Skip to main content
eLife logoLink to eLife
. 2024 Nov 11;13:RP94657. doi: 10.7554/eLife.94657

The E3 ubiquitin ligase RNF220 maintains hindbrain Hox expression patterns through regulation of WDR5 stability

Huishan Wang 1,†, Xingyan Liu 2,3,†, Yamin Liu 1,4, Chencheng Yang 1,4, Yaxin Ye 1,4, Xiaomei Yu 1,5, Nengyin Sheng 1,6,7, Shihua Zhang 2,6,8,✉, Bingyu Mao 1,5,6,✉, Pengcheng Ma 1,✉
Editors: Paschalis Kratsios9, Claude Desplan10
PMCID: PMC11554307  PMID: 39526890

Abstract

The spatial and temporal linear expression of Hox genes establishes a regional Hox code, which is crucial for the antero-posterior (A-P) patterning, segmentation, and neuronal circuit development of the hindbrain. RNF220, an E3 ubiquitin ligase, is widely involved in neural development via targeting of multiple substrates. Here, we found that the expression of Hox genes in the pons was markedly up-regulated at the late developmental stage (post-embryonic day E15.5) in Rnf220-/- and Rnf220+/- mouse embryos. Single-nucleus RNA sequencing (RNA-seq) analysis revealed different Hox de-repression profiles in different groups of neurons, including the pontine nuclei (PN). The Hox pattern was disrupted and the neural circuits were affected in the PN of Rnf220+/- mice. We showed that this phenomenon was mediated by WDR5, a key component of the TrxG complex, which can be polyubiquitinated and degraded by RNF220. Intrauterine injection of WDR5 inhibitor (WDR5-IN-4) and genetic ablation of Wdr5 in Rnf220+/- mice largely recovered the de-repressed Hox expression pattern in the hindbrain. In P19 embryonal carcinoma cells, the retinoic acid-induced Hox expression was further stimulated by Rnf220 knockdown, which can also be rescued by Wdr5 knockdown. In short, our data suggest a new role of RNF220/WDR5 in Hox pattern maintenance and pons development in mice.

Research organism: Mouse

Introduction

The coordinated expression of Hox genes clusters is critical for axial patterning to determine the positional identities during the development of many tissues, including the hindbrain (Frank and Sela-Donenfeld, 2019; Parker et al., 2014; Parker and Krumlauf, 2020; Pöpperl and Featherstone, 1993). In mammals, there are 39 Hox genes organized in four clusters (Hoxa, Hoxb, Hoxc, and Hoxd) and divided into 1–13 paralog groups (PG). During vertebrate development, the hindbrain forms eight metameric segmented units along the antero-posterior (A-P) axis known as rhombomeres (r), which give rise to the cerebellum, pons, and medulla later on Ghosh and Sagerström, 2018; Parker and Krumlauf, 2020. In the embryonic hindbrain, Hox1-5 genes are expressed in a nested overlapping pattern with rhombomere-specific boundaries. This Hox code is critical for the establishment of rhombomeric territories and the determination of cell fates (Barsh et al., 2017; Parker et al., 2016; Parker and Krumlauf, 2020).

At later embryonic stages, Hox genes also play vital roles in neuronal migration and circuit formation (Feng et al., 2021; Hockman et al., 2019; Kratochwil et al., 2017; Wang et al., 2013). For example, neurons in the pontine nuclei (PN), which acts as an information integration station between the cortex and cerebellum (Kratochwil et al., 2017; Maheshwari et al., 2020), originate at the posterior rhombic lip of r6-r8, migrate tangentially to the rostral ventral hindbrain, and then receive different inputs from the cortex, in which the specific expression pattern of Hox3-5 genes determines the migration routines, cellular organization, and neuronal circuits (Geisen et al., 2008; Kratochwil et al., 2017; Maheshwari et al., 2020; Di Meglio et al., 2013; Lizen et al., 2017). Note that Hox gene expression is maintained up to postnatal and even adult stages in the hindbrain derivatives (Farago et al., 2006; Feng et al., 2021; Kratochwil et al., 2017).

Hox pattern maintenance is generally governed by epigenetic regulators, especially the polycomb-group (PcG) and trithorax-group (trxG) complexes, which repress and activate Hox genes, respectively (Bahrampour et al., 2019; Chopra et al., 2009; Kang et al., 2022; Papp and Müller, 2006). In mammals, different SET/MLL proteins and a common multi-subunit core module consisting of WDR5, RBBP5, ASH2L, and DPY-30 (WRAD) constitute the COMPASS (complex of proteins associated with Set1) family of TrxG complexes, which acts as a methyltransferase generally (Cenik and Shilatifard, 2021; Jambhekar et al., 2019; Schuettengruber et al., 2017). Among them, WDR5 plays a central scaffolding role and has been shown to act as a key regulator of Hox maintenance (Wang et al., 2011; Wysocka et al., 2005). WDR5 was also reported for HOX maintenance in human and associated with various blood and solid tumors. In acute myeloid leukemia and acute lymphoblastic leukemia, WDR5 is responsible for MLL-mediated HOXA9 activation and is a potential drug target (Chen et al., 2021; Yu et al., 2021). In addition, WDR5 facilitates HOTTIP, a long noncoding RNA, to recruit the MLL complex and thus stimulate HOXA9 and HOXA13 expression during the progression of prostate and liver tumors (Fu et al., 2017; Malek et al., 2017; Quagliata et al., 2014; Wong et al., 2020).

The E3 ubiquitin ligase RNF220 is widely involved in neural development through targeting a range of proteins (Kim et al., 2018; Kong et al., 2010; Ma et al., 2021; Ma et al., 2022a; Wang et al., 2022,Wang et al., 2022; Ma et al., 2022c). Although our previous reports have shown that Rnf220-/- mice is neonatal lethal and the survived Rnf220+/- mice develop severe motor impairments, the underlying mechanisms remain incompletely understood (Ma et al., 2021; Ma et al., 2019). In the present study, a markedly up-regulation of Hox genes is observed in the pons of both Rnf220+/- and Rnf220-/- mice during late embryonic development. In consequence, the topographic input connectivity of the PN neurons with cortex is disturbed in Rnf220+/- mice. Furthermore, we identified WDR5 as a direct target of RNF220 for K48-linked ubiquitination and thus degradation, a mechanism critical for Hox de-repression by Rnf220 knockout. Together, these findings reveal a novel role for RNF220 in the regulation of Hox genes and pons development in mice.

Results

Rnf220 insufficiency leads to dysregulation of Hox expression in late embryonic pons

Rnf220 is strongly expressed in the embryonic mouse mid/hindbrain (Ma et al., 2019; Wang et al., 2022). Based on microarray analysis, we explored changes in expression profiles in E18.5 Rnf220+/- and Rnf220-/- mouse brains, which breed floxed Rnf220 to Vasa-Cre mice. Interestingly, several Hox genes were up-regulated in the mouse brain of both genotypes (Supplementary file 1, Supplementary file 2). Considering that Hox expression in forebrain is too low (data not shown), we focus on the hindbrain and found that this phenomenon was observed only in late embryonic stages after E15.5 (Figure 1—figure supplement 1). Since Rnf220-/- mice is neonatal lethal and there is not significant difference in the upregulation of Hox genes between Rnf220+/- and Rnf220-/- mice, Rnf220+/- mice were used in subsequent assays in this study. To determine the specific brain regions with aberrant Hox expression, we examined the expression levels of Hoxa9 and Hoxb9, two of the most significantly up-regulated genes, in different brain and spinal regions (Figure 1—figure supplement 2A–D). Notably, both Hoxa9 and Hoxb9 were exclusively up-regulated in the brainstem of Rnf220+/- mice (Figure 1—figure supplement 2C and D). The brainstem comprises the midbrain, pons, and medulla (Figure 1—figure supplement 2E). Further, we confirmed that the up-regulation of Hox genes was restricted to the pons in the Rnf220+/- mice (Figure 1—figure supplement 2F). In addition, RNA sequencing (RNA-seq) analysis of the pons also revealed an overall increase in Hox gene expression in adult Rnf220+/- mice (Figure 1A).

Figure 1. Hox genes up-regulated in pons of Rnf220+/- mice.

(A) The heatmap of RNA sequencing (RNA-seq) data showing Hox genes expression in pons of WT or Rnf220+/- mice (n=2 mice per group). (B–C) Uniform manifold approximation and projection (UMAP) diagram showing 15 identified cell clusters annotated by single-nucleus RNA-seq (snRNA-seq) analysis of pons. Each dot represents a single cell, and cells are laid out to show similarities (n=3 mice per group). Genes in parentheses represent the marker genes of the cell group, while the genes following ‘-’ represent the specific genes of this cell group. (D) Heatmap of snRNA-seq data showing Hox expression changes in each cell cluster. (E) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis showing mRNA levels of indicated Hox genes in P19 cells when endogenous Rnf220 was knocked down by small interfering RNAs (siRNAs) in the presence of RA. WT, wild-type; HE, heterozygote; RA, retinoic acid. **p<0.01, ***p<0.001.

Figure 1.

Figure 1—figure supplement 1. Hox genes exhibited de-repression in hindbrain of Rnf220-/- embryos at late developmental stages.

Figure 1—figure supplement 1.

Heatmap of Hox expression in hindbrain of Rnf220-/- mouse embryos at E16.5 and E15.5. Expression of each Hox gene was analyzed by quantitative real-time polymerase chain reaction (qRT-PCR) against Gapdh. Each Hox gene in wild-type controls was set to 1 (n=2 mice per group). Blank color represents the expression of that Hox is low and exceed detection range. KO, knockout.
Figure 1—figure supplement 2. Hox genes were up-regulated in brainstem of Rnf220+/- mice.

Figure 1—figure supplement 2.

(A) Diagram of central nervous system (CNS) in mice. (B) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of Rnf220 expression in CNS of Rnf220+/- and control mice. (C–D) qRT-PCR analysis of Hoxa9 (C) and Hoxb9 (D) expression in each CNS section of Rnf220+/- and control mouse (n=2 mice per group). (E) Diagram of mouse brainstem. (F) qRT-PCR analysis of mRNA levels of Hoxa9 and Hoxb9 in indicated sections of WT and Rnf220+/- mouse brainstems (n=2 mice per group). WT, wild-type; HE, heterozygote; SC, spinal cord. n.s., not significant; *p<0.05, **p<0.01, ***p<0.001.
Figure 1—figure supplement 3. Expression levels of Hox genes were not affected by Rnf220 knockdown in P19 cell line without RA induction.

Figure 1—figure supplement 3.

(A) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of Rnf220 and indicated Hox genes expression after RA treatment in P19 cells. (B) qRT-PCR analysis of the expression levels of Hoxa1, Hoxb1, Hoxa9, and Hoxb9 in Rnf220 knockdown P19 cells without RA induction. RA, retinoic acid. n.s., not significant; ***p<0.001.

To identify the specific cell populations in which Hox genes were up-regulated, we conducted single-nucleus RNA-seq (snRNA-seq) analysis of the pons of adult wild-type (WT) and Rnf220+/- mice. In total, 125,956 and 122,266 cell transcriptomes with an average of approximately ≥700 genes for the WT and Rnf220+/- mice respectively were further analyzed. 15 cell clusters were identified by uniform manifold approximation and projection (UMAP) in both the WT and Rnf220+/- groups (Figure 1B and C). When we annotate these cell clusters by their uniquely and highly expressed markers (Supplementary file 3), we found that most of the clusters were identified as distinct neuronal groups (cluster_1, 2, 4, 6, 7, 8, 10, 11, 12, and 13), in addition to astrocyte (cluster_5), oligodendrocyte (cluster_3), oligodendrocyte precursor (cluster_14), ependymal cell (cluster_9), and a group not corresponding to any known cell types (cluster_0) (Figure 1B). Then, the Hox gene expression levels for each cell clusters were analyzed and found that up-regulation of Hox genes was most pronounced in three of these clusters (cluster_2, 7, and 10) (Figure 1D), albeit with distinct profiles. Hox7-10 genes were up-regulated genes in cluster_2, while Hox3-5 and Hox1-3 genes were activated in cluster_7 and 10, respectively (Figure 1D). These findings indicate that Hox genes were specifically up-regulated in the pons of Rnf220+/- mice from late developmental stages on.

P19 embryonal carcinoma cells can be induced to differentiate and express Hox genes upon retinoic acid (RA) administration and have been used to study Hox regulation (Vanderheyden and Defize, 2003,Vanderheyden and Defize, 2003; Kondo et al., 1992; Pöpperl and Featherstone, 1993,Pöpperl and Featherstone, 1993; Figure 1—figure supplement 3A). Here, we tested the effects of Rnf220 knockdown on RA-induced Hox gene activation in P19 cells. Rnf220 knockdown further enhanced the activation of many Hox genes, including Hoxa1, Hoxb1, Hoxa9, and Hoxb9, by RA presence (Figure 1E), suggesting a general role of Rnf220 in Hox regulation. Note that Rnf220 knockdown had no clear effect on Hox expression in the absence of RA (Figure 1—figure supplement 3B).

Rnf220 insufficiency disturbs Hox expression pattern and the neuronal circuit formation in the PN

When we refer to the transcriptomic profiles of each cluster in the pons, we found that the cluster_10 likely represents cells derived from rhombomeres 2–5, given their expression of endogenous anterior Hox genes (Hox1-3), while the cluster_7 likely represents cells derived from rhombomeres 6–8, as evidenced by the expression of Hox3-5 (Figure 1D). After mapping known neuron-specific markers to each cluster, PN-specific markers, including Nfib, Pax6, and Barhl1, were enriched in the cluster_7 (Figure 2—figure supplement 1A). The quantitative real-time polymerase chain reaction (qRT-PCR) results showed that compared to WT mice, some PN markers were up-regulated in Rnf220+/- mice (Figure 2—figure supplement 1B). Originating at the posterior rhombic lip and migrating tangentially to their final position in the ventral part of the pons, PN neurons serve as relay cells between the cerebral cortex and cerebellum (Di Meglio et al., 2013; Kratochwil et al., 2017; Maheshwari et al., 2020). The expression pattern of Hox genes is crucial for the migration and the final neuronal circuit formation of the PN neurons (Kratochwil et al., 2017; Maheshwari et al., 2020). We analyzed the expression pattern of the endogenous Hox genes, including Hox3-5, in the PN neurons and the connection between the cortex and the PN neurons in Rnf220+/- mice (Figure 2; Figure 2—figure supplement 1C). The results of RT-PCR assays indicated an up-regulation in Hox4-5 expression levels in the Rnf220+/- PN (Figure 2—figure supplement 1C). In the PN, endogenous Hox3-5 genes exhibit a nested and unique expression pattern along the rostral-caudal axis, with Hox3 ubiquitously expressed throughout the PN, Hox4 localized to the middle and posterior regions, and Hox5 confined to the posterior segment (Kratochwil et al., 2017). Next, the PN was evenly dissected into the rostral, middle, and caudal segments along the rostral-caudal axis and the endogenous expression pattern of Hox genes was examined in each section. The results showed that all the Hox3-5 paralogs were uniformly up-regulated along the rostral-caudal axis in the Rnf220+/- PN (Figure 2A).

Figure 2. Hox gene expression was dysregulated and motor cortex projections were disorganized in pontine nuclei (PN) of Rnf220+/- mice.

(A) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of relative expression levels of Hox3, Hox4, and Hox5 in rostral, middle, and caudal sections of PN in WT and Rnf220+/- mice. Expression level of each gene in rostral section of WT PN was set to 1 (n=5 mice per group). Bar graphs show the relative levels normalized against rostral group in the respective wild-type mice. (B) Diagram of experimental stereotactic injections. (C) Green fluoresce showed the projection from motor cortex to PNs in adult (2 months) WT and Rnf220+/- mice (n=10 in WT group and n=9 in Rnf220+/- group). (D–E) The diameter (D) and area (E) sizes of PN in WT and Rnf220+/- mice. Each data presents the average diameter and area sizes of PN from four consecutive slices for completely presenting circular fluorescence projections. (F) The area of fluorescence projection from motor cortex to PN in WT and Rnf220+/- mice. The sample used for statistics is consistent with the one selected in D–E. Each data represents the average fluorescence area of four consecutive slices. (G) The proportion of projected fluorescence area from motor cortex to PN area. The sample used for statistics is consistent with the one selected in D–E. WT, wild-type; HE, heterozygote. n.s., not significant. **p<0.01.

Figure 2.

Figure 2—figure supplement 1. Hox genes were up-regulated in pontine nuclei (PN) of Rnf220+/- mice.

Figure 2—figure supplement 1.

(A) Heatmap of single-nucleus RNA sequencing (snRNA-seq) data showing expression levels of PN markers (Pax6, Barhl1, Unc5b, and Nfib) among 15 identified cell clusters (n=3 mice per group). (B– C) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of expression levels of indicated PN markers (B) and Hox genes (C) in pons of Rnf220+/- and WT mice (n=3 mice per group). WT, wild-type; HE, heterozygote. n.s., not significant; *p<0.05, ***p<0.001.
Figure 2—figure supplement 2. PN showed no structure difference but disorganized projection pattern from motor cortex between WT and Rnf220+/- mice.

Figure 2—figure supplement 2.

(A) Nissl staining showed the pons structure in adult (2 months) WT and Rnf220+/- mice. Scale bars, 500 μm. (B) DAPI labeling PN structure in adult (2 months) WT and Rnf220+/- mice. Scale bars, 500 μm. (C) Continuous slice of projection from motor cortex to PN in adult (2 months) WT and Rnf220+/- mice. Scale bars, 200 μm. WT, wild-type; HE, heterozygote; PN, pontine nuclei.

There is no difference of structure in PN or even pons between WT and Rnf220+/- mice (Figure 2—figure supplement 2A and B; Figure 2C–E). Considering the motor deficits of Rnf220+/- mice (Ma et al., 2021; Ma et al., 2019), the neuronal circuit between the motor cortex and the PN neurons were traced anterogradely by a non-transneuronal tracing virus (rAAV-hSyn-EGFP-WPRE-hGH-polyA) (Figure 2B). The results showed that fewer PN neurons were targeted by axons from the motor cortex in the Rnf220+/- mice (Figure 2C and F–G; Figure 2—figure supplement 2C). In addition, the projection from the motor cortex was centralized in the PN of Rnf220+/- mice (Figure 2C; Figure 2—figure supplement 2C).

Taken together, both the expression level/pattern of the endogenous Hox genes and the neuronal projection pattern from the motor cortex were disturbed by Rnf220 insufficiency in the mouse PN.

RNF220 targets WDR5 for K48-linked polyubiquitination and degradation

The up-regulation of Hox genes in the Rnf220+/- mice suggested a role for RNF220 in the maintenance of Hox expression pattern. Generally, the Hox expression pattern is maintained epigenetically by the PcG and trxG complexes, which regulate the silencing and activation of Hox genes, respectively (Bahrampour et al., 2019; Chopra et al., 2009; Kang et al., 2022; Papp and Müller, 2006). Indeed, we did observe the local epigenetic modification changes, i.e., the down-regulated H3K27me3 signals and up-regulated H3K4me3 signals, in some Hox cluster in hindbrain of Rnf220+/- mice by ChIP-qPCR assays (Figure 3—figure supplement 1A and B). Therefore, protein levels of the core components of PcG and TrxG complexes in the mouse hindbrain and pons were examined and the results showed that although the protein levels of the core components of PcG we examined were comparable between WT and Rnf220+/-, a clear increase in the protein level of WDR5, a key component of the trxG complex, was observed in the hindbrain of both Rnf220+/-and Rnf220-/- mouse embryos at E18.5 (Figure 3—figure supplement 2A and B; Figure 3A), the phenomenon was also observed at E16.5 (Figure 3B). We next tested the expression of WDR5 in the mouse pons, cortex, and cerebellum at adult and found that the increase in the protein level of WDR5 was only observed in the pons, but not in the cortex or cerebellum, in Rnf220+/- mice (Figure 3C and E; Figure 3—figure supplement 2C and D), which is consistent with the pons-specific up-regulation in Hox genes expression. In addition, the protein level of WDR5 was also enhanced in the PN of Rnf220+/- mice (Figure 3D) and Rnf220 knockdown P19 cells in the presence of RA (Figure 3F).

Figure 3. RNF220 mediates WDR5 degradation.

(A–D) Western blots analysis showing the protein level of WDR5 in the indicated brain tissues of mice with different genotypes at different ages. (E) Western blot analysis showing WDR5 levels in the pons of adult mice with indicated genotypes. (F) Western blot analysis of protein levels of WDR5 in P19 cells with Rnf220 knockdown or not in the presence or absence of RA. IB, immunoblot; WT, wild-type; HE, heterozygote; KO, knockout; PN, pontine nuclei; NC, negative control; RA, retinoic acid.

Figure 3.

Figure 3—figure supplement 1. Repressive epigenetic modification was down-regulated while activated epigenetic modification was up-regulated in promoter regions of indicated Hox genes in hindbrains of Rnf220+/- mice.

Figure 3—figure supplement 1.

(A–B) ChIP-qRT-PCR analysis of repressive epigenetic modification (H3K27me3) (A) and activated epigenetic modification (H3K4me3) (B) levels in promoter regions of indicated Hox genes in hindbrains of Rnf220+/- and WT mice (n=2 mice per group). WT, wild-type; HE, heterozygote. n.s., not significant; *p<0.05, **p<0.01, ***p<0.001.
Figure 3—figure supplement 2. Protein levels of the indicated core components of PRC1 and PRC2 complex in indicated mouse brain tissues of different genotypes.

Figure 3—figure supplement 2.

(A) Western blot analysis of protein levels of core components of PRC1 and PRC2 complexes in hindbrain of WT, Rnf220+/-, and Rnf220-/- mouse embryos at E18.5. (B) Western blot analysis of protein levels of core components of PRC1 and PRC2 complexes in pons of adult Rnf220+/- and WT mice. (C, D) Western blot analysis of protein levels of WDR5 in cerebellum and cortex of adult Rnf220+/- and WT mice. WT, wild-type; HE, heterozygote; KO, knockout; IB, immunoblot.

The above data suggest that WDR5 might be a direct target of RNF220 for polyubiquitination and thus degradation. Indeed, in HEK293 cells transiently co-transfected with FLAG-tagged RNF220 and myc-tagged WDR5, WDR5 co-immunoprecipitated with RNF220 (Figure 4A). In the reverse experiment, RNF220 also co-immunoprecipitated with WDR5 (Figure 4B). Furthermore, in the brainstem, when WDR5 was immunoprecipitated using an anti-WDR5 antibody, endogenous RNF220 was also detected in the immunoprecipitate. Then we examined if the WDR5 protein level was regulated by RNF220. The results showed that co-expression of WT RNF220, but not the ligase-dead mutant (W539A) or the RING domain deletion (△Ring) form, clearly reduced the protein level of WDR5 in HEK293 cells (Figure 4D). In addition, the reduction in the protein level of WDR5 by RNF220 overexpression was blocked by MG132, suggesting a role for the proteasome in this regulation (Figure 4E).

Figure 4. RNF220 interacts with and targets WDR5 for K48-linked polyubiquitination.

(A–B) Co-immunoprecipitation (co-IP) analysis of interactions between RNF220 and WDR5 in HEK293 cells. HEK293 cells were transfected with indicated plasmids and harvested after 48 hr. Cell lysates were immunoprecipitated with anti-FLAG beads. Whole-cell lysate and immunoprecipitates were subjected to western blot analysis using indicated antibodies. (C) Endogenous co-immunoprecipitation analysis showing the interaction between RNF220 and WDR5 in hindbrains of WT mice. (D) Western blots analysis shows the protein level of WDR5 when co-expressed with wild-type or mutated RNF220 in HEK293 cells. (E) Western blots analysis shows the protein level of WDR5 when co-expressed with RNF220 in HEK293 cells in the presence of MG132 (10 mM) or not. (F) In vivo ubiquitination assays showing the ubiquitination status of WDR5 when co-expressed with WT or mutated RNF220 in HEK293 cells. (G) In vivo ubiquitination assays showing the ubiquitination status of WDR5 in hindbrains of WT and Rnf220+/- mice. (H) In vivo ubiquitination assays showing RNF220-induced polyubiquitination of WDR5 when the indicated ubiquitin mutations were used in HEK293 cells. (I) In vivo ubiquitination assays showing the ubiquitination status of the indicated WDR5 mutants when co-expressed with WT or ligase-dead RNF220 in HEK293 cells. WT, wild-type; HE, heterozygote; KO, knockout; IB, immunoblot; IP, immunoprecipitation; UB, ubiquitin; WCL, whole-cell lysate; △Ring, RNF220 Ring domain deletion; W539R, RNF220 ligase dead mutation; K48, ubiquitin with all lysines except the K48 mutated to arginine; K48R, ubiquitin with the K48 was substituted by an arginine; 3KR, substitution of lysines at the positions of 109, 112, and 120 in WDR5 with arginines simultaneously.

Figure 4.

Figure 4—figure supplement 1. RNF220 interacted with and targeted WDR5 for polyubiquitination at multiple lysine sites.

Figure 4—figure supplement 1.

(A) Western blot analysis of the levels of three WDR5 truncated proteins in HEK293 cells when co-transfected with RNF220 or not. (B) In vivo ubiquitination analysis of ubiquitination status of indicated WDR5 KR mutants when co-expressed with RNF220 or not in HEK293 cells. IB, immunoblot; IP, immunoprecipitation; WCL, whole-cell lysate; K31R, K52R, K109R, K112R, K120R, K123R, or K126R, substitution of lysine with arginine in WDR5 at indicated positions.

We further carried out polyubiquitination assays to examine if WDR5 may be a target for RNF220. It was found that co-expression of RNF220 strongly enhanced the polyubiquitination of WDR5 protein, and this regulation depends on the E3 ubiquitin ligase activity of RNF220 because RNF220△Ring failed to promote the polyubiquitination of WDR5 (Figure 4F). Moreover, when the endogenous WDR5 protein was immunoprecipitated from the mouse pons, its polyubiquitination level in Rnf220+/- mice was markedly decreased compared to WT mice (Figure 4G).

Different types of ubiquitination linkages have distinct regulatory effects on the stability or activity of protein targets, and K48-linked polyubiquitination usually leads to proteasomal degradation of protein targets (Grice and Nathan, 2016,Grice and Nathan, 2016.). Indeed, WDR5 were only ubiquitinated by RNF220 when K48-type ubiquitin was present (Figure 4H). Consistent with this, when the K48R mutated ubiquitin was co-expressed, the RNF220-induced polyubiquitination level of WDR5 protein was fully diminished (Figure 4H). To determine the exact lysines ubiquitinated by RNF220, we first tested the effects of RNF220 on the stability of different WDR5 truncates and found that the truncate remaining 1-127aa was enough to be degraded by RNF220, suggesting the corresponding lysines were included in this region (Figure 4—figure supplement 1A). We individually mutated all these conserved lysines into arginines and then examined RNF220-mediated ubiquitination of each mutant. It was found that K109, K112, and K120 were required for the polyubiquitination of WDR5 (Figure 4—figure supplement 1B). Furthermore, when these lysine residues were simultaneously mutated into arginines, RNF220 failed to enhance the polyubiquitination levels of the resulted WDR5-3KR mutants (Figure 4I), suggesting that these lysine residues are direct ubiquitination sites. Together, these results indicate that RNF220 regulates WDR5 ubiquitination by adding K48-linked polyubiquitin chains at the lysine sites of K109, K112, and K120.

The maintenance of Hox expression by RNF220 depends on its regulation to WDR5

To investigate the requirement of the RNF220-mediated regulation to WDR5 in Hox expression maintenance by RNF220, we first examined whether Wdr5 knockdown could mitigate the impact of Rnf220 knockdown on Hox expression in P19 cells in the presence of RA. It is observed that the stimulation of Hox genes by Rnf220 knockdown was significantly reduced when Wdr5 was knocked down simultaneously by small interfering RNAs (siRNAs) in the presence of RA (Figure 5A–C). Note that the expression levels of Hox genes showed no clear changes when without RA or only Wdr5 was knocked down in P19 cells (Figure 5—figure supplement 1A and B).

Figure 5. WDR5 recovered Rnf220 deficiency-induced up-regulation of Hox genes in P19 cell line.

(A–B) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis showing the expression levels of Rnf220 (A) and Wdr5 (B) when transfected the indicated combinations of small interfering RNAs (siRNAs) against Rnf220 or Wdr5 in the presence or absence of RA. Bar graphs show the relative levels normalized against control group without siRNA or RA treatment. (C) qRT-PCR analysis showing the expression levels of Hoxa1, Hoxb1, Hoxa9, Hoxb9 when siRnf220, together with siWDR5 or not, were transfected in P19 cells treated with RA. RA, retinoic acid. n.s., not significant; ***p<0.001.

Figure 5.

Figure 5—figure supplement 1. Wdr5 knockdown had no effect on Hox genes expression in P19 cells in the presence of RA or not.

Figure 5—figure supplement 1.

(A) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis showing the expression levels of Hoxa1, Hoxb1, Hoxa9, Hoxb9 when transfected siRnf220 or both siRnf220 and siWdr5 without RA treatment. (B) qRT-PCR analysis of mRNA levels of Wdr5, Hoxa1, Hoxb1, Hoxa9, and Hoxb9 when Wdr5 was knocked down by small interfering RNA (siRNA) transfection in P19 cells with or without RA treatment. Bar graphs show the relative levels normalized against control group without siRNA or RA treatment. RA, retinoic acid. n.s., not significant; *p<0.05.

Using in utero microinjection, we tested the effects of WDR5 inhibition by WDR5-IN-4, an established WDR5 inhibitor (Aho et al., 2019), on the up-regulation of Hox genes in hindbrains of the Rnf220+/- mice at late embryonic stages (Figure 6A). It was found that the up-regulation of Hox3-5 genes in the hindbrain of the Rnf220+/- embryos was largely reversed by WDR5-IN-4 (Figure 6C). Notably, we found that WDR5-IN-4 injection had no effect on the endogenous Rnf220 expression in the hindbrain (Figure 6B). Last, the effect of genetic ablation of Wdr5 in neural system on the up-regulation of Hox genes in RNF220 hypoinsufficient mice was examined. Considering Wdr5+/- mice is embryonic lethal, and the up-regulation of Hox genes could also be observed in the hindbrains of Rnf220fl/wt;Nestin-Cre mice, we used Rnf220 fl/wt;Nestin-Cre and Wdr5fl/wt mice to generate WT, Rnf220fl/wt;Nestin-Cre, Wdr5fl/wt;Nestin-Cre, and Rnf220fl/wt;Wdr5fl/wt;Nestin-Cre mice (Figure 6D). It was found that the up-regulation of Hox3-5 genes in the pons of Rnf220fl/wt;Nestin-Cre mice were markedly recovered by Wdr5 genetic ablation in Rnf220fl/wt;Wdr5fl/wt;Nestin-Cre mice (Figure 6E). ChIP-qPCR also showed the local epigenetic modification changes in some Hox cluster, with H3K27me3 up-regulated and H3K4me3 down-regulated in Rnf220 and Wdr5 double knockdown P19 cell line related to Rnf220 single knockdown P19 cell line in the presence of RA (Figure 6—figure supplement 1).

Figure 6. Genetic and pharmacological ablation of WDR5 recovered Rnf220 deficiency-induced up-regulation of Hox genes.

(A) Diagram of experimental strategy for in utero local injection of WDR5 inhibitors. (B–C) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of expression levels of Rnf220 (B), Hox3-Hox5 (C) in hindbrains of WT and Rnf220+/- mouse embryos treated with WDR5 inhibitors or not at E18.5 (n=3 mice per group). Actin was used as the internal controls (C). Heatmap of Hox expression showed the relative levels normalized against WT group. (D–E) qRT-PCR analysis of expression levels of Rnf220 (D), Wdr5 (D), Hox3-Hox5 (E) in pons of P15 mice with indicated genotypes (n=2 mice per group). Gapdh was used as the internal controls (E). Heatmap of Hox expression showed the relative levels normalized against WT group. WT, wild-type; HE, heterozygote.

Figure 6.

Figure 6—figure supplement 1. Rnf220 and Wdr5 co-suppression recovered Hox epigenetic modification to a certain degree.

Figure 6—figure supplement 1.

(A–B) ChIP-qRT-PCR analysis of repressive epigenetic modification (H3K27me3) (A) and activated epigenetic modification (H3K4me3) (B) levels in promoter regions of indicated Hox genes in P19 cell line transfected with siRnf220 or both siRnf220 and siWdr5. n.s., not significant; *p<0.05, **p<0.01.

Taken together, Rnf220 dificiency induces the up-regulation of Hox genes in the mouse hindbrain and thus a defects in cortex-PN nueronal circuits. Mechanistically, we found that RNF220 regulates the protein stability of WDR5 via ubiquitination in the mouse hindbrain. WDR5 conditional knockdown or functional inhibition reversed the up-regulation of Hox genes expression in Rnf220 deficient mice. The above findings support the involvement of WDR5 regulation by RNF220 in the maintenance of Hox expression pattern in the mouse hindbrain.

Discussion

During early embryonic development, the Hox genes are collinearly expressed in the hindbrain and spinal cord along the A-P axis to guide regional neuronal identity. Later on, the segmental Hox gene expression pattern in the hindbrain is maintained till at least early postnatal stages. The Hox genes are also expressed in adult hindbrains with restricted anterior boundaries (Philippidou and Dasen, 2013; Miller and Dasen, 2024; Di Bonito et al., 2013). In addition to their roles in progenitor cell specification, cell survival, neuronal migration, axon guidance, and dendrite morphogenesis during early development stages (Smith and Kratsios, 2024), Hox genes also play key roles in the regulation of synapse formation, neuronal terminal identity, and neural circuit assembly at late stages (Feng et al., 2020; Feng et al., 2021; Philippidou and Dasen, 2013). Our study revealed a dose-dependent role of RNF220 and WDR5 in the maintenance of Hox expression in the hindbrain, which might have a functional role in the neural circuit organization of the pons in mice.

In mammals, WDR5, a key component of the COMPASS-related complexes, has been reported to be absolutely required for the regulation of Hox genes expression during mammalian embryo development and cancer progression via different mechanisms (Wysocka et al., 2005; Chen et al., 2021; Yu et al., 2021). Here, we report a WDR5 protein stability controlling mechanism by RNF220-mediated polyubiquitination and illustrate the role of this regulation on the maintenance of Hox genes expression in the mouse hindbrain. The stabilization of WDR5 and stimulation of Hox expression upon RNF220 knockdown was also recapitulated in RA-treated P19 cells, a cellular model for Hox regulation study.

Interestingly, when examined at single cell level, different Hox stimulation profiles were detected in different neuronal groups, so that Hox1-3 were up-regulated in cluster 10, while Hox3-5 and Hox7-10 up-regulation appeared in cluster 7 and cluster 2, respectively (Figure 1D). Clusters 10 and 7 express endogenous Hox1-3 and Hox3-5, respectively. It is reasonable that the expression of these Hox genes is stimulated upon WDR5 elevation due to RNF220 insufficiency. Cluster 2 is most interesting in that, Hox7-10 were up-regulated in these cells which were not expressed in WT hindbrain. This cluster was defined as glycinergic neuron cells by specific Slc6a5 expression. The nature of this group of cells and the phenotypic effect of Hox up-regulation await further analysis. The de-regulation of Hox genes might have wide effect on the development of many nuclei in the pons, including cell differentiation and neural circuit formation. For the PN, we showed here that the patterning and projection pattern from the motor cortex were affected in the Rnf220+/- mice.

The regulation of WDR5 and Hox expression by RNF220 seems to be context dependent and precisely controlled in vivo, depending on the molecular and epigenetic status of the cell. For example, although WDR5 and RNF220 are widely co-expressed in the brain, WDR5 levels are not affected in most regions in the Rnf220+/- brain, including the cortex, cerebellum, etc. (Figure 3—figure supplement 2C and D). This is also true for EED, another epigenetic regulator, which is targeted by RNF220 in the cerebellum, but not in the pons (Ma et al., 2020). In untreated P19 cells, knockdown of RNF220 also has no effect on the stability of endogenous WDR5, although overexpression of RNF220 did reduce WDR5 level in 293T cells. We suggest that RA treatment of P19 cells helps to set up the molecular environment that facilitates Hox expression as well as RNF220-WDR5 interaction.

In summary, our data support WDR5 as a RNF220 target involved in the maintenance of Hox expression and thus development of the pons.

Materials and methods

Mouse strains and genotyping

All procedures involving mice were conducted in accordance with the guidelines of the Animal Care and Use Committee of the Kunming Institute of Zoology, Chinese Academy of Sciences (IACUC-PA-2021-07-018). Mice were housed under standard conditions at a temperature range of 20–22°C, humidity of 30–45%, and 12 hr light/dark cycle. Rnf220 floxed mice (Rnf220fl/fl) were originally 129Sz/SvPasCrl background and mated with C57BL/6 then. Other mice used were maintained on a C57BL/6 background. Vasa-Cre mice were used to mate with Rnf220 floxed mice (Rnf220fl/fl) to generate Rnf220 germ cell knockout (Rnf220-/-) or heterozygote (Rnf220+/-) mice. Nestin-Cre mice were used to mate with Rnf220fl/fl and Wdr5 floxed mice (Wdr5fl/fl) to generate conditional neural specific knockout or heterozygote mice. Rnf220fl/wt;Wdr5fl/wt;Nestin-Cre mice were obtained by crossing Rnf220fl/wt;Nestin-Cre with Wdr5fl/wt mice.

Genotypes were determined by PCR using genome DNA from tail tips as templates. PCR primers were listed as follows: 5’-CTG TTG ATG AAG GTC CTG GTT-3’ and 5’-CAG GAA AAT CAA TAG ACA ACT T-3’ were used to detect Rnf220 floxP carrying. 5’-CTG TTG ATG AAG GTC CTG GTT-3’ and 5’-CTG ATT TCC AGC AAC CTA AA-3’ were used to detect Rnf220 knockout. 5’-GCC TGC ATT ACC GGT CGA TGC-3’ and 5’-CAG GGT GTT ATA AGC AAT CCC-3’ were used for Cre positive detection. 5’-GAA TAA CTA CTT TCC CTC AGA CC-3’ and 5’-CAG GCC AAG TAA CAG GAG GTA G-3’ were used to detect Wdr5 floxP carrying. 5’-GAA TAA CTA CTT TCC CTC AGA CC-3’ and 5’-AGA CCC TGA GTG AGG ATA CAT AA-3’ were used to detect Wdr5 knockout.

Cell culture

The HEK293 cell line was from Conservation Genetics CAS Kunming Cell Bank (KCB 200408YJ) and P19 cell line was a generous gift from Dr. NaiheJing (Shanghai Institute of Biochemistry and Cell Biology, CAS). Both cell lines were verified by STR matching analysis and tested negative for mycoplasma. Both HEK293 and P19 cell lines were grown in Dulbecco’s Modified Eagle Medium (Gibco, C11995500BT) supplemented with 10% fetal bovine serum (FBS) (Biological Industries, 04-001-1A), 100 units/mL penicillin and 100 mg/mL streptomycin (Biological Industries, 03-031-1B). Cell cultures were maintained at 37°C in a humidified incubator with 5% CO2. 0.5 μM RA (Sigma, R2625) was used to induce Hox expression in P19 cells.

To achieve gene overexpression or knockdown, HEK293 and P19 cells were transfected by Lipo2000 (Invitrogen, 11668500) according to the manufacturer’s instructions. The following siRNAs (RiboBio) were used for Rnf220 or Wdr5 knockdown in P19 cells: siG2010160325456075, siG2010160325457167, and siG2010160325458259 were used for Rnf220 knockdown; siB09924171210, siG131113135429, and siG131113135419 were used for Wdr5 knockdown.

Total RNA isolation and qRT-PCR

Tissue and cells were homogenized with 1 mL TRIzol (TIANGEN, DP424), after which 200 μL of chloroform was added to the lysates for phase separation. After centrifugation at 12,000×g for 15 min at 4°C, the aqueous phase (500 μL) was transferred to a new tube and mixed with equal volumes of isopropanol for RNA precipitation. After 30 min, RNA pellets were harvested by centrifugation at 12,000×g for 15 min at 4°C, twice washed with 75% ethanol, and dissolved in DNase/RNase-free water.

cDNA was synthesized with Strand cDNA Synthesis Kit (Thermo Scientific, K1632) according to the manufacturer’s instructions. All reactions were performed at least triplicates with Light Cycler 480 SYBR Green I Master (Roche, 04707516001). Primers used for qRT-PCR are listed in Table 1.

Table 1. Primers used for quantitative real-time polymerase chain reaction (qRT-PCR).

Genes Forward primers Reverse primers
Actin GCCAACCGTGAAAAGATGAC GAGGCATACAGGGACAGCAC
Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
Rnf220 GTCTCAGTAGACAAGGACGTTCACA GGGGTGGAGGTGTAGTAAGGAAG
Wdr5 CGTGACAGGCGGGAAGTGGA CGGGTGACAAGCCGTGGAAAT
Hoxa1 AGCTCTGTGAGCTGCTTGGT AAAAGAAACCCTCCCAAAACA
Hoxa2 TGCCATCAGCTATTTCCAGG GATGAAGGAGAAGAAGGCGG
Hoxa3 TCTTAACATGGAGGGAGCCA TCTGAAGGCTACGTGTGCTG
Hoxa4 ACGCTGTGCCCCAGTATAAG ACCTTGATGGTAGGTGTGGC
Hoxa5 CAGGGTCTGGTAGCGAGTGT CTCAGCCCCAGATCTACCC
Hoxa6 GTCTGGTAGCGCGTGTAGGT CCCTGTTTACCCCTGGATG
Hoxa7 CTTCTCCAGTTCCAGCGTCT AAGCCAGTTTCCGCATCTAC
Hoxa9 GTAAGGGCATCGCTTCTTCC ACAATGCCGAGAATGAGAGC
Hoxa10 TCTTTGCTGTGAGCCAGTTG CTCCAGCCCCTTCAGAAAAC
Hoxa11 CCTTTTCCAAGTCGCAATGT AGGCTCCAGCCTACTGGAAT
Hoxa13 CGGTGTCCATGTACTTGTCG AGCGGCTACTACCCGTGC
Hoxb1 GGTGAAGTTTGTGCGGAGAC TTCGACTGGATGAAGGTCAA
Hoxb2 GAACCAGACTTTGACCTGCC GAGCTGGAGAAGGAGTTCCA
Hoxb3 ATCTGTTTGGTGAGGGTGGA CCGCACCTACCAGTACCACT
Hoxb4 GACCTGCTGGCGAGTGTAG CTGGATGCGCAAAGTTCAC
Hoxb5 CTGGTAGCGAGTATAGGCGG AGGGGCAGACTCCACAGATA
Hoxb6 TAGCGTGTGTAGGTCTGGCG AGCAGAAGTGCTCCACGC
Hoxb7 CTTTCTCCAGCTCCAGGGTC AACTTCCGGATCTACCCCTG
Hoxb8 GAACTCCTTCTCCAGCTCCA CACAGCTCTTTCCCTGGATG
Hoxb9 TCCAGCGTCTGGTATTTGGT GAAGCGAGGACAAAGAGAGG
Hoxb13 TGCCCCTTGCTATAGGGAAT ATTCTGGAAAGCAGCGTTTG
Hoxc4 CTAATTCCAGGACCTGCTGC AAAAATTCACGTTAGCACGGT
Hoxc5 TTCTCGAGTTCCAGGGTCTG ATTTACCCGTGGATGACCAA
Hoxc6 CAGGGTCTGGTACCGAGAGTA TCCAGATTTACCCCTGGATG
Hoxc8 CAAGGTCTGATACCGGCTGT ATCAGAACTCGTCTCCCAGC
Hoxc9 AATCTGTCTCTGTCGGCTCC AGTCTGGGCTCCAAAGTCAC
Hoxc10 ACCTCTTCTTCCTTCCGCTC ACTCCAGTCCAGACACCTCG
Hoxc11 AAATGAAGGCTCCTACGGCG TGTCGAAGAAGCGGTCGAAA
Hoxc12 AATACGGCTTGCGCTTCTT GACCCTGGCTCTCTGGTTTC
Hoxc13 CTCACTTCGGGCTGTAGAGG TCAGGTGTACTGCTCCAAGG
Hoxd1 TCTGTCAGTTGCTTGGTGCT TGAAAGTGAAGAGGAACGCC
Hoxd3 ACCAGCTGAGCACTCGTGTA AGAACAGCTGTGCCACTTCA
Hoxd4 CTCCCTGGGCTGAGACTGT CCCTGGGAACCACTGTTCT
Hoxd8 GCCCGCGAAGTTTTACGGAT TAAGTGGTCTGGGTCCTCGC
Hoxd9 TTGTTTGGGTCAAGTTGCTG CTCAGCTTGCAGCGATCA
Hoxd10 TCTCCTGCACTTCGGGAC GGAGCCCACTAAAGTCTCCC
Hoxd11 AGTGAGGTTGAGCATCCGAG ACACCAAGTACCAGATCCGC
Hoxd12 TGCTTTGTGTAGGGTTTCCTCT CTTCACTGCCCGACGGTA
Hoxd13 TGGTGTAAGGCACCCTTTTC CCCATTTTTGGAAATCATCC
Unc5b CGTGACAGGCGGGAAGTGGA CGGGTGACAAGCCGTGGAAAT
Pax6 AGACAACAACAAAGCGGACT CTTCGCAAATGACAACTGAC
Barhl1 TACCAGAACCGCAGGACTAAAT AGAAATAAGGCGACGGGAACAT
Nfib AGAAGCCCGAAATCAAGCAG CCAGTCACGGTAAGCACAAA
Neph2 ACAAGGTTCGGAAATGAAGTCG GTTGCCATTAGGACGAGGAA

ChIP-qPCR

P19 cells or grinded mouse PN tissues were cross-linked with 1% formaldehyde for 25 min, and stopped with addition of glycine. After gentle centrifuging, samples were collected and lysed with ChIP lysis buffer (150 mM NaCl, 25  mM Tris, pH 7.5, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate, and complete protease inhibitor cocktail) for 30 min on ice. Genomic DNA was sheared into 200–500 bp fragments by sonication. After centrifugation, the supernatants containing chromatin fragments were collected and immunoprecipitated with anti-IgG (2 μg, ProteinTech, B900610), anti-H3K27me3 (2 μg, Abcam, ab192985, RRID: AB_2650559), or anti-H3K4me3 antibodies (2 μg, Abcam, ab8580, RRID: AB_306649) at 4°C overnight. Then, the immunoprecipitates coupled with protein A/G agarose beads (Santa Cruz, sc-2003) were washed sequentially by a low salt washing buffer, high salt washing buffer, LiCl washing buffer, and TE buffer. The immunoprecipitated chromatin fragments were eluted by 500 μL elution buffer for reversal of cross-linking at 65°C overnight. Input or immunoprecipitated genomic DNA was purified by the QIAquick PCR Purification Kit (QIAGEN, 28104) and used as a template for quantification PCR. The primers we used were listed in Table 2.

Table 2. Primers used for ChIP-qPCR.

Genes Forward primers Reverse primers
Hoxa1 GCAGGACAAGGTTGATGGG GCAGGTGGGAGGGACAGAT
Hoxa3 GGACAGACTCGGTGGTAAGA AGTTCATGTTCACGGTTCCTAT
Hoxa9 GCAGGAAACACTTTGCCAGA GCCCGAGTTAGGACCCGTA
Hoxa10 CTCCTTGCCTCCTTCTTCC CCTGGGTATCTGAGCATCTAA
Hoxb3 CCGAGGACGGACCGAAGAT CCCTGAACTGGACCACCAT
Hoxb4 GAAGAACGCACGGAAAGTAAG GGGAAAGAATATGAGCGGAGT
Hoxb7 CCTTAGGGACGCCTTGGTC ACGCAGGGATTGAATGTTCG
Hoxb8 GCCATTGAATTTCTATCCCAC GGTGAGGCAAGCTAAAGCAG
Hoxc6 CTTCTCCTCTGCCCTCTTC GTTAGTTAATACATGGACCTCT
Hoxc8 GTCGTGGATTGATGAACGCG TCTGCTCACTGTCGGTAGG
Hoxc9 TGTGCCTTGAGTCACTTTGC CTTGCTCCACTTCTCCAGAT
Hoxc10 TTTTCTTTGGGTCCTCGTAAA AGTCTAGGGAGCCATTTGTC
Hoxd3 TTTTCCGAGTCCTATTGCTTG CTGTATCATCTGCCCTCTATC
Hoxd8 AGGACTTTGATTCGCTTTGATA CGAGGTTGACGGATTGATTG
Hoxd9 AACCTACCCTCGGAGATGC GCACTGGAGTCCCAAGGAG
Hoxd10 GGAGGGATGTTTCCGAACT CACATACCCAGGCAGAACG

In utero microinjection

Pregnant mice were administered isoflurane for deep anesthesia. Following this, a laparotomy was performed to carefully extract the embryos, which were then placed on a sterile surgical drape. WDR5-IN-4 (100 μg, MedChemExpress, HY-111753A), containing 0.05% Malachite Green reagent for tracing, was injected into the hindbrain of E15.5 embryos using a finely tapered borosilicate needle. To minimize the risk of spontaneous abortion, injections were spaced for the selected embryos. Following the injections, the uterus was returned to the abdominal cavity and infused with 2 mL of 37°C, 0.9% saline solution. The peritoneum and abdominal skin were then sutured. Finally, the mice were placed on a heating pad to facilitate recovery from anesthesia.

Ubiquitination assay, immunoprecipitation, and western blot analysis

In vivo ubiquitination, immunoprecipitation, and western blot assays were carried out as previously described (Ma et al., 2014). HEK293 cells were transfected in six-well plates, and at 48 hr post transfection cells were lysed in 500 μL of lysis buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 5 mM EDTA [pH 8.0], and 1% Triton X-100) that contained a protease inhibitor mixture (Roche Applied Science) for 30 min on ice; mouse tissues were fully grinded and lysed with RIPA Strong Lysis (Beyotime, P0013B) containing a protease inhibitor mixture for 30 min on ice. Following centrifugation at 12,000 rpm for 10 min at 4°C, 50 μL supernatant was mixed with loading buffer and incubate boiled at 95°C for 5 min, the remaining supernatant was coated with antibody and A/G agarose beads (or FLAG beads) overnight. After washing five times, the bound proteins were eluted with SDS loading buffer at 95°C for 5 min. Final total lysates and immunoprecipitates were subjected to SDS-PAGE and western blot analysis. The following primary antibodies were used for botting: anti-RNF220 (Sigma-Aldrich, HPA027578, RRID: AB_10601482), anti-WDR5 (D9E11) (Cell Signaling Technology, 13105, RRID: AB_2620133), anti-RING1B (D22F2) (Cell Signaling Technology, 5694S, RRID: AB_10705604), anti-SIN3B (AK-12) (Santa Cruz, sc-768, RRID: AB_2187787), anti-EZH2 (ProteinTech, 21800-1-AP, RRID: AB_10858790), anti-SUZ12 (Bethyl, A302-407A, RRID: AB_1907290), anti-RYBP (A-1) (Santa Cruz, sc-374235, RRID: AB_10989572), anti-CBX6 (H-1) (Santa Cruz, sc-393040, RRID: AB_2923357), anti-CBX7 (G-3) (Santa Cruz; sc-376274, RRID: AB_10989202), anti-CBX8 (C-3) (Santa Cruz, sc-374332, RRID: AB_10990104), anti-PHC1 (D-10) (Santa Cruz, sc-390880), anti-α-Tubulin (ProteinTech, 66031-1-Ig, RRID: AB_11042766), anti-FLAG (Sigma-Aldrich; F-7425, RRID: AB_439687), anti-myc (ProteinTech; 16286-1-AP, RRID: AB_1182162), and anti-Ub (P4D1) (Santa Cruz, sc-2007, RRID: AB_631740).

snRNA-seq library preparation, sequencing, and data analysis

snRNA-seq libraries were prepared using the Split-seq platform (Butler et al., 2018; Rosenberg et al., 2018). Freshly harvested mouse pons tissues underwent nuclear extraction following previously described protocols (Butler et al., 2018; Rosenberg et al., 2018). In brief, mouse brain tissues were transferred into a 2 mL Dounce homogenizer containing 1 mL homogenizing buffer (250 mM sucrose, 25 mM KCl, 5 mM MgCl2, and 10 mM Tris-HCl [pH = 8.0], 1 mM DTT, RNase Inhibitor, and 0.1% Triton X-100). The mixture was subjected to five strokes with a loose pestle, followed by 10 strokes with a tight pestle. The resulting homogenates were filtered through a 40 μm strainer into 5 mL Eppendorf tubes and subsequently centrifuged for 4 min at 600×g and 4°C. The pellet was re-suspended and washed in 1 mL of PBS containing RNase inhibitors and 0.1% BSA. The nuclei were again filtered through a 40 μm strainer and quantified. These nuclei were partitioned into 48 wells, each of which contained a barcoded, well-specified reverse transcription primer, to enable in-nuclear reverse transcription. Subsequent second and third barcoding steps were carried out through ligation reactions. After the third round of barcoding, the nuclei were divided into 16 aliquots and lysed prior to cDNA purification. The resulting purified cDNA was subjected to template switching and qRT-PCR amplification, which was halted at the beginning of the plateau stage. Finally, the purified PCR products (600 pg) were used to generate Illumina-compatible sequencing libraries. Distinct, indexed PCR primer pairs were employed to label each library, serving as the fourth barcode.

The libraries underwent sequencing on the NextSeq system (Illumina) using 150-nucleotide kits and paired-end sequencing protocols. In this arrangement, Read 1 covered the transcript sequences and Read 2 contained the UMI and UBC barcode combinations. Initially, a six-nucleotide sequencing index, serving as the fourth barcode, was appended to the ends of Read 2. Subsequently, reads with more than one mismatching base in the third barcode were excluded from the dataset. Furthermore, reads containing more than one low-quality base (Phred score≤10) within the UMI region were also discarded. The sequencing results were aligned to exons and introns in the reference genome (Genome assembly GRCm38) and aggregated intron and exon counts at the gene level were calculated by kallisto and bustools software as described (https://bustools.github.io/BUS_notebooks_R).

Following export of the matrix, quality control measures were performed to remove low-quality cells and potential doublets, as described previously (Rosenberg et al., 2018). After filtering, a total of 125,956 and 122,266 cells for WT and Rnf220+/- pons respectively remained for subsequent analysis. Seurat v2 (Butler et al., 2018.) was used to identify HVGs within each group. Principal component analysis and UMAP were performed to embed each cell from the reduced principal component space on a 2D map. Then clustering of cell populations and identification of differentially expressed genes (DEGs) were carried out as previously described (Ma and Mao, 2022b). We annotated the embryonic cell populations and lineages based on their DEGs (Supplementary file 3).

Mouse brain stereotactic injection and neuronal tracing

Mouse brain stereotactic injection and neuronal tracing were carried out as previously described with minor modifications (Xu et al., 2021). Adult mice (2–3 months of age) were used for anterograde monosynaptic neuronal tracing. The mice were first deeply anesthetized with isoflurane and placed into a stereotactic apparatus with the front teeth latched onto the anterior clamp. The mouth and nose of the mice were covered with a mask to provide isoflurane and keep them in an anesthetic state during the operation. The head was adjusted and maintained in horizontal by inserting ear bars into the ear canal. The hair of the head was shaved with an electric razor and cleaned using a cotton swab which was dipped in 75% alcohol. Cut the scalp along the midline with surgical scissors and make sure the bregma, lambda, and the interaural line were exposed. The intersection between the lambda and interaural line was set to zero. The coordinates ±1.75, –4.9, −1.65 were applied for motor cortex localization. Each mouse received a single injection of 500 nL of rAAV-hSyn-EGFP-WPRE-hGH-poly A (Brainvta, PT-1990) viral fluid in the hemisphere. After the injection, mice were bred for another 3 weeks for neuronal tracing before their brains were harvested for analysis.

Slice preparation

Mice subjected to stereotactic injection were euthanized, and whole brains were collected for the preparation of frozen sections. Following fixation in 4% paraformaldehyde (diluted in PBS) for 48 hr, the brains were successively treated with 20% sucrose (diluted in PBS) for 48 hr and 30% sucrose for 24 hr. Brain tissues were then embedded in optimal cutting temperature compound (SAKURA, 4583) at −20°C and sliced along the sagittal plane at a thickness of 40 μm.

Quantification and statistical analysis

PN and fluorescence length and area were statistically analyzed by ImageJ software (National Institute of Health). Statistical analyses were performed using GraphPad Prism software (GraphPad Software Inc, La Jolla, CA, USA). All experiments were repeated at least two times. Comparisons were performed using the two-tailed Student’s t-test. p-Values of less than 0.05 were considered statistically significant (*), 0.01 were considered statistically significant (**), and 0.001 were considered statistically significant (***).

Acknowledgements

We are grateful to all members of the Mao and Zhang laboratories for discussion of and comments on the manuscript. We would like to thank the Core Technology Facility of Kunming Institute of Zoology (KIZ), Chinese Academy of Sciences (CAS) for providing us with service.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Shihua Zhang, Email: zsh@amss.ac.cn.

Bingyu Mao, Email: mao@mail.kiz.ac.cn.

Pengcheng Ma, Email: kunmapch@mail.kiz.ac.cn.

Paschalis Kratsios, University of Chicago, United States.

Claude Desplan, New York University, United States.

Funding Information

This paper was supported by the following grants:

  • National Key R&D Program of China 2021YFF0702700 to Bingyu Mao.

  • Yunnan Fundamental Research Projects 202101AU070137 to Huishan Wang.

  • National Natural Science Foundation of China 8240055266 to Huishan Wang.

  • National Natural Science Foundation of China 32170965 to Pengcheng Ma.

  • Yunnan Fundamental Research Projects 202205AC160065 to Pengcheng Ma.

  • Yunnan Fundamental Research Projects 202201AW070009 to Pengcheng Ma.

  • Yunnan Fundamental Research Projects 202301AS070059 to Pengcheng Ma.

  • Yunnan Fundamental Research Projects 202401AT070187 to Huishan Wang.

Additional information

Competing interests

No competing interests declared.

Author contributions

Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft.

Data curation, Software, Formal analysis, Visualization, Methodology.

Validation, Investigation, Visualization.

Investigation, Visualization, Methodology.

Investigation, Methodology.

Visualization.

Conceptualization.

Data curation, Software, Formal analysis.

Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Visualization, Project administration, Writing – review and editing.

Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Visualization, Project administration, Writing – review and editing.

Ethics

This study was performed in strict accordance with the recommendations in the Animal Care and Use Committee of the Kunming Institute of Zoology, Chinese Academy of Sciences. All of the animals were handled according to Animal Care and Use Committee of the Kunming Institute of Zoology, Chinese Academy of Sciences (Permit Number: IACUC-PA-2021-07-018). All surgery was performed under sodium pentobarbital or isoflurane, and every effort was made to minimize suffering.

Additional files

Supplementary file 1. Differently expressed genes identified using microarray between wild-type (WT) and Rnf220+/- mice.

Whole-mount brain from E18.5 mice were used (n=2 in WT group and n=3 in Rnf220+/- group).

elife-94657-supp1.docx (23.2KB, docx)
Supplementary file 2. Differently expressed genes identified using microarray between wild-type (WT) and Rnf220-/- mice.

Whole-mount brain from E18.5 mice were used (n=2 in WT group and n=3 in Rnf220-/- group).

elife-94657-supp2.docx (22.4KB, docx)
Supplementary file 3. Uniquely and highly expressed genes of each cluster in single-nucleus RNA sequencing (snRNA-seq).

The pons from 2 months’ mice were used (n=3 mice per group).

elife-94657-supp3.docx (106.7KB, docx)
MDAR checklist

Data availability

All the snRNA-seq and RNA-seq raw data have been deposited in the GSA (https://ngdc.cncb.ac.cn/gsa/) with accession number is CRA013111.

The following dataset was generated:

Huishan W. 2024. Hindbrain pattern maintenance in mouse. Genome Sequence Archive. CRA013111

References

  1. Aho ER, Wang J, Gogliotti RD, Howard GC, Phan J, Acharya P, Macdonald JD, Cheng K, Lorey SL, Lu B, Wenzel S, Foshage AM, Alvarado J, Wang F, Shaw JG, Zhao B, Weissmiller AM, Thomas LR, Vakoc CR, Hall MD, Hiebert SW, Liu Q, Stauffer SR, Fesik SW, Tansey WP. Displacement of WDR5 from chromatin by a WIN Site Inhibitor with picomolar affinity. Cell Reports. 2019;26:2916–2928. doi: 10.1016/j.celrep.2019.02.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bahrampour S, Jonsson C, Thor S. Brain expansion promoted by polycomb-mediated anterior enhancement of a neural stem cell proliferation program. PLOS Biology. 2019;17:e3000163. doi: 10.1371/journal.pbio.3000163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barsh GR, Isabella AJ, Moens CB. Vagus motor neuron topographic map determined by parallel mechanisms of hox5 expression and time of axon initiation. Current Biology. 2017;27:3812–3825. doi: 10.1016/j.cub.2017.11.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nature Biotechnology. 2018;36:411–420. doi: 10.1038/nbt.4096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cenik BK, Shilatifard A. COMPASS and SWI/SNF complexes in development and disease. Nature Reviews. Genetics. 2021;22:38–58. doi: 10.1038/s41576-020-0278-0. [DOI] [PubMed] [Google Scholar]
  6. Chen W, Chen X, Li D, Zhou J, Jiang Z, You Q, Guo X. Discovery of DDO-2213 as a potent and orally bioavailable inhibitor of the wdr5-mixed lineage leukemia 1 protein-protein interaction for the treatment of mll fusion leukemia. Journal of Medicinal Chemistry. 2021;64:8221–8245. doi: 10.1021/acs.jmedchem.1c00091. [DOI] [PubMed] [Google Scholar]
  7. Chopra VS, Hong JW, Levine M. Regulation of Hox gene activity by transcriptional elongation in Drosophila. Current Biology. 2009;19:688–693. doi: 10.1016/j.cub.2009.02.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Di Bonito M, Glover JC, Studer M. Hox genes and region-specific sensorimotor circuit formation in the hindbrain and spinal cord. Developmental Dynamics. 2013;242:1348–1368. doi: 10.1002/dvdy.24055. [DOI] [PubMed] [Google Scholar]
  9. Di Meglio T, Kratochwil CF, Vilain N, Loche A, Vitobello A, Yonehara K, Hrycaj SM, Roska B, Peters A, Eichmann A, Wellik D, Ducret S, Rijli FM. Ezh2 orchestrates topographic migration and connectivity of mouse precerebellar neurons. Science. 2013;339:204–207. doi: 10.1126/science.1229326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Farago AF, Awatramani RB, Dymecki SM. Assembly of the brainstem cochlear nuclear complex is revealed by intersectional and subtractive genetic fate maps. Neuron. 2006;50:205–218. doi: 10.1016/j.neuron.2006.03.014. [DOI] [PubMed] [Google Scholar]
  11. Feng W, Li Y, Dao P, Aburas J, Islam P, Elbaz B, Kolarzyk A, Brown AE, Kratsios P. A terminal selector prevents A Hox transcriptional switch to safeguard motor neuron identity throughout life. eLife. 2020;9:e50065. doi: 10.7554/eLife.50065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Feng W, Li Y, Kratsios P. Emerging roles for hox proteins in the last steps of neuronal development in worms, flies, and mice. Frontiers in Neuroscience. 2021;15:801791. doi: 10.3389/fnins.2021.801791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Frank D, Sela-Donenfeld D. Hindbrain induction and patterning during early vertebrate development. Cellular and Molecular Life Sciences. 2019;76:941–960. doi: 10.1007/s00018-018-2974-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fu Z, Chen C, Zhou Q, Wang Y, Zhao Y, Zhao X, Li W, Zheng S, Ye H, Wang L, He Z, Lin Q, Li Z, Chen R. LncRNA HOTTIP modulates cancer stem cell properties in human pancreatic cancer by regulating HOXA9. Cancer Letters. 2017;410:68–81. doi: 10.1016/j.canlet.2017.09.019. [DOI] [PubMed] [Google Scholar]
  15. Geisen MJ, Di Meglio T, Pasqualetti M, Ducret S, Brunet JF, Chedotal A, Rijli FM. Hox paralog group 2 genes control the migration of mouse pontine neurons through slit-robo signaling. PLOS Biology. 2008;6:e142. doi: 10.1371/journal.pbio.0060142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ghosh P, Sagerström CG. Developing roles for hox proteins in hindbrain gene regulatory networks. The International Journal of Developmental Biology. 2018;62:767–774. doi: 10.1387/ijdb.180141cs. [DOI] [PubMed] [Google Scholar]
  17. Grice GL, Nathan JA. The recognition of ubiquitinated proteins by the proteasome. Cellular and Molecular Life Sciences. 2016;73:3497–3506. doi: 10.1007/s00018-016-2255-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hockman D, Chong-Morrison V, Green SA, Gavriouchkina D, Candido-Ferreira I, Ling ITC, Williams RM, Amemiya CT, Smith JJ, Bronner ME, Sauka-Spengler T. A genome-wide assessment of the ancestral neural crest gene regulatory network. Nature Communications. 2019;10:4689. doi: 10.1038/s41467-019-12687-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jambhekar A, Dhall A, Shi Y. Roles and regulation of histone methylation in animal development. Nature Reviews. Molecular Cell Biology. 2019;20:625–641. doi: 10.1038/s41580-019-0151-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kang H, Cabrera JR, Zee BM, Kang HA, Jobe JM, Hegarty MB, Barry AE, Glotov A, Schwartz YB, Kuroda MI. Variant polycomb complexes in Drosophila consistent with ancient functional diversity. Science Advances. 2022;8:eadd0103. doi: 10.1126/sciadv.add0103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kim J, Choi TI, Park S, Kim MH, Kim CH, Lee S. Rnf220 cooperates withZc4h2to specify spinal progenitor domains. Development. 2018;1:dev165340. doi: 10.1242/dev.165340. [DOI] [PubMed] [Google Scholar]
  22. Kondo T, Takahashi N, Muramatsu M. The regulation of the murine Hox-2.5 gene expression during cell differentiation. Nucleic Acids Research. 1992;20:5729–5735. doi: 10.1093/nar/20.21.5729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kong Q, Zeng W, Wu J, Hu W, Li C, Mao B. RNF220, an E3 ubiquitin ligase that targets Sin3B for ubiquitination. Biochemical and Biophysical Research Communications. 2010;393:708–713. doi: 10.1016/j.bbrc.2010.02.066. [DOI] [PubMed] [Google Scholar]
  24. Kratochwil CF, Maheshwari U, Rijli FM. The long journey of pontine nuclei neurons: from rhombic lip to cortico-ponto-cerebellar circuitry. Frontiers in Neural Circuits. 2017;11:33. doi: 10.3389/fncir.2017.00033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lizen B, Hutlet B, Bissen D, Sauvegarde D, Hermant M, Ahn MT, Gofflot F. HOXA5 localization in postnatal and adult mouse brain is suggestive of regulatory roles in postmitotic neurons. The Journal of Comparative Neurology. 2017;525:1155–1175. doi: 10.1002/cne.24123. [DOI] [PubMed] [Google Scholar]
  26. Ma P, Yang X, Kong Q, Li C, Yang S, Li Y, Mao B. The ubiquitin ligase RNF220 enhances canonical Wnt signaling through USP7-mediated deubiquitination of β-catenin. Molecular and Cellular Biology. 2014;34:4355–4366. doi: 10.1128/MCB.00731-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ma P, Song NN, Li Y, Zhang Q, Zhang L, Zhang L, Kong Q, Ma L, Yang X, Ren B, Li C, Zhao X, Li Y, Xu Y, Gao X, Ding YQ, Mao B. Fine-tuning of shh/gli signaling gradient by non-proteolytic ubiquitination during neural patterning. Cell Reports. 2019;28:541–553. doi: 10.1016/j.celrep.2019.06.017. [DOI] [PubMed] [Google Scholar]
  28. Ma P, An T, Zhu L, Zhang L, Wang H, Ren B, Sun B, Zhou X, Li Y, Mao B. RNF220 is required for cerebellum development and regulates medulloblastoma progression through epigenetic modulation of Shh signaling. Development. 2020;147:dev188078. doi: 10.1242/dev.188078. [DOI] [PubMed] [Google Scholar]
  29. Ma P, Li Y, Wang H, Mao B, Luo ZG. Haploinsufficiency of the TDP43 ubiquitin E3 ligase RNF220 leads to ALS-like motor neuron defects in the mouse. Journal of Molecular Cell Biology. 2021;13:374–382. doi: 10.1093/jmcb/mjaa072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ma P, Liu X, Xu Z, Liu H, Ding X, Huang Z, Shi C, Liang L, Xu L, Li X, Li G, He Y, Ding Z, Chai C, Wang H, Qiu J, Zhu J, Wang X, Ding P, Zhou S, Yuan Y, Wu W, Wan C, Yan Y, Zhou Y, Zhou QJ, Wang GD, Zhang Q, Xu X, Li G, Zhang S, Mao B, Chen D. Joint profiling of gene expression and chromatin accessibility during amphioxus development at single-cell resolution. Cell Reports. 2022a;39:110979. doi: 10.1016/j.celrep.2022.110979. [DOI] [PubMed] [Google Scholar]
  31. Ma P, Mao B. The many faces of the E3 ubiquitin ligase, RNF220, in neural development and beyond. Development, Growth & Differentiation. 2022b;64:98–105. doi: 10.1111/dgd.12756. [DOI] [PubMed] [Google Scholar]
  32. Ma P, Wan LP, Li Y, He CH, Song NN, Zhao S, Wang H, Ding YQ, Mao B, Sheng N. RNF220 is an E3 ubiquitin ligase for AMPA receptors to regulate synaptic transmission. Science Advances. 2022c;8:eabq4736. doi: 10.1126/sciadv.abq4736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Maheshwari U, Kraus D, Vilain N, Holwerda SJB, Cankovic V, Maiorano NA, Kohler H, Satoh D, Sigrist M, Arber S, Kratochwil CF, Di Meglio T, Ducret S, Rijli FM. Postmitotic hoxa5 expression specifies pontine neuron positional identity and input connectivity of cortical afferent subsets. Cell Reports. 2020;31:107767. doi: 10.1016/j.celrep.2020.107767. [DOI] [PubMed] [Google Scholar]
  34. Malek R, Gajula RP, Williams RD, Nghiem B, Simons BW, Nugent K, Wang H, Taparra K, Lemtiri-Chlieh G, Yoon AR, True L, An SS, DeWeese TL, Ross AE, Schaeffer EM, Pienta KJ, Hurley PJ, Morrissey C, Tran PT. TWIST1-WDR5-hottip regulates hoxa9 chromatin to facilitate prostate cancer metastasis. Cancer Research. 2017;PMID:3181–3193. doi: 10.1158/0008-5472.Can-16-2797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Miller A, Dasen JS. Establishing and maintaining Hox profiles during spinal cord development. Seminars in Cell & Developmental Biology. 2024;152–153:44–57. doi: 10.1016/j.semcdb.2023.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Papp B, Müller J. Histone trimethylation and the maintenance of transcriptional ON and OFF states by trxG and PcG proteins. Genes & Development. 2006;20:2041–2054. doi: 10.1101/gad.388706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Parker HJ, Bronner ME, Krumlauf R. A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates. Nature. 2014;514:490–493. doi: 10.1038/nature13723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Parker HJ, Bronner ME, Krumlauf R. The vertebrate Hox gene regulatory network for hindbrain segmentation: evolution and diversification: coupling of a Hox gene regulatory network to hindbrain segmentation is an ancient trait originating at the base of vertebrates. BioEssays. 2016;38:526–538. doi: 10.1002/bies.201600010. [DOI] [PubMed] [Google Scholar]
  39. Parker HJ, Krumlauf R. A Hox gene regulatory network for hindbrain segmentation. Current Topics in Developmental Biology. 2020;139:169–203. doi: 10.1016/bs.ctdb.2020.03.001. [DOI] [PubMed] [Google Scholar]
  40. Philippidou P, Dasen JS. Hox genes: choreographers in neural development, architects of circuit organization. Neuron. 2013;80:12–34. doi: 10.1016/j.neuron.2013.09.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Pöpperl H, Featherstone MS. Identification of a retinoic acid response element upstream of the murine Hox-4.2 gene. Molecular and Cellular Biology. 1993;13:257–265. doi: 10.1128/mcb.13.1.257-265.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Quagliata L, Matter MS, Piscuoglio S, Arabi L, Ruiz C, Procino A, Kovac M, Moretti F, Makowska Z, Boldanova T, Andersen JB, Hämmerle M, Tornillo L, Heim MH, Diederichs S, Cillo C, Terracciano LM. Long noncoding RNA HOTTIP/HOXA13 expression is associated with disease progression and predicts outcome in hepatocellular carcinoma patients. Hepatology. 2014;59:911–923. doi: 10.1002/hep.26740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Rosenberg AB, Roco CM, Muscat RA, Kuchina A, Sample P, Yao Z, Graybuck LT, Peeler DJ, Mukherjee S, Chen W, Pun SH, Sellers DL, Tasic B, Seelig G. Single-cell profiling of the developing mouse brain and spinal cord with split-pool barcoding. Science. 2018;360:176–182. doi: 10.1126/science.aam8999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Schuettengruber B, Bourbon HM, Di Croce L, Cavalli G. Genome regulation by polycomb and trithorax: 70 years and counting. Cell. 2017;171:34–57. doi: 10.1016/j.cell.2017.08.002. [DOI] [PubMed] [Google Scholar]
  45. Smith JJ, Kratsios P. Hox gene functions in the C. elegans nervous system: From early patterning to maintenance of neuronal identity. Seminars in Cell & Developmental Biology. 2024;152–153:58–69. doi: 10.1016/j.semcdb.2022.11.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Vanderheyden M, Defize L. Twenty one years of P19 cells: what an embryonal carcinoma cell line taught us about cardiomyocyte differentiation. Cardiovascular Research. 2003;58:292–302. doi: 10.1016/S0008-6363(02)00771-X. [DOI] [PubMed] [Google Scholar]
  47. Wang KC, Yang YW, Liu B, Sanyal A, Corces-Zimmerman R, Chen Y, Lajoie BR, Protacio A, Flynn RA, Gupta RA, Wysocka J, Lei M, Dekker J, Helms JA, Chang HY. A long noncoding RNA maintains active chromatin to coordinate homeotic gene expression. Nature. 2011;472:120–124. doi: 10.1038/nature09819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wang X, Zhou F, Lv S, Yi P, Zhu Z, Yang Y, Feng G, Li W, Ou G. Transmembrane protein MIG-13 links the Wnt signaling and Hox genes to the cell polarity in neuronal migration. PNAS. 2013;110:11175–11180. doi: 10.1073/pnas.1301849110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang YB, Song NN, Zhang L, Ma P, Chen JY, Huang Y, Hu L, Mao B, Ding YQ. Rnf220 is implicated in the dorsoventral patterning of the hindbrain neural tube in mice. Frontiers in Cell and Developmental Biology. 2022;10:831365. doi: 10.3389/fcell.2022.831365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wong CH, Li CH, He Q, Chan SL, Tong JHM, To KF, Lin LZ, Chen Y. Ectopic HOTTIP expression induces noncanonical transactivation pathways to promote growth and invasiveness in pancreatic ductal adenocarcinoma. Cancer Letters. 2020;477:1–9. doi: 10.1016/j.canlet.2020.02.038. [DOI] [PubMed] [Google Scholar]
  51. Wysocka J, Swigut T, Milne TA, Dou Y, Zhang X, Burlingame AL, Roeder RG, Brivanlou AH, Allis CD. WDR5 associates with histone H3 methylated at K4 and is essential for H3 K4 methylation and vertebrate development. Cell. 2005;121:859–872. doi: 10.1016/j.cell.2005.03.036. [DOI] [PubMed] [Google Scholar]
  52. Xu L, Zheng Y, Li X, Wang A, Huo D, Li Q, Wang S, Luo Z, Liu Y, Xu F, Wu X, Wu M, Zhou Y. Abnormal neocortex arealization and Sotos-like syndrome-associated behavior in Setd2 mutant mice. Science Advances. 2021;7:eaba1180. doi: 10.1126/sciadv.aba1180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Yu X, Li D, Kottur J, Shen Y, Kim HS, Park K-S, Tsai Y-H, Gong W, Wang J, Suzuki K, Parker J, Herring L, Kaniskan HÜ, Cai L, Jain R, Liu J, Aggarwal AK, Wang GG, Jin J. A selective WDR5 degrader inhibits acute myeloid leukemia in patient-derived mouse models. Science Translational Medicine. 2021;13:eabj1578. doi: 10.1126/scitranslmed.abj1578. [DOI] [PMC free article] [PubMed] [Google Scholar]

eLife Assessment

Paschalis Kratsios 1

This valuable study focuses on gene regulatory mechanisms essential for hindbrain development. Through molecular genetics and biochemistry, the authors propose a new mechanism for the control of Hox genes, which encode highly conserved transcription factors essential for hindbrain development. The strength of evidence is solid, as most claims are supported by the data. This work will be of interest to developmental biologists.

Reviewer #1 (Public review):

Anonymous

The manuscript by Wang et al. investigates the role of Rnf220 in hindbrain development and Hox expression. The authors suggest that Rnf220 controls Hox expression in the hindbrain through regulating WDR5 levels. The authors combine in vivo experiments with experiments in P19 cells to demonstrate this mechanism. However, the in vivo data does not provide strong support for the claims the authors make and the role of Rnf in Hox maintenance and pons development is unclear.

While the authors partially addressed some of the issues raised in the first round of reviews, and the in vitro data showing a relationship between Rnf220 and WDR5 is convincing, some issues still remain about the experimental evidence supporting their claims and the relationship of this work with previous studies demonstrating the role of Hox proteins in pontine nuclei in vivo.

The authors say they were unable to detect Hox levels via in situ hybridization at late embryonic stages, stating that the levels are likely too low to be detected-yet they are presumably high enough to cause ectopic targeting of pontine neurons. Work from the Rijli group, which the authors cite, shows that Hox3-5 paralogs can be clearly detected both by in situ and by staining with commercially available antibodies. Since a major claim of this paper is the upregulation of Hox genes in Rnf220+/- mice through WDR5 regulation, the authors need to show this more convincingly. The inability to detect Hox upregulation, and subsequent rescue, by means other than qPCR in vivo remains a major weakness of the paper. The authors also do not discuss how broad upregulation of all Hox paralogs leads to the changes in PN targeting in the context of previous work.

The links between Wdr5 expression, epigenetic modifications, Hox expression and axon mistargeting in vivo remains somewhat tenuous. For example, the authors show epigenetic modification changes in some Hox genes, but not Hox5 paralogs, and only show the rescue by Wdr5 KO in vitro. Similarly, they do not attempt to show rescue of axon targeting in vivo after presumably restoring Hox levels by Wdr5 inhibition or knockdown.

eLife. 2024 Nov 11;13:RP94657. doi: 10.7554/eLife.94657.3.sa2

Author response

Huishan Wang 1, Xingyan Liu 2, Yamin Liu 3, Chencheng Yang 4, Yaxin Ye 5, Xiaomei Yu 6, Nengyin Sheng 7, Shihua Zhang 8, Bingyu Mao 9, Pengcheng Ma 10

The following is the authors’ response to the original reviews.

Reviewer 1:

(1) A major issue throughout the paper is that Hox expression analysis is done exclusively through quantitative PCR, with values ranging from 2-fold to several thousand-fold upregulation, with no antibody validation for any Hox protein (presumably they are all upregulated).

Thank you for your comment.

We tried to verify the stimulated Hox expression pattern by in situ hybridization. Although in early embryos (E9.5) we could detect clearly hox (i.e. Hox8 and Hox9 in Author response image 1) expression patterns in the neural tube by whole mount in situ hybridization, we failed to detect a clear pattern in the brain stem at E18.5 either in whole mount tissue or on sections. That’s one reason that we turned to single nuclear RNA-seq instead.

This is likely due to their low expression levels at late developmental stages and need to be detected by more sensitive method. However, we estimated that the stimulated expression levels of the representative Hox genes are at least comparable to the physiological levels at posterior spinal cord to evoke a functional effect.

Author response image 1. Some Hox8 and Hox9 expression pattern in E9.

Author response image 1.

5 embryos.

(2) In Figure 1, massive upregulation of most Hox genes in the brainstem is shown after e16.5 but the paper quickly focuses on analysis of PN nuclei. What are the other consequences of this broad upregulation of Hox genes in the brainstem? There is no discussion of the overall phenotype of the mice, the structure of the brainstem, the migration of neurons, etc. The very narrow focus on motor cortex projections to PN nuclei seems bizarre without broad characterization of the mice, and the brainstem in particular. There is only a mention of "severe motor deficits" from previous studies, but given the broad expression of Rnf220, the fact that is a global knockout, and the effects on spinal cord populations shown previously the justification for focusing on PN nuclei does not seem strong.

Thank you for your comment.

Although RNF220 is important for the dorsal-ventral patterning of the spinal cord as well as the hindbrain during embryonic development, the earlier neural patterning and differentiation are normal in the Rnf220+/- mice (Wang et al., 2022). However, these mice showed reduced survival and motility to various degree postnatally (Ma et al., 2019; Ma et al., 2021), likely suggesting a dosage dependent role of RNF220 in maintaining late neural development. As our microarray assay showed the deregulation of the Hox genes in the brain, we followed this direction in this study and narrowed down the affected region to the pons. Our single nuclear RNA-Seq (snRNA-seq) data further shows that the Hox de-regulation mainly occurred in 3 clusters of neurons. However, the pons is complex and contains tens of nuclei. And the current resolution of our data does not support to assign a clear identity to each of them. Although it is clear that more nuclei are likely affected, the PN (cluster7) is the only cluster we can identify to follow in the current study.

As to general effect of RNF220 haploinsufficiency on the brainstem, we carried out Nissl staining assays and found no clear difference in neuronal cell organization between WT and Rnf220+/- pons (revised Figure 2-figure supplement 2).

(3) It is stated that cluster 7 in scRNA-seq corresponds to the PN nuclei. The modest effect shown on Hox3-5 expression in that data in Figure 1 is inconsistent with the larger effect shown in Figure 2.

Thank you for your comment.

Due to the low efficiency of snRNA-seq and the depth of the sequencing, the quantification of the Hox expression based on the snRNA-seq data is likely less accurate as the qRT-PCR. In addition, only mRNAs in the nuclear could be captured by snRNA-seq, while mRNAs in both the nuclear and cytoplasm were reversed-transcribed and examined for qRT-PCR assays in Figure 2A.

(4) Presumably, Hox genes are not the only targets of Rnf220 as shown in the microarray/RNA-sequencing data. There is no definitive evidence that any phenotypes observed (which are also not clear) are specifically due to Hox upregulation. The only assay the authors use to look at a Hox-dependent phenotype in the brainstem is the targeting of PN nuclei by motor cortex axons. This is only done in 2 animals and there are no details as to how the data was analyzed and quantified. The only 2 images shown are not convincing of a strong phenotype, they could be taken at slightly different levels or angles. At the very least, serial sections should be shown and the experiment repeated in more animals. There is also no discussion of how these phenotypes, if real, would relate to previous work by the Rijli group which showed very precise mechanisms of synaptic specificity in this system.

Thank you for your comments and suggestions.

The deregulation of Hox is the most obvious phenomena observed from the RNA-seq data, and we tried to assign its specific phenotypic effect in this study. As the roles of Hox in PN patterning and circuit formation is well established, we focused on the PN in the following study. Based on literature, we carried out the circuit analysis to examine the targeting of PN neurons by the motor cortex axons. A cohort of additional animals with different genotypes (n=10 for WT and n=9 for Rnf220+/-) were used to repeat the experiment and we got the same conclusion. More detailed information on data analysis and serial images were included in the revised manuscript and figure legends.

(5) The temporal aspect of this regulation in vivo is not clear. The authors show some expression changes begin at e16.5 but are also present at 2 months. Is the presumed effect on neural circuits a result of developmental upregulation at late embryonic stages or does the continuous overexpression in adult mice have additional influence? Are any of the Hox genes upregulated normally expressed in the brainstem, or PN specifically, at 2 months? Why perform single-cell sequencing experiments at 2 months if this is thought to be mostly a developmental effect? Similarly, the significance of the upregulated WRD5 in the pons and pontine nuclei at 2 months in Figure 3 is not clear.

Thank you for your comment.

The spatial and temporal expression pattern of Hox genes is established at early embryonic stages and then maintained throughout developmental stage in mammals. As we have shown, the de-repression of Hox genes is a long-lasting defect in Rnf220+/- mice beginning at late embryonic stages. Since the neuronal circuit is established after birth in mice, we speculated that the neuronal circuit defects from motor cortex to PN neurons were due to the long-lasting up-regulation of Hox genes in PN neurons. We could not distinguish the effect on neural circuit a result of Hox genes developmental upregulation or continuous overexpression in adult mice. An inducible knockout mouse model may help to answer this question in the future. The discussion on this point was included in the revised manuscript.

We carried out snRNA-seq analysis using pons tissues from adult mice aiming to identify the specific cell population with Hox up-regulation, which we failed to specify by in situ hybridization.

We repeated the related experiments in the original Figure 3 and some of the blot images were replaced and quantified.

(6) In Figure 3C, the levels of RNF220 in wt and het don't seem to be that different.

We repeated the experiments and changed the related image in the revised Figure 3C.

(7) Based on the single-cell experiments, and the PN nuclei focus, the rescue experiments are confusing. If the Rnf220 deletion has a sustained effect for up to 2 months, why do the injections in utero? If the focus is the PN nuclei why look at Hox9 expression and not Hox3-5 which are the only Hox genes upregulated in PN based on sc-sequencing? No rescue of behavior or any phenotype other than Hox expression by qPCR is shown and it is unclear whether upregulation of Hox9 paralogs leads to any defects in the first place. The switch to the Nes-cre driver is not explained. Also, it seems that wdr5 mRNA levels are not so relevant and protein levels should be shown instead (same for rescue experiments in P19 cells).

Thank you for your comments.

Since our data suggest that the upregulation of Hox genes expression is a long-lasting effect beginning at the late embryonic stage of E16.5, we conducted the rescue experiments by in utero injection of WDR5 inhibitor at E15.5 and examined the expression of Hox genes at E18.5. Although it is also necessary to examine whether the rescue effect by WDR5 inhibitor injection is also a long-lasting effect at adult stages, it is difficult to distinguish the embryos or pups when they were given birth. As a supplement, rescue assays with genetic ablation of Wdr5 gene were conducted and the results showed that genetic ablation of a single copy of Wdr5 allele could revere the upregulation of Hox genes by RNF220 haploinsufficiency in the hindbrains at P15.

Most of the upregulated Hox genes including both Hox9 and Hox3-5 were examined in our rescue experiments. Since this study focuses on the PN nuclei, the results of Hox3-5 genes were shown in the revised main Figure 6.

We conducted rescue experiments by deleting Wdr5 in neural tissue using _Nestin-Cr_e mice because Wdr5+/- mice is embryonic lethal. And the up-regulation of Hox genes could be also observed in the hindbrains of Rnf220fl/wt; Nestin-Cre mice. Although Rnf220fl/wt; Wdr5fl/wt; Nestin-Cre mice are viable and could survive to adult stages, developmental defects in the forebrains, including cerebral cortex and hippocampus, were observed in Rnf220fl/wt;Wdr5fl/wt;Nestin-Cre mice. Therefore, no rescue of behavior tests was conducted in this study. We believe that it is out of the scope of this study to discuss the role of WDR5 in the development of forebrains.

The potential defects due to the up-regulation of Hox9 paralogs awaits further investigations.

Wdr5 mRNA levels were firstly examined to confirm the genetic deletion or siRNA mediated knockdown of Wdr5 genes. We have carried out western blot to examine the WDR5 protein levels and the results were included in the revised Figure 3.

(8) What is the relationship between Retinoic acid and WRD5? In Figure 3E there is no change in WRD5 levels without RA treatment in Rnf KO but an increase in expression with RA treatment and Rnf KO. However, the levels of WRD5 do not seem to change with RA treatment alone. Does Rnf220 only mediate WDR5 degradation in the presence of RA? This does not seem to be the case in experiments in 293 cells in Figure 4.

Thank you for your comment.

We believe that the regulation of WDR5 and Hox expression by RNF220 is context dependent and precisely controlled in vivo, depending on the molecular and epigenetic status of the cell, which is fulfilled by RA treatment in P19 cells. In Figure 4, the experiment is based on exogenous overexpression assays, which might not fully reflect the situation in vivo.

(9) Why are the levels of Hox upregulation after RA treatment so different in Figure 5 and Figure Supplement 5?

In Figure.5C, the Hox expression levels were normalized against the control group in the presence of RA; while in Figure Supplement 5 they were normalized to the control group without RA treatment.

(10) In Figures 4B+C which lanes are input and which are IP? There is no quantitation of Figure 4D, from the blot it does look that there is a reduction in the last 2 columns as well. The band in the WT flag lane seems to have a bubble. Need to quantitate band intensities. Same for E, the effect does not seem to be completely reversed with MG132.

Thanks for pointing this out. The labels were included in the revised Figure 4B and 4C.

We repeated the experiments for Figure 4D and 4E. Some of bot images were replaced and quantified in the revised Figure 4D and 4E.

Reviewer 2:

(1) Figure 1E shows that Rnf220 knockdown alone could not induce an increase in Hox expression without RA, which indicates that Rnf220 might endogenously upregulate Retinoic acid signaling. The authors should test if RA signaling is downstream of Rnf220 by looking at differences in the expression of Retinaldehyde dehydrogenase genes (as a proxy for RA synthesis) upon Rnf220 knockdown.

Thank you for your comment and suggestion.

Two sequential reactions are required for RA synthesis from retinol, which catalyzed by alcohol dehydrogenases (ADHs)/ retinol dehydrogenase (RDH) and retinaldehyde dehydrogenase (RALDHs also known as ALDHs) respectively. When RA is no longer needed, it is catabolized by cytochrome enzymes (CYP26 enzymes) (Niederreither, et al.,2008; Kedishvili et al., 2016). Here, we test ADHs、ALDHs and CYP26 enzymes in E16.5 WT and Rnf220-/- embryos.

The results are as follows. ADH7 and ADH10 are slightly upregulated. ALDH1 and ALDH3 are upregulated and downregulated in Rnf220-/- embryos, respectively, but there is no significant change in the expression of ALDH2, which plays a key role in RA synthesis during embryonic development (Niederreither, et al.,2008). Furthermore, Cyp26a1 which responsible for RA catabolism was upregulated in Rnf220-/- embryos. Collectively, these data do not support a clear effect on RA signaling by RNF220.

Author response image 2. The effect of Rnf220 on RA synthesis and degradation pathways.

Author response image 2.

(2) In Figure 2C-D further explanation is required to describe what criteria were used to segment the tissue into Rostral, middle, and caudal regions. Additionally, it is unclear whether the observed change in axonal projection pattern is caused due to physical deformation and rearrangement of the entire Pons tissue or due to disruption of Hox3-5 expression levels. Labeling of the tissue with DAPI or brightfield image to show the structural differences and similarities between the brain regions of WT and Rnf220 +/- will be helpful.

Thank you for your comment and suggestion.

More information on the quantification of the results shown in Figure 2C-D was included in our revised manuscript. We carried out Nissl staining assays using coronal sections of the brainstem and found that there is no significant difference in neuronal cell organization between WT and Rnf220+/- (revised Figure 2-figure supplement 2).

(3) Line 192-195. These roles of PcG and trxG complexes are inconsistent with their initial descriptions in the text - lines 73-74.

We are sorry for the mistake. We carefully revised the related descriptions to avoid such mistake. Thank you.

(4) In Figure 4D, the band in the gel seems unclear and erased. Please provide a different one. These data show that neither Rnf220 nor wdr5 directly regulates Hox gene expressions. The effect of double knockdown in the presence of RA suggests that they work together to suppress Hox gene expression via a different downstream target. This point should be addressed in the text and discussion section of the paper. example for the same data which shows a full band with lower intensity.

Thank you for your suggestion.

We repeated the experiment of Figure 4D and some of the blot images were replaced in the revised Figure 4D.

Indeed, in the presence of RA, knockdown of Rnf220 alone can upregulate the expression Hox genes (Figure 5C). Knockdown of Wdr5 could reverse the upregulation of Hox genes in RNF220 knockdown cells, suggesting that Rnf220 regulated Hox gene expression in a Wdr5 dependent manner. However, in the absence of RA, none of Rnf220 knockdown, Wdr5 knockdown or Rnf220 and Wdr5 double knockdown had a significant effect on the expression of Hox genes in P19 cells. It seems that RA signaling plays a crucial role for the regulation of RNF220 to WDR5 in P19 cells and discussion on this point was included in the revised manuscript.

(5) In Figure 4G the authors could provide some form of quantitation for changes in ubiquitination levels to make it easier for the reader. They should also describe the experimental procedures and conditions used for each of the pull-down and ubiquitination assays in greater detail in the methods section.

Thank you for your suggestion.

The quantitation and statistics for the original Figure 4G were included in the revised Figure 4. More information on the biochemical assays was included in the “Methods and Materials” section of our revised manuscript.

(6) Figure 5 shows that neither Rnf220 nor wdr5 directly regulate Hox gene expressions. The effect of double knockdown in the presence of RA suggests that they work together to suppress Hox gene expression via a different downstream target.

Thank you for your comment.

In fact, knockdown of Rnf220 alone can upregulate the expression Hox genes in the presence of RA (Figure 5C). Furthermore, knockdown of Wdr5 could reverse the upregulation of Hox genes in Rnf220 knockdown cells, which suggest that Rnf220 regulated Hox gene expression in a Wdr5 dependent manner. However, in the absence of RA, none of Rnf220 knockdown, Wdr5 knockdown or Rnf220 and Wdr5 double knockdown had a significant effect on the expression of Hox genes in P19 cells. It seems that RA signaling plays a crucial role for the regulation of RNF220 to WDR5 in P19 cells and discussion on this point was included in the revised manuscript.

(7) In Figure 6, while the reversal of changes in Hox gene expression upon concurrent Rnf220; Wdr5 inhibition highlights the importance of Wdr5 in this regulatory process, the mechanistic role of wdr5 and its functional consequences are unclear. To answer these questions, the authors need to: (i) Assay for activated and repressive epigenetic modifications upon double knockdown of Rnf220 and Wdr5 similar to that shown in Figure 3- supplement 1. This will reveal if wdr5 functions according to its intended role as part of the TrxG complex. (ii) The authors need to assay for changes in axon projection patterns in the double knockdown condition to see if Wdr5 inhibition rescues the neural circuit defects in Rnf220 +/- mice.

Thank you for your suggestion.

Although it is also necessary to examine whether the rescue effect by WDR5 inhibitor injection in uetro is also a long-lasting effect for neuronal cirtuit at adult stages, it is difficult to distinguish the embryos or pups when they were given birth. Although Rnf220fl/wt;Wdr5fl/wt;Nestin-Cre mice are viable and could survive to adult stages, developmental defects in the forebrains, including cerebral cortex and hippocampus, were observed in Rnf220fl/wt;Wdr5fl/wt;Nestin-Cre mice. Therefore, no rescue effect on defects of behavior and neuronal circuit were examined in this study. Maybe, a PN nuclei specific inducible Cre mouse line could help toward this direction in the future.

We carried out ChIP-qPCR and tested activated and repressive epigenetic modifications upon double knockdown of Rnf220 and Wdr5 in P19 cell line and found Rnf220 and Wdr5 double knockdown recured Hox epigenetic modification to a certain degree (Figure 6-figure supplement 1).

References

Kedishvili, N.Y. 2016. Retinoic acid synthesis and degradation. Subcell Biochem, 81:127-161. DOI: 10.1007/978-94-024-0945-1_5, PMID: 2783050

Ma, P., Li, Y., Wang, H., Mao, B., Luo, Z.-G. 2021. Haploinsufficiency of the TDP43 ubiquitin E3 ligase RNF220 leads to ALS-like motor neuron defects in the mouse. Journal of Molecular Cell Biology, 13: 374-382. DOI: 10.1093/jmcb/mjaa072, PMID: 33386850

Ma, P., Song, N.-N., Li, Y., Zhang, Q., Zhang, L., Zhang, L., Kong, Q., Ma, L., Yang, X., Ren, B., Li, C., Zhao, X., Li, Y., Xu, Y., Gao, X., Ding, Y.-Q., Mao, B. 2019. Fine-Tuning of Shh/Gli Signaling Gradient by Non-proteolytic Ubiquitination during Neural Patterning. Cell Rep, 28: 541-553.e544. DOI: 10.1016/j.celrep.2019.06.017, PMID: 31291587

Niederreither, K., Dollé, P. 2008. Retinoic acid in development: towards an integrated view. Nat Rev Genet, 9: 541-53. DOI: 10.1038/nrg2340, PMID: 18542081

Wang, Y.-B., Song, N.-N., Zhang, L., Ma, P., Chen, J.-Y., Huang, Y., Hu, L., Mao, B., Ding, Y.-Q. 2022. Rnf220 is Implicated in the Dorsoventral Patterning of the Hindbrain Neural Tube in Mice. Front Cell Dev Biol, 10. DOI: 10.3389/fcell.2022.831365, PMID: 35399523

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Data Citations

    1. Huishan W. 2024. Hindbrain pattern maintenance in mouse. Genome Sequence Archive. CRA013111

    Supplementary Materials

    Supplementary file 1. Differently expressed genes identified using microarray between wild-type (WT) and Rnf220+/- mice.

    Whole-mount brain from E18.5 mice were used (n=2 in WT group and n=3 in Rnf220+/- group).

    elife-94657-supp1.docx (23.2KB, docx)
    Supplementary file 2. Differently expressed genes identified using microarray between wild-type (WT) and Rnf220-/- mice.

    Whole-mount brain from E18.5 mice were used (n=2 in WT group and n=3 in Rnf220-/- group).

    elife-94657-supp2.docx (22.4KB, docx)
    Supplementary file 3. Uniquely and highly expressed genes of each cluster in single-nucleus RNA sequencing (snRNA-seq).

    The pons from 2 months’ mice were used (n=3 mice per group).

    elife-94657-supp3.docx (106.7KB, docx)
    MDAR checklist

    Data Availability Statement

    All the snRNA-seq and RNA-seq raw data have been deposited in the GSA (https://ngdc.cncb.ac.cn/gsa/) with accession number is CRA013111.

    The following dataset was generated:

    Huishan W. 2024. Hindbrain pattern maintenance in mouse. Genome Sequence Archive. CRA013111


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES