-chronic doses of Oxcarbazepine and Levetiracetam have also been shown to cause genotoxicity in mice and their fetuses, leading to increased DNA damage.^82,83 DNA damage caused by AEDs can have long term effects on various cellular components, including cellular proteins, cytokines, growth factors, synaptic proteins, neurotransmitters (GABA and glycine), ultimately impairing the neural function.^84,85

Measurement of total protein production is a critical method for assessing oxidative stress biomarkers, as ROS can cause damage to proteins, resulting in structural alterations, increased susceptibility to proteolysis, and impacting the function of receptors, enzymes, and transport proteins.^86–88 During larval development until adulthood, a significant concentration of protein is deposited in the fat body, which plays a crucial role in neurohormonal modifications in enzymes.^89–91 Exposure to CLB and VGB may induce protein alterations through ROS-induced protein oxidation, where a mixture of hydroxyl or superoxide radicals is formed,⁵⁸ resulting in changes to protein structure and function. Here, in our study, CLB and VGB have shown contrasting results which might be due to the opposite mechanisms of action of CLB, which acts as agonist of GABA as compared to VGB, which acts as an antagonist.⁹²

To gain a deeper understanding of the underlying molecular changes associated with the variations in developmental patterns, behavioral changes, and alterations in oxidative and antioxidative molecules, we employed a proteomic approach using OHRLCMS analysis on Drosophila larvae. The analysis was conducted using SDS-PAGE. From the gel, we selected overexpressed protein bands for further analysis using mass spectrometry. The increased expression of these proteins may be indicative of cellular damage and stress.⁹³ In the LCMS data, we have identified 88 proteins in the 75 kDa band and 38 proteins in the 63 kDa band for CLB-treated samples. In VGB-treated samples, 26 proteins were identified in the 63 kDa band, and 23 proteins in the 23 kDa band. Among the identified proteins, we focused on six specific proteins for further investigation, based on their functions and protein coverage in the bands. These selected proteins are Acyl-CoA synthetase long-chain, isoform J, NADH–ubiquinone oxidoreductase 75 kDa subunit, mitochondrial (75 kDa), V-type proton ATPase Subunit E, ADP/ATP carrier protein (25–35 kDa), Malic enzyme and DNA-binding protein modulo (63 kDa). These proteins were chosen for their potential involvement in larvae and further analysis of their functions may provide valuable insights into the mechanisms underlying the effects of CLB and VGB exposure.

To further confirm the results obtained from SDS-PAGE and LCMS, we conducted RT-PCR. Through RT-PCR analysis, we observed that the expression levels of ACSL, ND75, Men, mod, Vha26, and sesB in Drosophila were all significantly higher compared to the control group, consistent with the overexpression of these genes at the protein level.^94,95 The increased gene expression indicates that CLB and VGB have effects on Drosophila, potentially leading to teratogenesis and genotoxicity. Similar correlations have been reported in humans also as in the case of Clobazam prescription to a 10-year-old child, whose parents carried a polymorphic recessive mutation of the CYP2C19 gene and experienced metabolic alterations.^96,97 The combined results from the proteomic analysis and RT-PCR provide strong evidence of the impact of CLB and VGB on Drosophila at the genetic levels, with potential implications for understanding the effects of these drugs on teratogenic and genotoxicity. Additionally, the parallel findings in humans with specific genetic variations underscore the importance of personalized medicine approaches in antiepileptic drug prescriptions.

Further, this study focuses on investigating the relationship between differential expressions in response to AEDs, to understand the underlying mechanisms and pathways that lead to side effects. In Drosophila, Vha26 gene encodes for V-type proton ATPase subunit E and is orthologous to human genes like ATP6V1E1 and ATP6V1E2. Vha26 gene encodes a multisubunit enzyme responsible for ATP hydrolysis, rotational movement, proton translocation, and integral membrane functions (UniProt, P54611).⁹⁸ The V-type proton ATPase subunit E plays a crucial role in synaptic vesicle acidification and synaptic transmission to the neuromuscular junction.⁹⁹ It is also involved in several pathways, including nitric oxide, cyclic GMP signaling,¹⁰⁰ notch signaling¹⁰¹ and wnt signaling.¹⁰² In our study found that overexpression of the Vha26 gene when exposed to VGB and CLB, influenced these pathways, leading to abnormal wing development,¹⁰² altered behavior, cell apoptosis, and disruptions in developmental patterns in organisms, as indicated by previous research.⁵⁵ Moreover, gene overexpression can lead to misfolding and mutations,¹⁰³ potentially resulting in various diseases in humans, such as osteopetrosis, renal tubular acidosis, and neurodegenerative diseases.¹⁰⁴ Importantly, previous reports have shown that de novo mutations in the ATP6V1 gene are linked to developmental encephalopathy and epilepsy.^98,105

The ADP, ATP carrier protein, also known as adenine nucleotide translocator, belongs to the mitochondrial carrier family and plays a crucial role in cellular energy metabolism.¹⁰⁶ In Drosophila, this protein is encoded by two genes called stress-sensitive B and ANT2. While the exact mode of action of the ANT gene remains unclear, the sesB gene was chosen for gene expression analysis.¹⁰⁷ The sesB gene is essential for the retrieval of neurotransmitters like GABA, glutamate, serotonin, dopamine, and noradrenaline, and it helps control their concentration in synaptic regions.¹⁰⁸ The protein encoded by the sesB gene is engaged in calcium-mediated cell signaling pathways, insulin secretion,¹⁰⁹ and the tricarboxylic acid (TCA) cycle.¹¹⁰ When the sesB gene is enhanced during exposure to VGB and CLB, it leads to abnormalities in locomotory behavior, neuroanatomy, brain development, reduced fertility rate, pupae malformation, and oxidative stress response, as shown in our previous studies.^21,55 These changes could be attributed to variations in neurotransmitters like GABA and peripheral receptors.¹¹¹ In Drosophila, the nebula mutant with a sesB mutation exhibits a phenotype homologous to Down syndrome, which may be caused by mitochondrial defects in AAC activity.¹⁰⁹

The Drosophila Men gene, also known as the malic enzyme, shares orthology with the human SRM (spermidine synthase) gene, which is responsible for spermidine biosynthesis. In Drosophila larvae and vertebrate liver, the NADP-malic enzyme plays a role in activity regulation based on dietary lipid and carbohydrate composition.¹¹² On the other hand, ME2, a mitochondrial enzyme encoded by the genome, is involved in synthesizing the neurotransmitter GABA in neurons. Additionally, the malic enzyme is a key player in the citric acid pathway, converting malate to pyruvate,¹¹³ and also its function is linked to the glycolytic, citric acid, and JNK pathways.¹¹⁴ Enhanced expression of the Men gene when exposed to CLB and VGB may lead to abnormal oxidative stress response, potentially mediated by the JNK pathway.¹¹⁵ This response could contribute to an extended larval period in the lifespan of Drosophila,¹¹⁶ providing evidence for our previous studies on the teratogenic effects of these drugs.²¹

The NADH–ubiquinone oxidoreductase 75 kDa subunit, encoded by the ND75 gene in mitochondria, shares orthology with the human NDUFS1 gene. This protein is crucial for cellular respiration and is involved in recognizing the N-terminal segment of the 75 kDa subunit.¹¹⁷ It also plays a vital role in mitigating the effects of ROS and is associated with mitochondrial complex I deficit, mitochondrial metabolism disorders, and mitochondrial disorders caused by dysfunction of the orthologous gene in humans.¹¹⁸ Enhanced expression of the ND75 gene due to exposure to CLB and VGB may lead to malformation in pupae, abnormalities in neuroanatomy, locomotory activity, and DNA damage.⁵⁵ These changes might be attributed to alterations in cyclic AMP activity and the protein kinase A pathway¹¹⁹ as well as variations in TCA cycle metabolites.¹²⁰ Furthermore, the NDUF1 gene triggers the mitochondrial pathway of apoptosis through a BIM-mediated BAK-dependent reaction, contributing to the production of ROS that can lead to DNA damage.¹²¹

The Acyl-CoA synthetase long-chain, isoform J, is encoded by the ACSL gene, which is orthologous to human ACSL3. This protein is involved in various essential processes, including axon guidance, biosynthesis of organophosphates, and positive regulation of triglyceride sequestration. It is localized in the peroxisome, endoplasmic reticulum, and axon. The orthologous genes play a critical role in regulating BMP signaling, which is necessary for synapse growth related to brain functions like learning and memory. Disruptions in synaptic growth may lead to synaptic defects and neurological disorders.¹²² Overexpression of the ACSL gene upon exposure to VGB can lead to infertility in women and in Drosophila malformation of pupae, and abnormalities in brain development.⁵⁵ This effect may be influenced by interactions with the growth-promoting pathway at the neuromuscular junction (NMJ) synapse and the BMP pathway.¹²³ Moreover, when the gene is overexpressed, it can lead to an increase in incomplete fatty acid oxidation and mitochondrial oxidative stress, resulting in elevated mitochondrial superoxide production.¹²⁴ Interestingly, the ACSL gene is the only gene known to cause nonsyndromic intellectual disability, specifically X-linked mental retardation.^125,126

The collective expression of these genes is involved in numerous pathways, including the nitric oxide and cyclic GMP pathway, notch signaling pathway, wnt signaling pathway, NMJ signaling pathway, BMP pathway, protein kinase A pathway, JNK pathway, glycolytic pathway, citric acid pathway, calcium-mediated cell signaling pathways, and growth-promoting pathway. Notably, the overexpression of these genes could lead to significant enhancement of these pathways in the Drosophila model. These pathway variations highlight the potential genotoxic and teratogenic effects of exposing Drosophila to CLB and VGB. The intricate interplay of these pathways ultimately converges in cell communication, suggesting that the dysregulation caused by drug exposure may have broad implications for cellular processes. Understanding how these pathways are affected can provide valuable insights into the molecular mechanisms underlying the observed effects in Drosophila, and may also have relevance in understanding the potential risks and consequences of CLB and VGB exposure in human health. Overall, these findings emphasize the importance of studying the interactions of these genes and pathways in Drosophila as a model system to gain deeper insights into the effects of AEDs on cellular processes and the potential impact on neurological development and health.

Conclusion

The present study focused on the potential of two commonly used AEDs, CLB and VGB to cause genetic abnormalities. The results revealed that these drugs have caused upregulated gene expression, alterations in antioxidant and oxidative enzymes, and DNA damage, which could potentially contribute to the development of various neuropsychiatric disorders in Drosophila. Our study has identified overexpression of specific genes that may have affected various biochemical pathways (JNK pathway, NMJ signalling pathway, BMP pathway, protein kinase A pathway, growth-promoting pathway) and others that play critical roles in contributing to disorders. These changes involve proteins related to neurotransmitters such as GABA receptors, glutamate, serotonin, dopamine, and peripheral receptors that modulate synaptic function. From the present study, we can state that both CLB and VGB have the potential to induce teratogenicity and genotoxic effects in new-borns and adults who consume these drugs, potentially leading to mental retardation and other adverse effects in humans. This study sheds light on the mode of action underlying the observed effects and emphasizes the importance of careful consideration and monitoring when using these AEDs for long-term therapy.

Author contributions

Dr. Nagaraj K. conceptualized the study, investigation, supervision of the study, review and editing of the manuscript. Ms. Shamapari R. was involved in conducting the experiments, methodology, Software, visualization, discussion of the results, and manuscript writing.

Funding

None declared.

 

Conflict of interest statement. No potential conflict of interest was reported by any of the authors.

Data availability

Data will be made available on request.