Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Dec 1.
Published in final edited form as: Am J Med Genet A. 2024 Jul 19;194(12):e63815. doi: 10.1002/ajmg.a.63815

A novel ABCC9 variant in a Greek family with Cantu syndrome affecting multiple generations highlights the functional role of the SUR2B NBD1

Jian Gao 1,2,*, Athina Ververi 3,*, Ellen Thompson 1,2, Rob Tryon 1,2, Alexandros Sotiriadis 4, Fotios Rouvalis 5, Dorothy K Grange 2,6, Christos Giannios 7, Colin G Nichols 1,2
PMCID: PMC11540739  NIHMSID: NIHMS2007394  PMID: 39031464

Abstract

Cantu syndrome (CS) [OMIM #239850] is an autosomal dominant multiorgan system condition, associated with a characteristic facial phenotype, hypertrichosis and multiple cardiovascular complications. CS is caused by gain-of-function (GOF) variants in KCNJ8 or ABCC9 that encode pore-forming Kir6.1 and regulatory SUR2 subunits of ATP-sensitive potassium (KATP) channels. A novel heterozygous ABCC9 variant, c.2440G>T; p.Gly814Trp, was identified in three individuals from a four generation Greek family. The membrane potential in cells stably expressing hKir6.1 and hSUR2B with p.Gly814Trp was hyperpolarized compared to cells expressing WT channels, and inside-out patch clamp assays of KATP channels formed with hSUR2B p.Gly814Trp demonstrated a decreased sensitivity to ATP inhibition, confirming a relatively mild gain-of-function effect of this variant. The specific location of the variant reveals an unrecognized functional role of the first glycine in the signature motif of the NBD domains in ABC protein ion channels.

Keywords: Cantu syndrome, KATP channel, SUR2B, DiBAC, Nucleotide Binding Domain, Signature motif

Introduction

Cantu syndrome (CS) is a rare autosomal dominant genetic disorder, associated with characteristic coarse facial appearance, hypertrichosis, joint hyperflexibility, lymphedema, and multiple cardiovascular abnormalities, including tortuous blood vessels, patent ductus arteriosus (PDA) and cardiac hypertrophy (1, 2). All reported cases of CS are caused by inherited or de novo gain-of-function variants in either KCNJ8 or ABCC9. KCNJ8 and ABCC9 encode the Kir6.1 pore-forming and SUR2 regulatory subunits, respectively, of hetero-octameric ATP-sensitive potassium (KATP) channels (3, 4) that are found predominantly in muscle tissues (5). There are two major splice variants of SUR2, SUR2A and SUR2B (6, 7). KATP channels composed of Kir6.1 and SUR2B are predominantly expressed in vascular (8), lymphatic (9) and gastrointestinal (10) smooth muscles. KATP channels formed by Kir6.2 and SUR2A are present in cardiac and skeletal muscle (7, 11).

All KATP channels share the same architecture (12, 13) and similar modulation of channel function by nucleotides (14). ATP inhibits the channel by non-hydrolytic binding to a pocket formed at the interface between the Kir6.x cytoplasmic domains (15). SUR subunits are members of the ATP-binding cassette (ABC) transporter superfamily and are composed of TMD0, TMD1 and TMD2 transmembrane domains, with two cytoplasmic nucleotide binding domains (NBD), between TMD1 and TMD2 (NBD1) and at the very C-terminus of the protein (NBD2). Mg-nucleotide binding to two nucleotide binding sites (NBS) (16) that are formed at the interface between the two NBDs (17, 18) results in conformational changes that propagate to the channel, leading to channel opening (19). Thus, the activities of KATP channels are determined by intracellular ATP and ADP levels, and KATP channels couple cell metabolism to excitability (14, 20). The nucleotide-bound dimerized NBDs are stabilized by synthesized potassium channel activators (KCOs) such as pinacidil and prevented by channel inhibitors such as glibenclamide (13, 18).

Within the fully dimerized NBDs, NBS1 is formed by the Walker A (“GQVGCGKSS”) and Walker B (“IVFLDD”) motifs in NBD1 and the signature (“FSVGQ”) motif in NBD2, while NBS2 is formed by the equivalent Walker A and B motifs in NBD2 and signature motif in NBD1 (21). NBS2 contains the necessary elements for ATP hydrolysis, including a glutamate residue in the last amino acid in Walker B (22) and conserved “LSGGQ” in the signature motif, and is reported to hydrolyze the bound MgATP (23). In contrast, NBS1 does not conserve these sequences and has been considered a degenerate NBS that retains MgATP binding but does not support hydrolysis (24). While a full mechanistic understanding remains elusive, there is a consensus that Kir6.x associated with SUR1 or SUR2 subunits are activated by hydrolysis of MgATP to MgADP at NBS2, and that experimentally, addition of MgADP to the cytoplasmic face can maintain the activated SUR state (25).

Within multiple members of the ABC transporter family, the conserved Walker B glutamate has been shown to be important in coordinating the γ‐phosphate of ATP and the Mg2+ ion and inducing the ATP hydrolysis reaction. Within the LSGGQ motif, mutation of the second glycine has been shown to decrease the activities of several ABC transporters(26–28). The first glycine in the signature motif, which has received less experimental study, is not fully conserved within the ABC family(21), suggesting tolerance to mutation. Here, we report a variant involving the first signature glycine, p.Gly814Trp, in SUR2B that was identified in three generations of a family. The variant segregated with the clinical diagnosis of Cantu syndrome, suggesting a causal effect on KATP channel activity.

Materials and Methods

Editorial Policies and Ethical Considerations

Genetic testing was performed as part of clinical diagnosis. Ethical approval was not required. Written informed consent was obtained for publication of all images of family members.

Molecular genetic analysis

The proband underwent clinical genetic testing on peripheral blood via an intellectual disability gene panel. Genomic DNA was enriched for targeted regions using a hybridization-based protocol, and was, subsequently, sequenced at >50x depth using Illumina technology. Reads were aligned to the reference sequence (GRCh37). Genomic DNA was isolated from saliva samples submitted by six additional family members using the Lamda Biotech Animal Genomic Test Kit. Primers (int21F: ATCAGCCTGAAGCCATCTTG and int22R: CAGCACTGGAATGGGGTACT) were ordered (Integrated DNA Technology) flanking the 22nd exon of abcc9 in order to generate a 688 bp product containing the putative Gly814Trp variant. The int21F primer was subsequently used for detection by Sanger sequencing.

Molecular biology and cell culture

The identified p.Gly814Trp variant was introduced into human SUR2B(29)(pcDNA3.1-_ hSUR2B; GenBankTM accession no. NP_064693.2) cDNA using site-directed mutagenesis and verified by direct Sanger sequencing. WT and p.Gly814Trp (G814W) hSUR2B cDNA were subcloned into a vector including hKir6.1 and IRES sequence for stable cell line generation using the landingpad HEK293 cell system(30).

HEK293 stable cells expressing hKir6.1 and WT or G814W hSUR2B were generated as described previously(29). For transient expression, cosm6 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) and transfected using FuGENE 6 (Roche Applied Science) with wildtype pcDNA3.1_hKir6.2 (0.6 μg; GenBankTM accession no. NG_012446.1) and wildtype or variant pcDNA3.1_hSUR2B constructs (1 μg) in addition to 0.2 μg of pcDNA3.1_eGFP for visual detection of successful transfection. Excised patch-clamp recordings were made 48–72h post-transfection.

Membrane potential assessments by voltage-sensitive fluorescent dye

This experiment was conducted as described previously(29). Briefly, transparent cell-culture 96-well plates were coated with poly-L-lysine (0.1 mg/ml) one day before stable cells were plated at an appropriate density. Cells were cultured with 100 μl DMEM containing 10% FBS, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 4 μg/ml doxycycline. After one day in culture, the medium was discarded and the cells were washed twice with low [K] (1mM) buffer (80 μl/well). Cells were then incubated with 3 μM DiBAC4(3) in low K buffer, with or without additional channel modulators, for at least 20 min. Separate images of green and red fluorescence were taken with EVOS M5000 imaging system (10x lens).

The recipe for low K buffer is: NaCl 139 mM, KCl 1 mM, CaCl2 2 mM, MgCl2 1 mM, HEPES 10 mM, Glucose 10 mM. The pH was adjusted to 7.4 with NaOH.

Exported tiff images were analyzed by CellProfiler with custom designed programs for Landing pad cells and generated stable cell lines. Multiple measurements of each cell were exported as a csv format file and the intensities of all cells as well as the mean value in each image were extracted with a custom script written in Python©. The average intensity value of duplicate images was calculated as one data point for the statistical analysis and data presentation.

Excised inside-out patch-clamp

Pipettes were made from soda lime glass microhematocrit tubes (Kimble) and had resistance of 1–3 megohms when filled with pipette solution. The bath and pipette solutions (KINT) contained (in mM):140 KCl, 10 HEPES, 1 EGTA (pH=7.4 with KOH). Currents were recorded at a constant holding potential of −50 mV in the absence and presence of nucleotides, as indicated. Where included, free Mg2+ concentrations were maintained at 0.5 mM by supplementation of MgCl2, calculated using CaBuf (Katholieke Universiteit Leuven). Rapid solution exchange was attained using a Dynaflow Resolve perfusion chip (Cellectricon). Experiments were performed at 20–22°C. KATP channel currents in solutions of varying nucleotide concentrations were normalized to the basal current in the absence of nucleotides, and dose-response data were fit with a four-parameter Hill fit according to Equation 1, using the Data Solver Function in Microsoft Excel,

Normalizedcurrent=Imin+(Imax−Imin)/(1+([X]/IC50)H), Eqn. 1,

where current in KINT = Imax = 1; Imin is the normalized minimum current observed in high [ATP]; [X] refers to the concentration of ATP; IC50 is the concentration of half-maximal inhibition; and H denotes the Hill coefficient.

Data analyses

All statistical analyses were performed using Microsoft Excel or Prism (GraphPad). Significance values were calculated using Student t-test. All values are expressed as mean ±SD.

Results

Clinical information

The proband is a 5 year old boy with developmental delay, dysmorphic features (Fig. 1A1) and hypertrichosis. He is the first child of non-consanguineous parents of Greek (father) and Albanian (mother) origin. He has a maternal half-brother who is healthy. The pregnancy was complicated by mild polyhydramnios, for which no maternal causes were identified. The polyhydramnios was detected at 28 weeks gestation and persisted throughout the third trimester. The pregnancy was otherwise uncomplicated and the proband was born at 40 weeks gestation. His growth parameters at birth were normal (birth weight 20th centile, head circumference 22nd centile, length 33rd centile) and remained at similar centiles at last follow-up visit at 5 years. The child was referred for genetic assessment due to the diagnosis of Autistic Spectrum Disorder (ASD) and dysmorphic features. The diagnosis of ASD was confirmed with the use of Autism Diagnostic Observation Schedule, Second Edition (ADOS-2) and Autism Diagnostic Interview-Revised (ADI-R). The proband’s developmental delay has gradually improved. He is currently functioning at an almost age-appropriate level and is scheduled to attend mainstream school without support. There were no health concerns at his last follow-up visit at the age of 5 years, although echocardiogram revealed aortic root ectasia (z score 1.98). He is under follow-up by a pediatric cardiologist and a developmental pediatrician.

Figure 1: Affected individuals and pedigree.

Figure 1:

(A). Images of the proband (1) and his father (2) and grandmother (3) carrying the c.2440G>T; p.Gly814Trp ABCC9 variant. (B). Pedigree of the family. Square: male, circle: female, black: clinically affected by CS, white: non-affected; grey: clinically affected by CS without molecular confirmation.

Due to his constellation of findings, the proband underwent genetic analysis using an intellectual disability gene panel at the age of 3 years (Invitae Daignostic Testing). The testing identified a heterozygous c.2440G>T; p.Gly814Trp variant in ABCC9 which was absent from gnomAD and all in-silico tools predicted pathogenicity. Parental testing showed that the father, aged 38 years, also carries the variant, but with no reported health concerns, other than hypertrichosis and cholesteatoma. On physical examination, the father has facial features consistent with Cantu syndrome (Fig. 1A2). Both the proband and his father were referred to cardiology, and the father was found to have ventricular hypertrophy and mild aortic dilatation (44 mm, z score 3.3). Segregation testing in the family did not identify the variant in the paternal aunt, who has a normal phenotype. However, the paternal grandmother, who has a Cantu syndrome facial appearance and hypertrichosis, was also found to carry the variant (Fig. 1A3). She is 62 years old and does not have any reported health concerns, apart from ventricular hypertrophy. Her father is reported to have had a similar facial appearance, as confirmed by examination of family photographs. He also had a cholesteatoma and died at 67 years of ‘premature old age’. The family pedigree is shown in Figure 1B.

The p.Gly814Trp variant increases the basal activity of KATP channels

Gly814 in SUR2 is located in NBD1, at the interface of the dimerized NBD1/2 conformation (Fig. 2A) and is conserved in all human ABCC family protein sequences (Fig. 2B). To examine the effect of the p.(Gly814Trp) on Kir6.1/SUR2B-dependent ion channel activity, the variant was introduced into human SUR2B cDNA and stable cell lines expressing wild type hKir6.1 and wild type hSUR2B (WT) or p.Gly814Trp (G814W) mutant hSUR2B were generated as previously described(29). DiBAC4(3), a cell membrane sensing fluorescent dye assay was used to assess membrane polarization. A representative experiment is shown in Fig. 3A, together with the distribution of fluorescence intensity in individual cells (Fig. 3B). Under basal conditions, G814W cells exhibit lower mean intensity fluorescence (0.099 ± 0.017) than WT cells (0.121 ± 0.015, Fig. 3C), reflecting a membrane hyperpolarization effect that indicates a gain of channel function under basal conditions in intact cells, although the effect is weaker than previously seen for other established CS gain-of-function variants (29). From these DiBAC4(3) measurements, the relative K conductances were as follows: WT 1.0; G814W 1.8 ± 0.6; A478V 4.4 ± 2.0; R1154Q 5.0 ± 2.0; R1154W 5.8 ± 1.7; calculated using a simplified Goldman-Hodgkin-Katz equation that assumes permeability is conductance, and that all non-K conductances can be lumped into a single “sodium” conductance (eqn. 6 in ref. 29).

Figure 2: Molecular location of p.Gly814Trp.

Figure 2:

(A). Localization of the Gly814 in the Cryo-EM structure of hSUR2B(PDB:7vlr) (B). Sequence alignment of ABCC family proteins. The black arrow points to the Gly814 in SUR2.

Figure 3. p.Gly814Trp hyperpolarizes the cell membrane potential.

Figure 3.

(A) Representative images of stable cell lines expressing hKir6.1 plus WT or G814W hSUR2B. Cells were incubated with 3 μM DiBAC4(3) in the low K buffer before images were taken. (B) Distribution of the pooled relative fluorescence of WT or mutant cells from all the images. (C) Summary of the absolute or relative mean values of the fluorescence of the WT and mutant channel expressing cells. p value is shown on top of the figures according to student t-test.

The p.Gly814Trp variant decreases sensitivity of recombinant channels to ATP inhibition

To further assess the effect of the variant on channel activity, inside-out patch-clamp assays were performed on Cosm6 cells transiently transfected with hKir6.2 and WT or G814W hSUR2B, and GFP. Both wild type and mutant channels were dose-dependently inhibited by ATP in the presence (Fig. 4A) or absence (Fig. 4B) of physiological (0.5 mM free) Mg2+. Under both conditions, the inhibitory effect of [ATP] was reduced ~3-fold in G814W channels, with IC50 increasing from ~20 μM to 60 μM in the presence of Mg2+ and from ~10 μM to ~30 μM in the absence of Mg2+ (Fig. 4C, D), with no significant change in the Hill coefficient.

Figure 4: p.Gly814Trp decreases ATP inhibition in the presence or absence of Mg2+.

Figure 4:

(A) and (B) The response of recombinant Kir6.2/SUR2B channels to MgATP(blue) or ATP(red) in μM was determined from voltage-clamped patches (−50 mV), as shown in representative traces. (B). Dose dependent curves fitted by Hill equation show ATP inhibition of WT or p.(Gly814Trp) channels in the presence or absence of Mg2+. (C). Scatter plots show data from individual experiments with mean IC50 ± S.D. P values are shown on top of the figures according to student t-test.

Discussion

We provide the first report of a Greek family with CS, in which the genetic basis was confirmed in 3 generations, but the phenotype was present in at least 4 generations. The affected individuals show many of the typical features associated with CS, and all harbor a heterozygous c.2440G>T variant in ABCC9 resulting in a p.Gly814Trp variant in NBD1 of SUR2. Functional assays of recombinant KATP channels containing p.Gly814Trp (G814W) exhibit reduced sensitivity to inhibitory ATP compared to WT, providing a molecular explanation of the condition.

Role of the LSGGQ glycine in ABC protein function

Both the DiBAC4(3) assay and the patch-clamp analyses indicate that the variant p.Gly814Trp increases Kir6.1/SUR2B-dependent channel activity. Naively, it may be predicted that the effect of this variant, being located within NBD1 and at the Mg2+ nucleotide-dependent interface of NBD1/2 dimers would affect channel activity in the presence of Mg2+, by increasing the activatory effects of MgADP, as is seen with many other CS variants in SUR2 (31–33). Interestingly, the patch-clamp assay shows that the variant decreased sensitivity to ATP, even in the absence of Mg2+. One possibility is that even in the absence of MgATP and subsequent conformational changes, the NBD domain dimerization-induced effect is mimicked by this variant. It is also possible that ATP binding in the absence of Mg2+ is increased by this variant, so that the outward facing (NBD dimerized) conformation is stabilized (34). In NBD-dimerized SUR1 Cryo-EM structures (17), the second nucleotide binding site (NBS2) is not fully closed, with a predicted distance between the Gly814 backbone carbon and the ATP adenine group of ~11 A. Conceivably, the bulky G814W tryptophan side chain may help to close the gap and stabilize the NBD-dimerized conformation. A recent study reported the insertion of a regulatory (R-domain) peptide between the two NBDs of SUR2A, in which the main chain of neighboring Gly815 was proposed to bind to a glutamate residue within the R-domain (35). Interestingly, p.Gly815Ala has also been reported in association with CS (2), and variant p.Gly832Cys in SUR1 (equivalent to Gly814 in SUR2), has been reported in association with neonatal diabetes mellitus (36), which is caused by GOF variants in Kir6.2/SUR1 channels. Conceivably, a mutation of either or both LSGGQ glycines may thus work by destabilizing the R-domain insertion and favoring NBD dimerization. The equivalent G550W mutation in ABCC7 (which generates the CFTR chloride channel), also increases sensitivity to protein kinase A activation and channel open probability (37), although mutations at the corresponding site in more distant ABC transporters have been reported to be without functional effect (38, 39). A potentially simple explanation is that for ion channels CFTR and KATP, just stabilizing NBD dimerization will favor channel opening, whereas both NBD dimerization, hydrolysis, and nucleotide dissociation are required for a complete cycle in ABC transporters.

Clinical implications

The majority of identified CS individuals are de novo or have at most 1 or 2 antecedent affected individuals in any given family (2). While this might reflect identification bias resulting from modern exome sequencing being more likely to be carried out in children, it might also suggest that, historically at least, premature mortality resulting from untreated pulmonary and cardiovascular complications (1, 2) precluded the generation of very extensive CS pedigrees. Clearly, complications in neonates or infants account for some premature CS deaths (1, 2), but premature death in adulthood is also likely; there are few reports of older (>50 years) males with confirmed CS, and evidence for heart failure in older females with CS (40). That said, the penetrance of different CS features has thus far been difficult to predict, and no quantitative molecular phenotype – organism phenotype relationship has been developed. In this regard, it is interesting that the p.Gly814Trp variant underlies an extended pedigree in the present family, with at least 4 generations affected, and at least one older male and an affected antecedent who died at 65. Possibly, In comparison to other confirmed CS variants (29), p.Gly814Trp demonstrated a more mild gain-of-function effect in recombinant channels. In future, a quantitative molecular phenotype – organism phenotype relationship may be necessary, particularly for predicting the ability of SUR2-inhibitors to treat CS, since the sensitivity to such inhibitors can be dependent on the severity of the gain-of-function itself(29, 32).

A cholesteatoma, an abnormal accumulation of keratin-producing squamous cells in the middle ear, was present in two affected individuals. Cholesteatomas are most often seen in association with chronic recurrent ear infections and are rarely congenital. This feature has not previously been described in CS, and with no obvious connection to the underlying molecular basis, it is uncertain if there is a causal link between CS and cholesteatoma.

Acknowledgements

These studies were supported by R35 grant HL171542 from the NIH (to CGN).

Footnotes

Competing Interests

The authors declare no competing interests.

Data Availability Statement

The original data will be made available to any interested parties upon reasonable request.

References

  • 1.Grange DK, Nichols CG, Singh GK. Cantu Syndrome and Related Disorders. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, et al. , editors. GeneReviews(R). Seattle (WA)2014. [Google Scholar]
  • 2.Grange DK, Roessler HI, McClenaghan C, Duran K, Shields K, Remedi MS, et al. Cantu syndrome: Findings from 74 patients in the International Cantu Syndrome Registry. Am J Med Genet C Semin Med Genet. 2019;181(4):658–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Shyng S, Nichols CG. Octameric stoichiometry of the KATP channel complex. J Gen Physiol. 1997;110(6):655–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Aguilar-Bryan L, Clement JPt, Gonzalez G, Kunjilwar K, Babenko A, Bryan J. Toward understanding the assembly and structure of KATP channels. Physiol Rev. 1998;78(1):227–45. [DOI] [PubMed] [Google Scholar]
  • 5.Flagg TP, Enkvetchakul D, Koster JC, Nichols CG. Muscle KATP channels: recent insights to energy sensing and myoprotection. Physiol Rev. 2010;90(3):799–829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Shindo T, Yamada M, Isomoto S, Horio Y, Kurachi Y. SUR2 subtype (A and B)-dependent differential activation of the cloned ATP-sensitive K+ channels by pinacidil and nicorandil. Br J Pharmacol. 1998;124(5):985–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chutkow WA, Simon MC, Le Beau MM, Burant CF. Cloning, tissue expression, and chromosomal localization of SUR2, the putative drug-binding subunit of cardiac, skeletal muscle, and vascular KATP channels. Diabetes. 1996;45(10):1439–45. [DOI] [PubMed] [Google Scholar]
  • 8.Brayden JE. Functional roles of KATP channels in vascular smooth muscle. Clin Exp Pharmacol Physiol. 2002;29(4):312–6. [DOI] [PubMed] [Google Scholar]
  • 9.Davis MJ, Kim HJ, Zawieja SD, Castorena-Gonzalez JA, Gui P, Li M, et al. Kir6.1-dependent K(ATP) channels in lymphatic smooth muscle and vessel dysfunction in mice with Kir6.1 gain-of-function. J Physiol. 2020;598(15):3107–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.York NW, Parker H, Xie Z, Tyus D, Waheed MA, Yan Z, et al. Kir6.1- and SUR2-dependent KATP overactivity disrupts intestinal motility in murine models of Cantu syndrome. JCI Insight. 2020;5(23). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Foster MN, Coetzee WA. KATP Channels in the Cardiovascular System. Physiol Rev. 2016;96(1):177–252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Li N, Wu JX, Ding D, Cheng J, Gao N, Chen L. Structure of a Pancreatic ATP-Sensitive Potassium Channel. Cell. 2017;168(1–2):101–10 e10. [DOI] [PubMed] [Google Scholar]
  • 13.Sung MW, Yang Z, Driggers CM, Patton BL, Mostofian B, Russo JD, et al. Vascular K(ATP) channel structural dynamics reveal regulatory mechanism by Mg-nucleotides. Proc Natl Acad Sci U S A. 2021;118(44). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Nichols CG. KATP channels as molecular sensors of cellular metabolism. Nature. 2006;440:471–6. [DOI] [PubMed] [Google Scholar]
  • 15.Tucker SJ, Gribble FM, Zhao C, Trapp S, Ashcroft FM. Truncation of Kir6.2 produces ATP-sensitive K+ channels in the absence of the sulphonylurea receptor. Nature. 1997;387(6629):179–83. [DOI] [PubMed] [Google Scholar]
  • 16.Moody JE, Millen L, Binns D, Hunt JF, Thomas PJ. Cooperative, ATP-dependent association of the nucleotide binding cassettes during the catalytic cycle of ATP-binding cassette transporters. J Biol Chem. 2002;277(24):21111–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wu JX, Ding D, Wang M, Kang Y, Zeng X, Chen L. Ligand binding and conformational changes of SUR1 subunit in pancreatic ATP-sensitive potassium channels. Protein Cell. 2018;9(6):553–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Puljung M, Vedovato N, Usher S, Ashcroft F. Activation mechanism of ATP-sensitive K(+) channels explored with real-time nucleotide binding. Elife. 2019;8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Nichols CG, Shyng SL, Nestorowicz A, Glaser B, Clement JPt, Gonzalez G, et al. Adenosine diphosphate as an intracellular regulator of insulin secretion. Science. 1996;272(5269):1785–7. [DOI] [PubMed] [Google Scholar]
  • 20.Tinker A, Aziz Q, Li Y, Specterman M. ATP-Sensitive Potassium Channels and Their Physiological and Pathophysiological Roles. Compr Physiol. 2018;8(4):1463–511. [DOI] [PubMed] [Google Scholar]
  • 21.Stockner T, Gradisch R, Schmitt L. The role of the degenerate nucleotide binding site in type I ABC exporters. FEBS Lett. 2020;594(23):3815–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sauna ZE, Muller M, Peng XH, Ambudkar SV. Importance of the conserved Walker B glutamate residues, 556 and 1201, for the completion of the catalytic cycle of ATP hydrolysis by human P-glycoprotein (ABCB1). Biochemistry. 2002;41(47):13989–4000. [DOI] [PubMed] [Google Scholar]
  • 23.Urbatsch IL, Julien M, Carrier I, Rousseau ME, Cayrol R, Gros P. Mutational analysis of conserved carboxylate residues in the nucleotide binding sites of P-glycoprotein. Biochemistry. 2000;39(46):14138–49. [DOI] [PubMed] [Google Scholar]
  • 24.Ueda K, Inagaki N, Seino S. MgADP antagonism to Mg2+-independent ATP binding of the sulfonylurea receptor SUR1. J Biol Chem. 1997;272(37):22983–6. [DOI] [PubMed] [Google Scholar]
  • 25.Masia R, Enkvetchakul D, Nichols CG. Differential nucleotide regulation of KATP channels by SUR1 and SUR2A. J Mol Cell Cardiol. 2005;39(3):491–501. [DOI] [PubMed] [Google Scholar]
  • 26.Logan J, Hiestand D, Daram P, Huang Z, Muccio DD, Hartman J, et al. Cystic fibrosis transmembrane conductance regulator mutations that disrupt nucleotide binding. J Clin Invest. 1994;94(1):228–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Szentpetery Z, Kern A, Liliom K, Sarkadi B, Varadi A, Bakos E. The role of the conserved glycines of ATP-binding cassette signature motifs of MRP1 in the communication between the substrate-binding site and the catalytic centers. J Biol Chem. 2004;279(40):41670–8. [DOI] [PubMed] [Google Scholar]
  • 28.Bakos E, Klein I, Welker E, Szabo K, Muller M, Sarkadi B, et al. Characterization of the human multidrug resistance protein containing mutations in the ATP-binssssssssding cassette signature region. Biochem J. 1997;323 (Pt 3)(Pt 3):777–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Gao J, McClenaghan C, Matreyek KA, Grange DK, Nichols CG. Rapid Characterization of the Functional and Pharmacological Consequences of Cantu Syndrome K(ATP) Channel Mutations in Intact Cells. J Pharmacol Exp Ther. 2023;386(3):298–309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Matreyek KA, Stephany JJ, Fowler DM. A platform for functional assessment of large variant libraries in mammalian cells. Nucleic Acids Res. 2017;45(11):e102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Cooper PE, Sala-Rabanal M, Lee SJ, Nichols CG. Differential mechanisms of Cantu syndrome-associated gain of function mutations in the ABCC9 (SUR2) subunit of the KATP channel. J Gen Physiol. 2015;146(6):527–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.McClenaghan C, Hanson A, Sala-Rabanal M, Roessler HI, Josifova D, Grange DK, et al. Cantu syndrome-associated SUR2 (ABCC9) mutations in distinct structural domains result in K(ATP) channel gain-of-function by differential mechanisms. J Biol Chem. 2018;293(6):2041–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gao J, McClenaghan C, Christiaans I, Alders M, van Duinen K, van Haelst MM, et al. Lymphedema as first clinical presentation of Cantu Syndrome: reversed phenotyping after identification of gain-of-function variant in ABCC9. Eur J Hum Genet. 2023;31(2):188–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sikimic J, McMillen TS, Bleile C, Dastvan F, Quast U, Krippeit-Drews P, et al. ATP binding without hydrolysis switches sulfonylurea receptor 1 (SUR1) to outward-facing conformations that activate K(ATP) channels. J Biol Chem. 2019;294(10):3707–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ding D, Hou T, Wei M, Wu JX, Chen L. The inhibition mechanism of the SUR2A-containing K(ATP) channel by a regulatory helix. Nat Commun. 2023;14(1):3608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yamazaki M, Sugie H, Oguma M, Yorifuji T, Tajima T, Yamagata T. Sulfonylurea treatment in an infant with transient neonatal diabetes mellitus caused by an adenosine triphosphate binding cassette subfamily C member 8 gene mutation. Clin Pediatr Endocrinol. 2017;26(3):165–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Chen J, Thrasher K, Fu L, Wang W, Aghamohammadzadeh S, Wen H, et al. The synthetic aminoglycoside ELX-02 induces readthrough of G550X-CFTR producing superfunctional protein that can be further enhanced by CFTR modulators. Am J Physiol Lung Cell Mol Physiol. 2023;324(6):L756–L70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kumar A, Shukla S, Mandal A, Shukla S, Ambudkar SV, Prasad R. Divergent signature motifs of nucleotide binding domains of ABC multidrug transporter, CaCdr1p of pathogenic Candida albicans, are functionally asymmetric and noninterchangeable. Biochim Biophys Acta. 2010;1798(9):1757–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Meier G, Thavarasah S, Ehrenbolger K, Hutter CAJ, Hurlimann LM, Barandun J, et al. Deep mutational scan of a drug efflux pump reveals its structure-function landscape. Nat Chem Biol. 2023;19(4):440–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Singh GK, McClenaghan C, Aggarwal M, Gu H, Remedi MS, Grange DK, et al. A Unique High-Output Cardiac Hypertrophy Phenotype Arising From Low Systemic Vascular Resistance in Cantu Syndrome. J Am Heart Assoc. 2022;11(24):e027363. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original data will be made available to any interested parties upon reasonable request.

RESOURCES