Skip to main content
Parasite logoLink to Parasite
. 2024 Nov 6;31:69. doi: 10.1051/parasite/2024069

Helminth diversity and seasonality of Angiostrongylus cantonensis in hedgehogs from Mallorca

Diversité des helminthes et saisonnalité d’Angiostrongylus cantonensis chez les hérissons de Majorque

Sofia Delgado-Serra 1, Jessica Sola 2, Miquel Puig Riera 2, Sebastià Jaume-Ramis 1, Ana Sanz-Aguilar 1,3, Claudia Paredes-Esquivel 1,4,*
PMCID: PMC11540299  PMID: 39504471

Abstract

Sentinel surveillance plays a critical role in monitoring pathogen circulation, assessing potential threats for species conservation, and evaluating the risk of spillover to human populations. This study provides a comprehensive exploration of helminth parasites in the Mediterranean-distributed hedgehog species Atelerix algirus in Mallorca, Balearic Islands. Using an integrated approach that combines necropsies and morphological and molecular identifications using the COI gene, we identified 11 helminth taxa in 135 hedgehogs, representing half of those that died at the local wildlife hospital in Mallorca between 2019 and 2022. We report an overall A. cantonensis prevalence of 11.5% and confirm the first case of a subclinical neuroangiostrongyliasis infection in a wildlife host. Infection prevalences over the year revealed that only two species, the nematode A. cantonensis and the cestode Mathevotaenia sp., had a seasonal pattern, with most A. cantonensis cases occurring in autumn and, to a lesser extent, Mathevotaenia sp. cases in winter. This pattern is probably due to the higher abundance and greater activity of snails and slugs (intermediate hosts) during these seasons, with important implications for public health and strategies for prevention of neuroangiostrongyliasis. Other key findings include a high prevalence (88.1%) of the lungworm Crenosoma striatum and detection of the acanthocephalan Moniliformis saudi for the first time in A. algirus. We anticipate that our study will facilitate surveillance efforts and clarify species identities in future studies. Given the lethal effects of A. cantonensis infection in hedgehogs, further studies are needed to evaluate the threat this parasite represents to European wildlife.

Keywords: Angiostrongylus cantonensis, Nematoda, Acanthocephala, Seasonality, Wildlife, Cestoda

Introduction

One of the main challenges we will confront in the 21st century is the increase in infectious diseases that affect both humans and wildlife [62]. Zoonotic diseases account for 60% of the known emerging human infections, 72% of which originate in wildlife [44]. In recent years, there has been a significant surge in interest regarding wildlife parasites because of their role in the epidemiology of emerging infectious diseases [86]. Furthermore, there is a growing number of reports on wildlife parasites infecting domestic animals, thereby increasing the risk of spillover and spread to human populations [66]. In this regard, the use of wildlife as sentinels has emerged as a promising and effective strategy for monitoring pathogen circulation in nature; however, this type of surveillance is still underused in most regions [37].

Among parasites, helminths are more likely to be associated with zoonotic diseases than other groups, with approximately 95% of human helminth infections having zoonotic origins [85]. While most research on helminths has focused on this aspect, metazoan parasites also play a crucial role in ecosystems as they can negatively impact host fitness by affecting reproduction and ultimately survival [1, 68]. Therefore, we still need to understand the fitness effects of helminths in various wild animals [71]. Additionally, our knowledge of most wildlife parasites remains limited, and many lack molecular characterisation [33], which can hinder surveillance efforts.

Hedgehog populations are declining in Europe. This is particularly evident in Erinaceus europaeus, populations of which are in decline with reductions documented in the Netherlands [41], Sweden [48] and the United Kingdom [89]. Similarly, Atelerix algirus, the North African hedgehog, has also been reported to be in decline in mainland Spain [32]. The primary threats identified for both species include accidental road kills, habitat destruction and their capture to be kept as pets [6]. Despite the North African hedgehog being classified as a Least Concern species by the International Union for Conservation of Nature (IUCN), the available information is considered insufficient to properly assess population tendencies, and close monitoring is recommended [6]. On the island of Mallorca in the Balearic Islands (western Mediterranean), these mammals are one of the most common rescued vertebrate species in the island’s wildlife rehabilitation hospital, a situation that appears to be common throughout the continent regarding E. europaeus [36, 59]. Atelerix algirus is distributed throughout North Africa, the Spanish Mediterranean coast and the Canary Islands [6]. In the Balearic Islands, it occurs below 600 m elevation, in the garrigue near the sea and in farmlands, gardens and parks [2]. Hedgehog offspring are born between June and October, with litters ranging in number from one to three hoglets. This nocturnal mammal occasionally hibernates between January and March. In warm winters, hibernation episodes are short, lasting only a few days or even less [2].

Hedgehogs can harbour zoonotic pathogens, including helminths, bacteria, viruses, protozoa and fungi [45]. In the case of helminths, various species of trematodes, nematodes, cestodes and acanthocephalans have been detected in these mammals and some of them are noteworthy because of their zoonotic potential [72]. The hedgehog’s diet includes insects, earthworms, mealworms, slugs, snails and small vertebrate eggs [39]. Invertebrates can serve as intermediate hosts for many parasites with indirect life cycles [33]. Because of their wide distribution, relative abundance, generalist diet and their sensitivity to habitat changes, pathogens and pollutants, hedgehogs can be good bioindicators of ecosystem health [40]. In this sense, they can serve as sentinel species to monitor the occurrence of helminth parasites in natural ecosystems, with implications for both wildlife and human health [22].

In Mallorca, A. algirus has proven to be an effective sentinel species for monitoring zoonotic parasites such as Angiostrongylus cantonensis, commonly known as the rat lungworm [22, 42]. Its suitability as a sentinel species stems from its ubiquity and high abundance on the island, coupled with its susceptibility to this brain-infecting nematode, which can cause lethal infections in this species [22, 42]. Given the unknown long-term impact of this zoonotic parasite on hedgehog conservation and the limited information available about its helminth fauna, our aim was to determine the prevalence and seasonality of A. cantonensis in A. algirus. Additionally, we sought to evaluate its role as a sentinel species for other helminths. Using an integrated approach that combined both morphological and molecular techniques, we have comprehensively characterised the helminth parasites found in North African hedgehogs from the Mediterranean island of Mallorca. Our research not only provides novel insights into the molecular identity, prevalence and seasonality of helminths parasitizing hedgehogs, but also underscores the potential risks to human health associated with the presence and circulation of this potentially zoonotic species.

Materials and methods

Ethics statement

The research protocols for specimen collection and manipulation in this study were approved in advance by the biosafety committee of the University of the Balearic Islands CBS-AB 07/2020 and the Conselleria de Medi Ambient I territory reference TRA 04/2023. This study adhered to the regulations of the Balearic government.

Study site and parasite collection

This study was conducted in Mallorca (2°39′03″ E, 39°34′14″ N), the largest island of the Balearic archipelago, in the western Mediterranean Sea. The island’s climate is typically Mediterranean, characterised by mild and stormy winters, dry hot summers and an annual rainfall of 450 mm per year.

Between 2013 and 2022, 273 North African hedgehogs died and were brought to the local Wildlife Rehabilitation Centre the Consorci per a la Recuperació de la Fauna de les Illes Balears, herein referred to as the COFIB wildlife hospital. An authorisation to examine the carcasses for scientific purposes was obtained (CBS-AB 07/2020). We conducted examinations on 135 randomly selected carcasses. In cases involving traumatic injuries or decomposition, certain organs could not be subjected to necropsy because of their condition and prevalence rates were calculated based on the total number of organs examined. Specimen collection was constrained by the available resources and limitations of the COFIB staff. During the summer, the primary focus of the centre is directed towards birds and reptiles included in the Balearic catalogue of threatened species, which arrive in large numbers. Therefore, collection of hedgehog specimens was restricted to the autumn, winter and spring months.

Necropsies were conducted in a Biosafety Level 2 facility, following the guidelines of the University of the Balearic Islands. The dissection of each organ was performed under a magnifying glass (5×). In total, we examined the following organs: brains (96), nasal sinuses (89), lungs (109), oesophagi (74), stomachs (73), intestines and peritonea (87), kidneys (19), livers (20), gallbladders (22) and hearts (86). Brain parasites were collected using the tissue digestion technique of Arango-Colonna et al. [8]. Helminth parasites collected were preserved in 70% ethanol at −18 °C.

Morphological identifications

Nematodes and acanthocephalans were clarified using lactophenol (25% phenol, 25% lactic acid, 25% glycerine, 25% distilled water) until the internal structures were visible. Acanthocephalans and cestodes were fixed with Bouin’s fixative for 48 hours and stained for 24 hours with Langeron’s chlorhydric carmine [15]. The stained parasites were mounted on glass slides using DPX before being observed under the microscope. Identification of the parasites relied on the keys and morphological descriptions of Dougherty [26], Vieira et al. [88] and Stunžėnas and Binkienė [83] for Crenosoma species; Butterworth and Beverley-Burton [14], Hoa [38] and Moravec et al. [60, 61] for Capillariidae; Amin et al. [3] for Plagiorhynchus spp.; Amin et al. [4] and Van Cleave [18] for Moniliformis spp.; Stefanski [82] and Giannetto and Trotti [35] for Spirura rytipleurites seurati; Ortlepp [65] for Physaloptera spp.; Quentin and Seguignes [70] for Gongylonema spp.; Kinsella [47] for Angiostrongylus cantonensis; and Gállego Franco [31] for Brachylaima spp.

DNA isolation and PCR amplification

Total DNA was extracted using an NZY Tissue gDNA Isolation kit (NZYtech, Lisbon, Portugal), and DNA concentration was determined using a spectrophotometer (ND-2000 NanoDrop, Thermo Fisher Scientific, Waltham, MA, USA). PCR amplifications were carried out on samples with a DNA concentration of > 10 ng/μL using the Veriti system (Applied Biosystems, Foster City, CA, USA). Folmer et al.’s primers [28] were employed to amplify a fragment of the cytochrome c oxidase subunit 1 (COI) gene region, which is commonly used for DNA barcoding (molecular identification). A second set of primers was used for specimens that could not be amplified with the first set. Different sets of primers were tested to amplify the parasites, if one set failed, the next set was attempted in the following order: LCO1490/HCO2198, JB4.5/JB3, LCO1490/JB4.5, JB3/ CO1-R trema. The primers used for COI PCR amplification are listed in Table 1.

Table 1.

Parasites, GenBank accession numbers of sequences and primer sets used for PCR amplification of the COI gene region.

Species Accession number Primers Primers reference
Moniliformis saudi OQ078755 LCO1490 (5′–GGTCAACAAATCATAAAGATATTGG–3’) [28]
Crenosoma striatum OQ078756a HCO2198 (5’–TAAACTTCAGGGTGACCAAAAAATCA–3’)
Gongylonema sp. OQ078757–OQ078758
Mathevotaenia sp. OQ078759 JB4.5 (5’–TAAAGAAAGAACATAATGAAAATG–3’) [11]
Eucoleus sp. OQ078760 JB3 (5’–TTTTTTGGGCATCCTGAGGTTTAT–3’)
Aonchotheca erinacei OQ078761
Physaloptera immerpani OQ078762
Spirura rytipleurites seurati OQ078763–OQ078764
Plagiorhynchus cylindraceus OQ078765 LCO1490 (5’–GGTCAACAAATCATAAAGATATTGG–3’) [11, 28]
JB4.5 (5’–TAAAGAAAGAACATAATGAAAATG–3’)
Brachylaima sp. OQ078766 JB3 (5’–TTTTTTGGGCATCCTGAGGTTTAT–3’) [11, 58]
CO1-R trema (5’–CAACAAATCATGATGCAAAAGG–3’)

We were unable to use the same nematode specimens for both morphological and molecular analyses because the latter cannot be conducted on specimens previously treated with lactophenol. This limitation represents a significant constraint for our study. The use of lactophenol, while essential for preserving and observing morphological features, renders the DNA unsuitable for subsequent molecular analysis.

The PCR reaction volume was 50 μL, consisting of 2 μL template DNA and 48 μL of PCR mix: 2 μL of each primer 10 μM, 25 μL of Taq master mix (Supreme NZYTaq II 2× Green Master Mix), 2 μL MgCl2 50 mM, and 17 μL of MilliQ water. PCR conditions were as follows: 95 °C for 3 min; 35 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 1 min; and finally, 72 °C for 10 min. PCR products were visualised on a 2% agarose gel and subsequently purified using an NZYGelpure kit (NZYtech). The purified products were then sent to an external company (Sistemas Genómicos S.L., Valencia, Spain) for bi-directional sequencing.

Sequence analyses and molecular characterisation

Sequences were analysed and aligned using CodonCode v.9.0.1 (CodonCode Corporation, Dedham, MA, USA) and compared against the GenBank database (https://blast.ncbi.nlm.nih.gov/). DNA sequences obtained were deposited in GenBank under accession numbers OQ078755–OQ078766.

To identify helminths with challenging morphology, a pairwise distance matrix was constructed using the Kimura 2-parameter substitution model (K2P) in MEGA 6 software [84]. Representative COI sequences from species within each genus were obtained from GenBank. For each haplotype, one sequence was included in the K2P analysis. All available sequences of Capillariidae species for the same target region were retrieved for phylogenetic reconstruction. A maximum likelihood phylogenetic tree was constructed using MEGA 6 (bootstrap test: 500 replicates).

Seasonality in parasite prevalence

We used Generalised Linear Models (GLMs; link function: logit; error distribution: binomial) to evaluate the impact of seasonality on the prevalence of each parasite species, based on the dates hedgehogs were presented to the COFIB hospital. We compared models that included and excluded seasonal effects in autumn (October–December), winter (January–March) and spring (April–June), on parasite prevalence among the hedgehogs that were necropsied at the COFIB wildlife hospital. We assessed the alternative models for each parasite prevalence using likelihood ratio tests (LRT). A p-value < 0.05 was considered statistically significant. These analyses were conducted in RStudio 4.1.2 [73].

Results

Records from the COFIB wildlife hospital for the period 2019–2022 indicate that A. algirus comprised 7–9% of the hospitalised animals. Among these hedgehogs, 42–46% were successfully reintroduced to their natural habitat after rehabilitation, while 20–25% died during hospitalisation and 15–20% were euthanised for humane reasons. Through a comprehensive morphological examination and complementary molecular characterisation, we identified eleven helminth taxa infecting 135 necropsied hedgehogs (File S1). Results are summarised in Table 2.

Table 2.

Summary of the results obtained in this study and literature review of studies published on helminth parasites associated with Atelerix algirus. Some studies were focussed on specific groups of parasites only.

Reference, hedgehog location and number of animals analysed per study.
This study
García-Salguero et al. 2019 [33]
Delgado-Serra et al. 2016 [21]
Paredes-Esquivel et al. 2019 [67]
Esteban et al. 1987 [27]
Esteban et al. 1987 [27]
Mas-Coma et al. 1993 [57]
Mas-Coma et al. 2000 [55]
Dollfus 1954 [25]
Khaldi et al. 2012 [46]
Torres-Martínez 1988 [87]
Mas-Coma 1979 [54]
Mas-Coma & Feliu 1977 [56]
Sánchez Vicente 2013 [76]
Fuentes et al. 2000 [29]
Mallorca islands
Mallorca islands
Mallorca islands
Mallorca islands
Formentera islands
Mallorca, Menorca & Ibiza islands
Cabrera island
Ibiza island
Western Morocco
Algeria
Catalunya (Spain)
Catalunya (Spain)
Catalunya (Spain)
Canary Islands
Valencian Region (Spain)
Helminth species n = 277 n = 7 n = 2 n = 44 n = 20 n = 1 n = 8 n = ? n = 25 n = 2 n = 3 n = ? n = 7 n = 3
Acanthocephala
 Acanthocephala sp. larvae 20.0%
 Moniliformis 14.28% 43.18% x x x 32.0%
 Moniliformis saudi 21.84%
 Plagiorhynchus cylindraceus 13.79% 2.53%
Cestoda
 Cestoda sp. 28.57% 4.0%
 Mathevotaenia sp. 10.34%
 Mathevotaenia aethechini x
 Mathevotaenia erinacei 8.0% 42.8%
Nematoda
 Angiostrongylus cantonensis 11.46% x
 Aonchotheca sp. 42.85%
 Aonchotheca erinacei 27.59% 36.36% x 4.0%
 Capillariidae 28.57%
 Capillaria annulosa x
 Crenosoma striatum 88.07% 85.71% x 4.0% 14.3% 66.67%
 Eucoleus sp. 7.34%
 Eucoleus aerophilus 42.85%
 Gongylonema sp. 20.31%
 Gongylonema sp. 13.63% x 36.0% 33.33%
 Physaloptera dispar = P. clausa 93.18% x x x 64.0%
 Physaloptera immerpani 5.48%
 Physaloptera sp. larvae 36.0%
 Pterygodermatites plagiostoma x 4.0% 14.3% 33.33%
 Spirura rytipleurites seurati 5.4% 24.0% 42.8%
 Trichuridae gen. sp. 50.0%
Trematoda
 Brachylaima sp. 3.45% x 28.6%
 Dollfusinus frontalis 11.36% x
 Zonorchis sp. 2.27%
 Zonorchis guevarai x

x presence of the parasite but prevalence not quantified.

Nematodes

The morphological and molecular analyses confirmed the identity of two metastrongylid species previously reported from North African hedgehogs in Mallorca: Angiostrongylus cantonensis and Crenosoma striatum found in the brain and lungs, respectively (Figs. 1a, 1b). These parasites were easily identified based on the available morphological descriptions [26, 47, 83, 88], while their sequence identity was confirmed by a 100% similarity to sequences already published in GenBank. Among the 11 hedgehogs infected with A. cantonensis, ten exhibited the typical neurological manifestations characterised by Delgado-Serra et al. [22]. One individual was asymptomatic for neurological signs. The lungworm C. striatum was the most prevalent among all helminth taxa (96/109 hedgehogs).

Figure 1.

Figure 1

Nematodes from Atelerix algirus from Mallorca. Photos a and b) Typical morphology of the copulatory bursa, rays, and spicules of Angiostrongylus cantonensis and Crenosoma striatum, respectively. c) Posterior end of a Physaloptera immerpani male showing wide caudal alae and papillae. d) Posterior end of a Spirura rytipleurites seurati male specimen showing spicules, caudal alae and typical disposition of caudal papillae. e) Posterior end of an Aonchotheca erinacei male showing the alae and the two pairs of caudal ventrally pointed papillae. f and g) Eucoleus sp. male posterior end showing spicules, and female vulvar region, respectively. h and i) Posterior end of a Gongylonema sp. male showing the typical disposition of papillae, and long spicule, respectively. Scale bar: 50 μm. Arrows point to the papillae. S, spicule; SS, spicular sheath; V, vulva; E, egg.

Using morphological keys, three other species of nematodes were identified to the species level: Physaloptera immerpani, Spirura rytipleurites seurati and Aonchotheca erinacei (Figs. 1c–1e). The sequences submitted to GenBank constitute the first COI records for these species and are the only available DNA data for the first two.

The stomach-dwelling species P. immerpani, found in 4/73 of the hedgehogs, displayed morphological similarities to Physaloptera dispar, the typical Physaloptera species reported in hedgehogs [46]. Our specimens showed “lips with a pair of cephalic papillae and massive external tooth”. Males showed “wide caudal alae covered by crests aligned longitudinally” as described by Ortlepp [65]. The distinguishing feature between P. immerpani and P. dispar is the third pair of post-cloacal papillae, which is sessile in the former (Fig. 1c) and pedunculate in the latter. Spirura rytipleurites seurati was collected from the hedgehogs’ oesophagi (3/74, 4.05%) and stomachs (1/73, 1.37%). This nematode was identified based on the typical disposition and number of the pre (4 pairs) and post (2 pairs) anal papillae (Fig. 1d) as described by Stefanski [82] and Giannetto et al. [35]. Finally, Aonchotheca erinacei (Fig. 1e) was found in 24/87 (27.6%) hedgehog intestines. This species was identified by the typical caudal wings and ventrally curved papillae, as well as the long spicule with a sheath showing transverse rings in males. The cuticular expansion of the female vulvar region also fit previous species descriptions by Hoa [38].

Lungworms of the genus Eucoleus (prevalence 8/109 lungs, 7.34%) were identified only to genus level because of the limited number of male specimens and their state of preservation. Nevertheless, the available male specimens show a rudimentary pseudobursa, lacking caudal lateral alae, with a spicular sheath that is long and densely covered by spines (Fig. 1f). Female specimens displayed a non-protuberant vulva (Fig. 1g). These characters correspond to those described for the genus Eucoleus [80]. Furthermore, the closely related Eucoleus and Capillaria genera were also differentiated based on their specific location within the hosts, with the former being found in the respiratory tract, mouth and stomachs and latter only found in the intestines [61, 80].

Eucoleus aerophilus and Eucoleus boehmi sequences used for molecular identification were obtained from [16]. These showed only 87–88% similarity to our specimens. The resulting phylogenetic tree confirmed these results, with our specimens not placed in a monophyletic clade with other Eucoleus species. However, the bootstrap values in some of the nodes were not statistically significant, permitting no further conclusions (File S2).

Similarly, Gongylonema specimens collected from 13/74 (17.57%) of the hedgehogs’ oesophagi and 2/73 (2.74%) of stomachs could only be identified at the genus level. Morphologically, our specimens appeared to belong to G. pulchrum as described by Quentin and Seguignes in 1979 [70]. They show the typical tail with two caudal wings, two very unequal spicules, with a very long left spicule and a short and robust right spicule and 6 and 4 pairs of pre-anal and post-anal papillae, respectively (Figs. 1h, 1i). However, the sequence-based identification analysis showed that they are genetically distant (K2P distance > 16) from G. pulchrum, as well as from G. aegypti, G. nepalensis and G. neoplasticum (Table 3); therefore, the species identity of the specimens remains unresolved.

Table 3.

Pairwise genetic distances (K2P) between Gongylonema species (COI sequences) available in GenBank and those obtained in this study. Sequences retrieved from GenBank are indicated with the accession numbers.

Species 1 2 3 4 5 6
1. Gongylonema sp. Haplotype 1 OQ078757 (this study) –
2. Gongylonema sp. haplotype 2 OQ078758 (this study) 0.91 –
3. G. aegypti LC026046 21.77 21.45 –
4. G. neoplasticum LC334451 21.86 21.86 9.51 –
5. G. pulchrum AP017685 16.27 16.86 14.22 13.10 –
6. G. nepalensis LC278393 18.97 19.28 14.51 13.69 10.30 –
7. Gongylonema sp. LC612845 17.42 18.02 16.72 15.29 12.91 12.90

Platyhelminthes (Trematoda and Cestoda)

We identified two platyhelminth parasites, the trematode Brachylaima sp. and the cestode Mathevotaenia sp., found in 3/87 and 9/87 of the small intestines, respectively. Specimens were identified to the genus level using the available morphological keys [31]. When comparing the resulting COI sequences, no similar DNA records were found in the GenBank database.

The cestode’s morphological features were consistent with those of Mathevotaenia [77]: an unarmed scolex bearing 4 oval suckers, craspedote proglottids with genital pores alternating irregularly and situated in the anterior half of the proglottid, 40–50 testes in the posterior part of the proglottid, body width 1 mm and length up to 130 mm (Figs. 2a, 2b). The cestode found in this study does not correspond to M. erinacei as the total length does not match the original description.

Figure 2.

Figure 2

Platyhelminths found in Atelerix algirus from Mallorca. a) Mathevotaenia sp. detail of the unarmed scolex with four oval suckers. b) Stained proglottids of Mathevotaenia sp. showing the distribution of the testes. c) Stained Brachylaima sp. Scale bar: 50 μm.

The morphology of the trematode was consistent with that of Brachylaima sp. [31]: body flattened and oval, with testes arranged in tandem at the posterior end of the body, and intertesticular ovary, somewhat sinuous ceca and an acetabulum close to the mid-body (Fig. 2c).

Thorny-headed worms (Acanthocephala)

Two acanthocephalan parasites were found infecting the small intestines of the hedgehogs: Moniliformis saudi and Plagiorhynchus cylindraceus, with the former being more prevalent than the latter (21.84% vs. 13.79%, respectively). Some adult M. saudi specimens were more than twice the size (261 mm) of those previously described by Amin et al. [4] (117.5 mm maximum length) (Fig. 3a). A single haplotype was found in the two specimens that were sequenced. The COI sequence analysis showed a 99.69% similarity with previously described M. saudi [4, 18] and 99.01% with Moniliformis cryptosaudi [5]. Genetic distances calculated with the Kimura-2-parameter (K2P) model showed that intrageneric distances varied from 0.83% with M. saudi to 33.4% with Moniliformis (Table 4), which is the only Moniliformis species previously reported in European hedgehogs. Plagiorhynchus cylindraceus specimens were found as cystacanths (Figs. 3b, 3c) and the single haplotype found was 99.83% similar to those previously reported in Mallorca [33].

Table 4.

Pairwise genetic distances (K2P) between all COI sequences from Moniliformis species available in GenBank and those obtained in this study. Sequences retrieved from GenBank are indicated with the accession number.

Species 1 2 3 4 5 6 7 8 9
1. M. saudi (OQ078755, this study) –
2. M. saudi KU206783 0.83 –
3. M. cryptosaudi MH401041 1.25 0.41 –
4. M. moniliformis MT512678 33.40 32.72 33.40 –
5. M. moniliformis AF416998 33.40 32.72 33.40 0.00 –
6. Moniliformis sp. OK415026 18.81 18.81 18.81 28.73 28.73 –
7. M. necromysi MT803593 31.43 31.43 32.10 36.07 36.07 32.10 –
8. M. ibunami MW115575 30.94 31.61 30.94 35.57 35.57 28.98 33.29 –
9. M. ibunami MW115576 30.94 31.61 30.94 35.57 35.57 28.98 33.29 0.00 –
10. M. kalahariensis MH401040 28.44 29.09 29.74 37.44 37.44 32.84 30.82 26.83 26.83

Figure 3.

Figure 3

Acanthocephalans found in Atelerix algirus from Mallorca. a) Abnormally large Moniliformis saudi. b and c) Proboscis and whole body of an immature Plagiorhynchus cylindraceus. Scale bar: 50 μm.

The lungs were the most affected organs, with 88.07% infected by lungworms. No parasites were found in the nasal sinuses, heart, kidney, liver or gallbladder.

Coinfections in the lungs with C. striatum and Eucoleus sp. were present in 8 of the 109 (7.34%) samples examined. Only one oesophagus was infected with two parasite species: Gongylonema sp. and Spirura rytipleurites seurati. Ten of 87 (11.49%) intestines were coinfected, as follows: one by A. erinacei and Mathevotaenia sp., four by M. saudi and A. erinacei; one by M. saudi and P. cylindraceus; one by M. saudi, P. cylindraceus and A. erinacei; one by A. erinacei and P. cylindraceus; one by A. erinacei and Brachylaima sp. and one by Mathevotaenia, Brachylaima and A. erinacei.

The effect of seasonality on helminth prevalence

Table 5 summarises the results of the GLM analysis to identify for each parasite whether the constant or seasonal model was better. Angiostrongylus cantonensis and Mathevotaenia sp. exhibit a significant LRT p-value for seasonal prevalence, indicating that their prevalences fluctuate throughout the year depending on the season, being highest in autumn and winter, respectively (Fig. 4). For all other parasites, the constant model is better, indicating that no significant differences in prevalence were detected between the seasons.

Table 5.

GLM models testing the extent of seasonality in the prevalence of the different parasites studied. Notation: df – degrees of freedom, AIC – Akaike Information Criteria, Dev – Deviance, LTR p-value – Likelihood Ratio Tests p-value. The best model explaining the prevalence of each parasite is in bold.

Parasite Model df AIC Dev LRT p-value
Angiostrongylus cantonensis Constant 1 70.350 68.350
Seasonal 3 67.850 61.850 0.038
Aonchotheca erinacei Constant 1 104.487 102.490
Seasonal 3 107.892 101.890 0.743
Brachylaima sp. Constant 1 28.099 26.099
Seasonal 3 31.626 25.626 0.789
Crenosoma striatum Constant 1 81.670 79.670
Seasonal 3 82.267 76.267 0.182
Eucoleus sp. Constant 1 59.188 57.188
Seasonal 3 61.425 55.425 0.414
Gongylonema sp. Constant 1 82.363 80.363
Seasonal 3 84.313 78.313 0.359
Mathevotaenia sp. Constant 1 59.871 57.871
Seasonal 3 56.063 50.063 0.020 *
Moniliformis saudi + Constant 1 93.326 91.326
Seasonal 3 96.384 90.384 0.624
Physaloptera immerpani + Constant 1 34.450 32.450
Seasonal 3 36.990 30.990 0.481
Plagiorhynchus cylindraceus Constant 1 72.681 70.681
Seasonal 3 74.019 68.019 0.264
Spirura rytipleurites seurati Constant 1 34.450 32.450
Seasonal 3 36.990 30.990 0.481
*

Statistically significant effects of seasonality (LRT p-values < 0.05) are indicated with an asterisk.

+

First report in Atelerix algirus.

Figure 4.

Figure 4

Seasonal prevalence (and standard error, represented as SE) of A. cantonensis and Mathevotaenia sp. in hedgehogs subjected to necropsies (purple lines). The figure also shows the mean monthly temperature (red line) and rainfall (blue bars) in Mallorca during the period 1971–2000 (data from Agencia Estatal de Meteorología AEMET).

Discussion

Pathogen surveillance plays a crucial role not only in identifying potential threats to wildlife, but also in assessing the circulation of zoonotic agents that could potentially spill over to human populations. This study represents the most comprehensive survey of helminth parasites in the hedgehog species Atelerix algirus, which is widely distributed in the Mediterranean region. Our approach involved both morphological and molecular (COI) characterisation of 11 helminth taxa, in addition to shedding light on the seasonality of rat lungworm (A. cantonensis) prevalence in the region.

Angiostrongylus cantonensis serves as the main aetiological agent of eosinophilic meningitis in humans and other vertebrates, often leading to severe clinical manifestations, particularly motor impairments [51, 81]. In 2018, this zoonotic nematode was reported for the first time in Mallorca in hedgehogs [67] and has since continued to spread across the island [22]. In 2022, A. cantonensis was also detected in urban rats in continental Spain [30]. Despite its potential threat to wildlife and humans, there is a lack of systematic surveillance of this parasite. This study represents the first effort to understand the prevalence of this pathogen in a wildlife species. We recorded an overall prevalence of 11.46% in A. algirus hedgehogs from Mallorca. As previously stated, this prevalence is based on the 96 brains examined, as some were excluded due to damage.

It is challenging to establish A. cantonensis prevalence comparisons with previous studies on accidental hosts since they have focussed solely on fauna exhibiting signs of neurological disease. The only comparable study we are aware of was conducted on tawny frogmouths (Podargus strigoides) in Australia [53], which found that 80% of the birds with neurological disease were infected with A. cantonensis. Further investigations are urgently needed to understand the threat this nematode may pose to European wildlife. However, an equally significant discovery of our study was the identification of an asymptomatic case of angiostrongyliasis in an infected hedgehog. To the best of our knowledge, this constitutes the sole confirmed report of a subclinical A. cantonensis infection in non-human accidental hosts. In humans, asymptomatic neuroangiostrongyliasis cases have been reported previously [74].

The results of the GLM analysis reveal a distinct seasonal pattern for neuroangiostrongyliasis on Mallorca, with most cases occurring in autumn (October to December) and to a lesser extent during winter (January to March) (Fig. 4). These findings are consistent with a prior study conducted on dogs in Australia, where A. cantonensis also circulated primarily during the same seasons, i.e. periods of increased humidity and average daily temperatures of 17–25 °C [51]. Our results are also consistent with observations made in Europe regarding the seasonality of the congeneric species Angiostrongylus vasorum [63]. During autumn, Mallorca experiences mild temperatures and maximal rainfall levels, conditions that enhance the abundance and availability of gastropods, the intermediate hosts of Angiostrongylus parasites. This in turn increases the likelihood of hedgehogs consuming infected gastropods, potentially elevating their A. cantonensis infection prevalences (Fig. 4).

The development of A. cantonensis larvae within gastropods ceases when temperatures fall below 15 °C [52]. Also, when experimentally infected, the viability of A. cantonensis L3 larvae in slugs was reduced when exposed to winter temperatures [7]. These studies are consistent with the reduced prevalence observed during winter months (Fig. 4). The seasonal pattern of the disease may suggest that infected hedgehogs do not survive the winter. To comprehensively evaluate the detrimental impact of this pathogen on hedgehogs, long-term studies are imperative, especially considering reports of declining populations [32]. Additionally, future investigations should encompass data from the summer months and incorporate larger sample sizes to gain a deeper understanding of the seasonal incidence of this parasite.

This study also revealed a high prevalence (88.07%) of the lungworm Crenosoma striatum in Atelerix algirus. This gastropod-borne nematode has previously been reported in A. algirus populations across various regions, including the Balearic Islands, mainland Spain, the Canary Islands and Algeria (Table 2). It is also highly prevalent in the European hedgehog, E. europaeus [90]. However, the epidemiology of this disease in A. algirus had not been thoroughly investigated until now. Previous studies on this subject have typically involved only a few specimens (<10), apart from a study in Algeria (Table 2), which recorded a much lower prevalence (4%) despite Algeria being the native range of this lungworm [46]. Crenosoma striatum inhabits the trachea, bronchi and bronchioles, leading to airway occlusion and often causing cardiorespiratory problems and granulomatous pneumonia [9], as well as increasing the risk of anaphylaxis and hyperpnoea [10]. In other regions, there are reports of severe and fatal cases during autumn in E. europaeus [19]. While we did not find evidence of seasonality in this infection, further studies are necessary to understand the impact of climate on the disease.

Molecular characterisation plays a pivotal role in enhancing helminth species identification and providing comprehensive insights into the life cycles of these parasites (e.g. intermediate hosts) [33]. In this study, we have conducted molecular characterisations of three nematode species for the first time: Spirura rytipleurites seurati, Aonchotheca erinacei and Physaloptera immerpani. We anticipate that our study will enhance surveillance efforts and clarify species identities in future studies. Particularly noteworthy is Physaloptera immerpani, which has remained relatively obscure since its initial description in 1937 when it was found in the stomach of Atelerix frontalis in South Africa [65]. Given its morphological resemblance to Physaloptera dispar, we postulate that some of the stomach parasites previously reported in hedgehogs may have been erroneously misidentified as P. dispar (Table 2). Physaloptera species have previously been reported sporadically in humans; however, precise species-level identification has not always been feasible [79].

We identified some specimens morphologically as G. pulchrum [70]. However, the K2P pairwise analysis of the COI gene region revealed a substantial genetic distance (16.27%–16.86%) between our specimens and the recognised G. pulchrum (Table 3). This is higher than the intraspecific divergence reported for nematodes (up to 5%) [24]. Therefore, the identity of our Gongylonema specimens remains unresolved. The COI gene region has been often used to detect hidden diversity in other taxa [23]. In the case of parasites, the detection of cryptic species holds particular significance, as these variants may differ in terms of pathogenicity, host specificity and resistance to anthelmintic treatments [17]. Given the numerous documented cases of gongylonemiasis in humans [50], elucidating the species composition within the Gongylonema genus is a crucial step prior to identification of potentially zoonotic agents.

Two thorny-headed worms were found infecting A. algirus in Mallorca: Moniliformis saudi and Paraechinus cylindraceus. Notably, our identification of M. saudi marks the first report of this parasite in A. algirus. Despite the considerable size difference compared to those described in other regions, the morphology of our specimens closely matched the established description of this helminth [4]. Furthermore, the genetic distance between our specimens and M. saudi was 0.83% (K2P model), a value well within the range of intraspecific variation reported for acanthocephalans (1–5%) [34]. Moniliformis saudi had previously only been documented in Paraechinus aethiopicus in Saudi Arabia, while previous studies in Europe had reported Moniliformis moniliformis in E. europaeus [43] and Atelerix algirus from the Balearic Islands [21, 27, 55, 57]. These reports were based on morphological identifications, which can occasionally lead to errors in helminth identification [64]. Given the substantial morphological similarity between Moniliformis species, we postulate that many of these prior reports might, in fact, correspond to M. saudi. The accurate identification of this parasite species has important implications for public health as M. moniliformis is a known zoonotic agent [75], while such zoonotic status has not been demonstrated for M. saudi. Given the resemblance in the life cycles of these species, it is reasonable to suspect that M. saudi could also be zoonotic, although further investigations are necessary to confirm this.

Plagiorhynchus cylindraceus was detected in the peritoneum and intestines of the hedgehogs. This species is a bird parasite and has been reported in other hedgehog species: Erinaceus europaeus from Germany, the United Kingdom, New Zealand [78], the Czech Republic [69] and Erinaceus roumanicus from the Czech Republic [69]. Skuballa et al. [78] suggested that insectivores and other small mammals, such as hedgehogs, could serve as paratenic hosts, facilitating the transmission of this parasite to birds of prey. The pathogenicity of acanthocephalans can vary depending on factors such as parasite burden and the extent of host tissue penetration, often leading to secondary infections [78]. The observed ability of P. cylindraceus to penetrate the intestinal wall coupled with the increased prevalence noted in this study compared to previous surveys in the same area [33] suggests that this species may warrant further consideration as a potential emerging concern for A. algirus in Mallorca.

The only cestode reported infecting A. algirus in Spain (Canary Islands) is Mathevotaenia erinacei [76]. However, M. aethechini has also been reported infecting A. algirus in Morocco [77]. In this study, we could only classify our specimens at the genus level, as Mathevotaenia sp. This parasite exhibited a significantly high prevalence during the winter (Fig. 4). The reduced availability of food resources during winter, combined with the fact that in Mallorca hedgehogs enter a state of partial hibernation during this period, may predispose them to infection by this cestode. However, cestodes generally cause mild infections [20], which does not align with our findings that suggest a more acute and potentially lethal course of the disease. In humans, Mathevotaenia infections have been reported, but appear to be exceedingly rare [49]. Identification of the trematode Brachylaima sp. to the genus level was validated through both morphological and molecular techniques. Butcher and Grove [12] documented human infections caused by Brachylaima cribbi in Australia, a parasite known to induce chronic infections that can persist for up to 18 months; it is typically transmitted through the ingestion of raw or undercooked gastropods [13].

We anticipate that the molecular characterisation of helminth parasites of A. algirus in Mallorca will significantly contribute to their early detection in other regions of the world. Furthermore, it promises a more comprehensive understanding of the life cycles and distributions of these pathogens. Equally important is the understanding of the seasonal dynamics of these parasites, particularly in the case of the zoonotic nematode Angiostrongylus cantonensis. The autumn/winter seasonal pattern observed for the rat lungworm in Mallorca, provides valuable and novel information for public health authorities in the region. Understanding the dynamics of these pathogens is essential for developing effective prevention and control strategies. We expect this study will facilitate future surveillance efforts, ultimately leading to improved management and control of helminth infections in hedgehog populations, including those with zoonotic potential.

Acknowledgments

We thank all wildlife hospital staff at Consorci per a la Recuperació de la Fauna de les Illes Balears for providing invaluable support for the establishment of a One Health approach. ASA was supported by a Ramon y Cajal fellowship from the Spanish Ministry of Innovation and Universities, the Agencia Estatal de Investigación and the European Social Fund (RYC-2017-22796). Her work was conducted within the framework of the activities of the Spanish Government through the “Maria de Maeztu Centre of Excellence” accreditation to IMEDEA (CSIC-UIB) (CEX2021-001198).

Cite this article as: Delgado-Serra S, Sola J, Riera MP, Jaume-Ramis S, Sanz-Aguilar A & Paredes-Esquivel C. 2024. Helminth diversity and seasonality of Angiostrongylus cantonensis in hedgehogs from Mallorca. Parasite 31, 69. https://doi.org/10.1051/parasite/2024069.

Footnotes

Edited by: Jean-Lou Justine.

Conflicts of interest

The authors declare that there is no conflict of interest regarding publication of this paper.

Funding

This work was sponsored by the Comunitat Autonòma de les Illes Balears through the Direcció General de Recerca, Innovació I Transformació Digital with funds from the Tourist Stay Tax Law (PDR2020/61 – ITS2017-006).

Supplementary materials

The supplementary material of this article is available at https://www.parasite-journal.org/10.1051/parasite/2024069/olm.

parasite-31-69-s1.pdf (387.2KB, pdf)

File S1. Helminth prevalence in hedgehogs arriving at the wildlife recovery centre in Mallorca.

parasite-31-69-s2.pdf (506.3KB, pdf)

File S2. Maximum likelihood phylogenetic tree based on the cytochrome oxidase I gene region. This shows the location Eucoleus sp. found in this study in relation to Capillariidae nematodes sequences available in GenBank.

References

  • 1.Akinyi MY, Jansen D, Habig B, Gesquiere LR, Alberts SC, Archie EA. 2019. Costs and drivers of helminth parasite infection in wild female baboons. Journal of Animal Ecology, 88(7), 1029–1043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Alcover JA. 2007. Atelerix algirus (Lereboullet, 1842), in Atlas y Libro Rojo de Mamíferos Terrestres de España, Palomo LJ, Gisbert J, Blanco JC, Editors. Dirección General para la Biodiversidad-SECEM-SECEMU: Madrid. p. 83–85. [Google Scholar]
  • 3.Amin OM, Canaris AG, Kinsella JM. 1999. A taxonomic reconsideration of the genus Plagiorhynchus s. lat. (Acanthocephala: Plagiorhynchidae), with descriptions of South African Plagiorhynchus (Prosthorhynchus) cylindraceus from Shore Birds and P. (P.) malayensis, and a key to the species of the subgenus Prosthorhynchus. Journal of the Helminthological Society of Washington, 66:2123–132. [Google Scholar]
  • 4.Amin OM, Heckmann RA, Mohammed O, Evans RP. 2016. Morphological and molecular descriptions of Moniliformis saudi sp. n. (Acanthocephala: Moniliformidae) from the desert hedgehog, Paraechinus aethiopicus (Ehrenberg) in Saudi Arabia, with a key to species and notes on histopathology. Folia Parasitologica, 63 (14), 1–12. [DOI] [PubMed] [Google Scholar]
  • 5.Amin OM, Heckmann RA, Sharifdini M, Albayati NY. 2019.Moniliformis cryptosaudi n. sp. (Acanthocephala: Moniliformidae) from the long-eared hedgehog Hemiechinus auritus (Gmelin) (Erinaceidae) in Iraq; a case of incipient cryptic speciation related to M. saudi in Saudi Arabia. Acta Parasitologica, 64(1),195–204. [DOI] [PubMed] [Google Scholar]
  • 6.Amori G, Hutterer R, Krystufek B, Yigit N. 2022. Atelerix algirus (North African hedgehog). The IUCN Red List of Threatened Species 2022, https://www.iucnredlist.org/species/27926/22324424. [Google Scholar]
  • 7.Anettová L, Šipková A, Izquierdo-Rodriguez E, Velič V, Modrý D. 2023. Rat lungworm survives winter: experimental overwintering of Angiostrongylus cantonensis larvae in European slugs. Parasitology, 150(10), 950–955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Arango-Colonna M, Delgado-Serra S, Haines LR, Paredes-Esquivel C. 2023. Improving the detection of Angiostrongylus cantonensis in the brain tissues of mammalian hosts. Acta Tropica, 242, 106917. [DOI] [PubMed] [Google Scholar]
  • 9.Barus V, Blazek K. 1971. The life cycle and the pathogenicity of the nematode Crenosoma striatum . Folia Parasitologica, 18(3), 215–225. [Google Scholar]
  • 10.Bexton S, Couper D. 2019. Veterinary care of free‐living hedgehogs. In Practice, 41(9), 420–432. [Google Scholar]
  • 11.Bowles J, Hope M, Tiu WU, Liu X, McManus DP. 1993. Nuclear and mitochondrial genetic markers highly conserved between Chinese and Philippine Schistosoma japonicum . Acta Tropica, 55 (4), 217–229. [DOI] [PubMed] [Google Scholar]
  • 12.Butcher AR, Grove DI. 2001. Description of the life-cycle stages of Brachylaima cribbi n. sp. (Digenea: Brachylaimidae) derived from eggs recovered from human faeces in Australia. Systematic Parasitology, 49(3), 211–221. [DOI] [PubMed] [Google Scholar]
  • 13.Butcher AR, Talbot GA, Norton RE, Kirk MD, Cribb TH, Forsyth JRL, Knight B, Cameron AS. 1996. Locally acquired Brachylaima sp. (Digenea: Brachylaimidae) intestinal fluke infection in two South Australian infants. Medical Journal of Australia, 164(8), 475–478. [DOI] [PubMed] [Google Scholar]
  • 14.Butterworth EW, Beverley-Burton M. 1980. The taxonomy of Capillaria spp. (Nematoda: Trichuroidea) in carnivorous mammals from Ontario, Canada. Systematic Parasitology, 1(3), 211–236. [Google Scholar]
  • 15.Castro A, Guerrero OM. 2004. Técnicas de diagnóstico parasitológico. San José, Costa Rica: Editorial de la Universidad de Costa Rica. p.132. [Google Scholar]
  • 16.Cesare ADi, Castagna G, Otranto D, Meloni S, Milillo P, Latrofa MS, Paoletti B, Bartolini R, Traversa D. 2012Molecular detection of Capillaria aerophila, an agent of canine and feline pulmonary capillariosis. Journal of Clinical Microbiology, 50(6), 1958–1963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Cháves-González LE, Morales-Calvo F, Mora J, Solano-Barquero A, Verocai GG, Rojas A. 2022. What lies behind the curtain: cryptic diversity in helminth parasites of human and veterinary importance. Current Research in Parasitology & Vector-Borne Diseases, 2, 100094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.van Cleave HJ. 1923. A key to the genera of Acanthocephala. Transactions of the American Microscopical Society, 42(4), 184–191. [PubMed] [Google Scholar]
  • 19.Cousquer G. 2004. Analysis of tracheal sputum for diagnosing and monitoring verminous pneumonia in hedgehogs (Erinaceus europaeus). Veterinary Record, 154(11), 332–333. [DOI] [PubMed] [Google Scholar]
  • 20.Craig P, Ito A. 2007. Intestinal cestodes. Current Opinion in Infectious Diseases, 20(5), 524–532. [DOI] [PubMed] [Google Scholar]
  • 21.Delgado-Serra S. 2016. Los helmintos parásitos que afectan al “Erizo Moruno” Atelerix algirus vagans. Final Degree Project, University of the Balearic Islands. [Google Scholar]
  • 22.Delgado-Serra S, Sola J, Negre N, Paredes-Esquivel C. 2022. Angiostrongylus cantonensis nematode invasion pathway, Mallorca, Spain. Emerging Infectious Diseases, 28(6), 1163–1169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Delgado-Serra S, Viader M, Ruiz-Arrondo I, Miranda MÁ, Barceló C, Bueno-Marí R, Hernández-Triana LM, Miquel M, Lester K, Jurado-Rivera JA, Paredes-Esquivel C. 2021. Molecular characterization of mosquito diversity in the Balearic Islands. Journal of Medical Entomology, 58(2), 608–615. [DOI] [PubMed] [Google Scholar]
  • 24.Derycke S, Vanaverbeke J, Rigaux A, Backeljau T, Moens T. 2010. Exploring the use of cytochrome oxidase c subunit 1 (COI) for DNA Barcoding of free-living marine nematodes. PLoS One, 5(10), e13716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Dollfus RP. 1954. Quelques cestodes du groupe Oochoristica auctorum, récoltés au Maroc, avec une liste des cestodes des hérissons (Erinaceidae) et une liste des sauriens et ophidians (exclus. Amérique et Australie) où ont été trouvé des Oochoristica. Archives de l’Institut Pasteur du Maroc, 4, 657–711. [Google Scholar]
  • 26.Dougherty EC. 1945A review of the genus Crenosoma Molin, 1861 (Nematoda: Trichostrongylidae): its history, taxonomy, adult morphology, and distribution. Proceedings of the Helminthological Society of Washington, 12(2), 44–62. [Google Scholar]
  • 27.Esteban JG, Galán-Puchades MT, Bargues MD, Valero MA, Mas-Coma S. 1987. Sobre la helmintofauna del erizo moruno, Erinaceus (Aethechinus) algirus (Lereboullet, 1842) (Insectivore: Erinaceidae) en el Archipélago Balear (Islas Gimnésicas y Pitiusas), in Mamíferos y Helmintos. Volumen homenaje al Prof. Dr. Herman Kahmann en su 81 aniversario, Sans-Coma V, Mas-Coma S, Gosálbez J, Editors. Barcelona: Ketres Editora, S.A. pp. 163–166. [Google Scholar]
  • 28.Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3(5), 294–299. [PubMed] [Google Scholar]
  • 29.Fuentes MV, Cerezuela AM, Galán-Puchades MT. 2000. A helminthological survey of small mammals (insectivores and rodents) in the Serra Calderona mountains (Valencian Community, Spain). Research and Reviews in Parasitology, 60(1–2), 25–35. [Google Scholar]
  • 30.Galán-Puchades MT, Gómez-Samblás M, Osuna A, Sáez-Durán S, Bueno-Marí R, Fuentes MV. 2023. Update on the first finding of the rat lungworm, Angiostrongylus cantonensis, in Rattus spp. in continental Europe, Valencia, Spain, 2022. Pathogens, 12(4), 567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gállego Franco L. 2017. Parasitación de Cornu aspersum Müller, 1774 (Helicidae) por metacercarias del género Brachylaima sensu lato Dujardin, 1843 (Brachylaimidae): tratamiento antihelmíntico y consumo humano. PhD Thesis, University of Barcelona. [Google Scholar]
  • 32.García-Rodríguez S, Puig-Montserrat X. 2014. Algerian hedgehog (Atelerix algirus Lereboullet, 1842) habitat selection at the northern limit of its range. Galemys. Spanish Journal of Mammalogy, 26(1), 49–56. [Google Scholar]
  • 33.Garcia-Salguero A, Delgado-Serra S, Sola J, Negre N, Miranda MA, Paredes-Esquivel C. 2019. Combined morphology and DNA-barcoding to identify Plagiorhynchus cylindraceus cystacanths in Atelerix algirus . Parasitology Research, 118(5), 1473–1478. [DOI] [PubMed] [Google Scholar]
  • 34.García-Varela M, De León GPP. 2008. Validating the systematic position of Profilicollis Meyer, 1931 and Hexaglandula Petrochenko, 1950 (Acanthocephala: Polymorphidae) using cytochrome c oxidase (Cox 1). Journal of Parasitology, 94(1), 212–217. [DOI] [PubMed] [Google Scholar]
  • 35.Giannetto S, Trotti GC. 1995. Light and scanning electron microscopy of Spirura rytipleurites seurati Chabaud, 1954 (Nematoda: Spiruridae) from Erinaceus europaeus in Sicily. Journal of Helminthology, 69(4), 305–311. [Google Scholar]
  • 36.Grupo de Rehabilitación de la Fauna Autóctona y su Hábitat (GREFA). 2016. Anuario 2016. http://www.grefa.org/multimedia/descargas/category/4-anuarios?download = 284:anuario-2016.
  • 37.Halliday JEB, Meredith AL, Knobel DL, Shaw DJ, Bronsvoort BMDC, Cleaveland S. 2007. A framework for evaluating animals as sentinels for infectious disease surveillance. Journal of the Royal Society Interface, 4(16), 973–984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hoa LV. 1960. Redescription de quelques Capillaria peu connus, récoltés à richelieu (Indre et-Loire). Annales de Parasitologie Humaine et Comparée,35(4), 594–606. [DOI] [PubMed] [Google Scholar]
  • 39.Hoefer HL 1994. Hedgehogs. Veterinary Clinics of North America: Small Animal Practice, 24, 113–120. [DOI] [PubMed] [Google Scholar]
  • 40.Hof AR. 2009. A study of the current status of the hedgehog (Erinaceus europaeus), and its decline in Great Britain since 1960. PhD Thesis, University of London. [Google Scholar]
  • 41.Huijser MP. 2009. Life on the edge: hedgehog traffic victims and mitigation strategies in an anthropogenic landscape. PhD Thesis, Wageninger University. [Google Scholar]
  • 42.Jaume-Ramis S, Martínez-Ortí A, Delgado-Serra S, Bargues MD, Mas-Coma S, Foronda P, Paredes-Esquivel C. 2023. Potential intermediate hosts of Angiostrongylus cantonensis in the European Mediterranean region (Mallorca, Spain). One Health, 17, 100610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jiménez AM. 1992. Contribución al conocimiento de la parasitofauna de micromamíferos de la isla de Córcega (Francia). Estudio general de los helmintos de insectívoros y roedores. Estudio particular de Fasciola hepatica (Trematoda: Fasciolidae) y su parasitación en roedores. PhD Thesis, University of València. [Google Scholar]
  • 44.Jones KE, Patel NG, Levy MA, Storeygard A, Balk D, Gittleman JL, Daszak P. 2008. Global trends in emerging infectious diseases. Nature, 451(7181), 990–993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Jota Baptista CV, Seixas F, Gonzalo-Orden JM, Oliveira PA. 2021. Can the European hedgehog (Erinaceus europaeus) be a sentinel for One Health concerns? Biologics, 1(1), 61–69. [Google Scholar]
  • 46.Khaldi M, Torres J, Samsó B, Miquel J, Biche M, Benyettou M, Barech G, Benelkadi H, Ribas A. 2012. Endoparasites (Helminths and Coccidians) in the hedgehogs Atelerix algirus and Paraechinus aethiopicus from Algeria. African Zoology, 47(1), 48–54. [Google Scholar]
  • 47.Kinsella JM. 1971. Angiostrongylus schmidti sp. n. (Nematoda: Metastrongyloidea) from the rice rat, Oryzomys palustris, in Florida, with a key to the species of Angiostrongylus Kamensky, 1905. Journal of Parasitology, 57(3), 494–497. [PubMed] [Google Scholar]
  • 48.Kristiansson H. 1990. Population variables and causes of mortality in a hedgehog (Erinaceus europaeus) population in southern Sweden, Journal of Zoology, 220(3), 391–404. [Google Scholar]
  • 49.Lamom C, Greer GJ. 1986. Human infection with an Anoplocephalid tapeworm of the genus Mathevotaenia . American Journal of Tropical Medicine and Hygiene, 35(4), 824–826. [DOI] [PubMed] [Google Scholar]
  • 50.Liu X, Wang Z, Han Y, Liu H, Jin J, Zhou P, Su S, Yan Z. 2018. Gongylonema pulchrum infection in the human oral cavity: A case report and literature review. Oral Surgery, Oral Medicine, Oral Pathology and Oral Radiology, 125(3), e49–e53. [DOI] [PubMed] [Google Scholar]
  • 51.Lunn JA, Lee R, Smaller J, MacKay BM, King T, Hunt GB, Martin P, Krockenberger MB, Spielman D, Malik R. 2012. Twenty-two cases of canine neural angiostrongylosis in eastern Australia (2002–2005) and a review of the literature. Parasites & Vectors. 5(70), 1–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lv S, Zhou XN, Zhang Y, Liu HX, Zhu D, Yin WG, Steinmann P, Wang XH, Jia TW. 2006. The effect of temperature on the development of Angiostrongylus cantonensis (Chen 1935) in Pomacea canaliculata (Lamarck 1822). Parasitology Research, 99, 583–587. [DOI] [PubMed] [Google Scholar]
  • 53.Ma G, Dennis M, Rose K, Spratt D, Spielman D. 2013. Tawny frogmouths and brushtail possums as sentinels for Angiostrongylus cantonensis, the rat lungworm. Veterinary Parasitology, 192(1–3), 158–165. [DOI] [PubMed] [Google Scholar]
  • 54.Mas-Coma S. 1979. Zonorchis guevarai n. sp. (Trematoda: Dicrocoeliidae), parásito de Erinaceus (Aetechinus) algirus Duveroy et Lereboullet, 1842 (Insectivora: Erinaceidae) en España. Revista Ibérica de Parasitología, 39(1), 505–514. [Google Scholar]
  • 55.Mas-Coma S, Esteban J, Fuentes MV, Bargues M, Valero MA, Galán-Puchades M. 2000. Helminth parasites of small mammals (insectivores and rodents) on the Pityusic Island of Eivissa (Balearic Archipelago). Research and Reviews in Parasitology, 60(1–2), 41–49. [Google Scholar]
  • 56.Mas-Coma S, Feliu C. 1977. Erinaceus (Aethechinus) algirus Duvernoy et Lereboullet, 1842 (Insectivora: Erinaceidae), nuevo huésped de Capillaria annulosa (Dujardin, 1843) (Nematoda: Trichuridae). Circular Farmacéutica, 35(256), 323–326. [Google Scholar]
  • 57.Mas-Coma S, Esteban JG, Fuentes MV, Jiménez AM, Galán-Puchades MT. 1993. Helmints paràsits de micromamífers (insectívors i rosegadors), in Història natural de l’Arxipelag de Cabrera. Monografies de La Societat d’Història Natural de Les Balears (vol. 2), Alcover JA, Ballesteros E, Fornós JJ, Editors. Palma de Mallorca: Editorial Moll. p. 293–308. [Google Scholar]
  • 58.Miura O, Kuris AM, Torchin ME, Hechinger RF, Dunham EJ, Chiba S. 2005. Molecular-genetic analyses reveal cryptic species of trematodes in the intertidal gastropod, Batillaria cumingi (Crosse). International Journal for Parasitology, 35(7), 793–801. [DOI] [PubMed] [Google Scholar]
  • 59.Molony SE, Dowding CV, Baker PJ, Cuthill IC, Harris S. 2006. The effect of translocation and temporary captivity on wildlife rehabilitation success: An experimental study using European hedgehogs (Erinaceus europaeus). Biological Conservation, 130(4), 530–537. [Google Scholar]
  • 60.Moravec F. 1981. Proposal of a new systematic arrangement of nematodes of the family Capillariidae. Folia Parasitologica, 29(2), 119–132. [PubMed] [Google Scholar]
  • 61.Moravec F, Prokopič J, Shlikas AV. 1987. The biology of nematodes of the family Capillariidae Neveu-Lemaire, 1936, Folia Parasitologica, 34(1), 39–56. [PubMed] [Google Scholar]
  • 62.Morens DM, Folkers GK, Fauci AS. 2004. The challenge of emerging and re-emerging infectious diseases. Nature, 430, 242–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Morgan ER, Modry D, Paredes-Esquivel C, Foronda P, Traversa D. 2021. Angiostrongylosis in animals and humans in Europe, Pathogens. 10(10), 1236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Nadler SA, De León GPP. 2011. Integrating molecular and morphological approaches for characterizing parasite cryptic species: implications for parasitology. Parasitology, 138(13), 1688–1709. [DOI] [PubMed] [Google Scholar]
  • 65.Ortlepp RJ. 1937. Some undescribed species of the nematode genus Physaloptera Rud., together with a key to the sufficiently known forms. Onderstepoort Journal of Veterinary Science and Animal Industry, 9(1), 71–84. [Google Scholar]
  • 66.Otranto D, Deplazes P. 2019. Zoonotic nematodes of wild carnivores. International Journal for Parasitology: Parasites and Wildlife, 9, 370–383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Paredes-Esquivel C, Sola J, Delgado-Serra S, Riera MP, Negre N, Miranda MÁ, Jurado-Rivera JA. 2019. Angiostrongylus cantonensis in North African hedgehogs as vertebrate hosts, Mallorca, Spain, October 2018. Eurosurveillance, 24(33), 1900489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Petrželková KJ, Samaš P, Romportl D, Uwamahoro C, Červená B, Pafčo B, Prokopová T, Cameira R, Granjon AC, Shapiro A, Bahizi M, Nziza J, Noheri JB, Syaluha EK, Eckardt W, Ndagijimana F, Šlapeta J, Modrý D, Gilardi K, Muvunyi R, Uwingeli P, Mudakikwa A, Mapilanga J, Kalonji A, Hickey JR, Cranfield M. 2022. Ecological drivers of helminth infection patterns in the Virunga Massif mountain gorilla population. International Journal for Parasitology: Parasites and Wildlife, 17, 174–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Pfäffle M, Černá Bolfíková B, Hulva P, Petney T. 2014. Different parasite faunas in sympatric populations of sister hedgehog species in a secondary contact zone. PLoS One, 9, e114030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Quentin JC, Seguignes M. 1979. Cycle biologique de Gongylonema mucronatum Seurat, 1916 parasite du Hérisson d’Afrique du Nord. Annales de Parasitologie Humaine et Comparée, 54(6), 637–644. [DOI] [PubMed] [Google Scholar]
  • 71.Rasmussen SL, Hallig J, van Wijk RE, Petersen HH. 2021. An investigation of endoparasites and the determinants of parasite infection in European hedgehogs (Erinaceus europaeus) from Denmark. International Journal for Parasitology: Parasites and Wildlife, 16, 217–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Riley P, Chomel B. 2005. Hedgehog zoonoses. Emerging Infectious Diseases, 11(1), 1–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.RStudioTeam. 2021. RStudio: Integrated Development for R. Boston, MA. http://www.rstudio.com. [Google Scholar]
  • 74.Sah R, Khatri A, Kharel R, Kc H, Rabaan AA, Tiwari R, Dhama K, Malik YS, Donovan S, Rodriguez-Morales AJ, Muigg V, Neumayr A. 2020. Case report: management of dead intraocular helminth parasites in asymptomatic patients. American Journal of Tropical Medicine and Hygiene, 103(2), 719–722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Salehabadi A, Mowlavi G, Sadjjadi SM. 2008. Human infection with Moniliformis moniliformis (Bremser 1811) (Travassos 1915) in Iran: another case report after three decades. Vector-Borne and Zoonotic Diseases, 8(1), 101–104. [DOI] [PubMed] [Google Scholar]
  • 76.Sánchez Vicente S. 2013. Contribución al conocimiento de la parasitofauna (helmintos y artrópodos) de mamíferos no lagomorfos de Canarias. PhD thesis, University of Barcelona. [Google Scholar]
  • 77.Schmidt GD. 1986. Handbook of tapeworm identification. Boca Raton, Florida: CRC Press. p. 688. [Google Scholar]
  • 78.Skuballa J, Taraschewski H, Petney TN, Pfäffle M, Smales LR. 2010. The avian acanthocephalan Plagiorhynchus cylindraceus (Palaeacanthocephala) parasitizing the European hedgehog (Erinaceus europaeus) in Europe and New Zealand. Parasitology Research, 106(2), 431–437. [DOI] [PubMed] [Google Scholar]
  • 79.Soriano Lleras A, Pan C. 1955. Two cases of Physaloptera infection in man from Colombia. Journal of Parasitology, 41(6), 635. [Google Scholar]
  • 80.Spratt DM. 2006. Description of Capillariid nematodes (Trichinelloidea: Capillariidae) parasitic in Australian marsupials and rodents, Zootaxa, 1348(1), 1–82. [Google Scholar]
  • 81.Spratt DM. 2015. Species of Angiostrongylus (Nematoda: Metastrongyloidea) in wildlife: A review. International Journal for Parasitology: Parasites and Wildlife, 4(2), 178–189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Stefanski W. 1934. Sur le développement et les caractères spécifiques de Spirura rytipleurites (Deslongchamps 1824). Annales de Parasitologie Humaine et Comparée, 12(3), 203–217. [Google Scholar]
  • 83.Stunžėnas V, Binkienė R. 2021. Description of Crenosoma vismani n. sp., parasitic in the lungs of Lynx lynx (L.) (Carnivora: Felidae), with identification key to the species of the genus Crenosoma Molin, 1861 (Nematoda: Crenosomatidae). Systematic Parasitology, 98(1), 73–83. [DOI] [PubMed] [Google Scholar]
  • 84.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0, Molecular Biology and Evolution, 30(12), 2725–2729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Taylor LH, Latham SM, Woolhouse MEJ. 2001. Risk factors for human disease emergence. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences, 356(1411), 983–989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Thompson RCA, Polley L. 2014. Parasitology and One Health. International Journal for Parasitology: Parasites and Wildlife, 3,A1–A2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Torres Martínez J. 1988. Sobre las helmintofaunas de las especies de insectívoros y roedores del delta del Ebro (NE de la Península Ibérica), Doctoral dissertation, University of Barcelona. [Google Scholar]
  • 88.Vieira FM, Muniz-Pereira LC, de Souza Lima S, Moraes Neto AH, Gonçalves PR, Luque JL. 2012. Crenosoma brasiliense sp. n. (Nematoda: Metastrongyloidea) parasitic in lesser grison, Galictis cuja (Molina, 1782) (Carnivora, Mustelidae) from Brazil, with a key to species of Crenosoma Molin, 1861. Folia Parasitologica, 59(3), 187–194. [DOI] [PubMed] [Google Scholar]
  • 89.Wilson E, Wembridge D. 2018. The state of Britain’s hedgehogs 2018. London, United Kingdom: British Hedgehog Preservation Society and People’s Trust for Endangered Species. p. 1–4. [Google Scholar]
  • 90.Zacharopoulou M, Guillaume E, Coupez G, Bleuart C, Le Loc’hG, Gaide N. 2022. Causes of mortality and pathological findings in European Hedgehogs (Erinaceus europaeus) admitted to a wildlife care centre in Southwestern France from 2019 to 2020. Journal of Comparative Pathology, 190, 19–29. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

The supplementary material of this article is available at https://www.parasite-journal.org/10.1051/parasite/2024069/olm.

parasite-31-69-s1.pdf (387.2KB, pdf)

File S1. Helminth prevalence in hedgehogs arriving at the wildlife recovery centre in Mallorca.

parasite-31-69-s2.pdf (506.3KB, pdf)

File S2. Maximum likelihood phylogenetic tree based on the cytochrome oxidase I gene region. This shows the location Eucoleus sp. found in this study in relation to Capillariidae nematodes sequences available in GenBank.


Articles from Parasite are provided here courtesy of EDP Sciences

RESOURCES