Methionine and vitamin E supplementation improve production performance, antioxidant potential, and liver health in aged laying hens

Abstract

Sulfur metabolites of methionine (Met) and vitamin E (VE) have antioxidant potential and can maintain liver health in chickens. This study explored the underlying mechanisms of Met sources, the ratio of total sulfur amino acids to lysine (TSAA: Lys), and VE levels on production performances, antioxidant potential, and hepatic oxidation in aged laying hens. Eight hundred and sixty-four, Hy-Line Brown laying hens (70-week age) were divided into 12 treatment groups, each having 6 repeats and 12 birds/each repeat. The dietary treatments consisted of DL-Met (DL-Met), DL-2-hydroxy-4-(methylthio)-butanoic acid (OH-Met), 3 ratios of TSAA: Lys (0.90, 0.95, and 1.00), and 2 levels of VE (20 and 40 g/ton). Albumen height and Haugh unit significantly increased at a lower level of VE (P < 0.05). Triglycerides (TG), total cholesterol (TC), low-density lipoprotein (LDL), and very low-density lipoprotein (VLDL) in serum and superoxide dismutase (SOD) and catalase activities (CAT) in the liver significantly reduced at 0.95 TSAA: Lys ratio (P < 0.05). Fatty acid synthase (FAS), lipoprotein lipase (LPL), nuclear factor erythroid 2-related factor 2 (Nrf2), and carnitine palmitoyltransferase-1 alpha (CPT-1α) also upregulated at this TSAA: Lys ratio (P < 0.05). Compared with the DL-Met group, the OH-Met group had lower Dipeptidyl Peptidase 4 (DPP4) and higher TC, LDL, and VLDL concentrations (P < 0.05).The expression of FAS,CPT-1α), glutathione (GSH), glutathione disulfide (GSSG), glutathione synthetase (GSS), and Nrf2 were significantly higher in OH-Met compared with the DL-Met group (P < 0.05). OH-Met at 0.95 and DL-Met at 0.90 TSAA: Lys ratio showed higher CAT and lower aspartate aminotransferase (AST) activities. Moreover, OH-Met at 0.90 and DL-Met at 0.95 of the TSAA: Lys ratio had a significant reduction of malondialdehyde (MDA) (P < 0.05). Overall, these results suggest that OH-Met source with a lower level of VE positively influenced production performance and improved liver health in aged laying hens through improved lipid metabolism and hepatic antioxidant function.

Introduction

Aged laying hens with their declining antioxidant capacity are particularly vulnerable to reactive oxygen species (ROS) and free radicals, which can lead to various liver metabolic disorders (Surai and Kochish, 2019; Gu et al., 2021). Furthermore, oxidative stress has been identified as a significant contributor to liver damage through intricate signal transduction pathways (Czaja, 2007; Morita et al., 2012; Li et al., 2015). Among various liver metabolic disorders, fatty liver syndrome (FLS) and fatty liver hemorrhagic syndrome (FLHS) are the most prevalent disorders (Julian, 2005; Trott et al., 2014). These conditions negatively impact egg production, quality, triglyceride levels, and overall chicken mortality (Julian, 2005; Trott et al., 2014; Lin et al., 2021).

Earlier findings suggested that aging can induce lipid peroxidation and protein oxidation, reduce the production performance and recovery of antioxidants, inhibit hepatocyte growth, and prevent liver tissue repair (Hanada et al., 2012; Cheng et al., 2017; Tanimizu et al., 2020). Imbalance in lipid homeostasis, such as hepatic lipid buildup, transportation, and metabolism could be key factors contributing to fatty liver disorders in chickens (Jiang et al., 2017). Inadequate dietary protein may also contribute to the development of fatty liver diseases (van Zutphen et al., 2016; Ampong et al., 2020; Chakravarthy et al., 2020). Low protein diets can likely result in an insufficiency of essential amino acids, such as methionine (Met), which is a precursor for carnitine formation (Longo et al., 2016); thereby an important role in the transportation of long-chain fatty acids (Longo et al., 2016). Hence, low Met intake decreases the levels of carnitine and can cause nonalcoholic fatty liver disease in humans (Krajcovicova-Kudlackova et al., 2000; Badaloo et al., 2005; Ampong et al., 2020; Savic et al., 2020). Thus, there is a growing concern about these challenges especially in aged laying hens.

Met is an essential amino acid for poultry and is routinely supplemented in diets through its synthetic sources, such as DL-Met or OH-Met. Both Met sources are equally efficient in satisfying the growth needs of poultry (Vazquez-Anon et al., 2006; Agostini et al., 2016). In addition, the downstream metabolites of Met, for instance, cysteine and taurine play crucial roles in the antioxidant defense system. Cysteine is implicated in glutathione (GSH) formation. Therefore, oxidative stress due to physiological changes in aging conditions may require high levels of Met to support vital antioxidant functions (Lugata et al., 2022). Likewise, vitamin E (VE) can help reduce ROS, maintain cellular integrity, and potentially protect against liver damage (Mazur-Kusnirek et al., 2019). Aged laying hens often have low plasma VE concentrations (Ryan et al., 2010), indicating that the oxidation reactions can deplete the VE level (Bayraktar et al., 2011; Koch and Hill, 2016) increasing the Met demand beyond standard requirements.

Therefore, we hypothesized that the current industry standard for TSAA: Lys and VE levels may be insufficient to fulfill the dietary requirement of aged laying hens. Thus, this study aimed to investigate the effects of Met sources, ratio of TSAA: Lys and VE levels on production performance, oxidative potential, lipid metabolism, and hepatic oxidative damage-related gene expression in aged laying hens.

Materials and methods

Ethics approval and protocol

Animal Care and Use Committee of the Feed Research Institute of the Chinese Academy of Agricultural Sciences reviewed and approved the experimental design and procedures. The field experiment was conducted ethically, and the experimental chickens received appropriate management and care throughout the study.

Animal husbandry and experimental birds

Eight hundred and sixty-four, Hy-line brown laying hens at 70 weeks of age were randomly divided into 12 treatment groups with 6 repeats (12 birds in each repeat) in a completely randomized design with a factorial arrangement. A 2-week adaptation period was provided before the commencement of the actual experimental trial, which lasted for 12 weeks. The chickens were housed in cage systems (40 cm x 40 cm x 35 cm). The experimental birds were given free access to water, while feed was provided twice a day.

The ingredient composition and nutrient levels of the basal diet are presented in Table 1. Feed was formulated based on the National Research Council (NRC, 1994) recommendation, following the Hy-Line Brown laying hens management manual. The ingredients were analyzed for nutrient composition following a previously described procedure (AOAC, 2000) for dry matter (DM; AOAC 934.01), crude protein (CP; AOAC 990.0), crude fat (CF; AOAC 978.10), crude ash (Ash; AOAC 920.39), starch (AOAC 996.11) (AOAC, 2003), and amino acids (AA; AOAC 982.30). These analyses were conducted using the hot air oven method, Kjeldahl method, Soxhlet extraction, incineration, polarimetry, and amino acid analyzer, respectively.

Table 1.

Ingredient and nutrient composition of basal diet.

Ingredients	%	Nutrients
Corn	66.91	AME, MJ/kg	11.51
Soybean meal	17	Crude Protein, %	14.35
Cottonseed meal	2	Ca, %	4.25
Limestone	10.80	Available phosphorus, %	0.35
Soybean oil	1.15	Amino acids, %
CaHPO4	1.35	SID-Lys	0.72
Premix1	0.25	SID-Met	0.36
Salt	0.22	SID-Met + Cys (TSAA)	0.65
		SID-Thr	0.50
Lysine-HCl	0.06	SID-Val	0.68
Choline chloride	0.10	SID-Ile	0.60
Total	100	SID-Arg	1.05

Abbreviation: AME, apparent metabolizable energy; MJ/kg; Mega joule per kilogram; Ca, Calcium; SID, standardized ileal digestibility; Lys, lysine; Met, methionine; Met + Cys, methionine and cysteine, sulfur-containing proteinogenic amino acids; Thr, threonine; TSAA: Lys, total sulfur amino acids to lysine ratio; Val, Valine; Ile, isoleucine; Arg, L-arginine.

¹The premix used for laying hens supplied the following per kg of complete feed: vitamin A, 12,500 IU; vitamin D₃, 4,125 IU; vitamin K₃, 2 mg; thiamine (B₁), 1 mg; riboflavin, 8.5 mg; pyridoxine, 8 mg; vitamin B₁₂, 5 mg; biotin, 2 mg; folic acid, 5 mg; Ca-pantothenate, 50 mg; niacin, 32.5 mg; Cu, 8 mg; Zn, 65 mg; Fe, 60 mg; Mn, 65 mg; Se, 0.3 mg; I, 1 mg.

The experimental diets were formulated using two sources of Met (DL-Met and OH-Met) with three ratios of TSAA: Lys (0.90, 0.95, and 1.00, as recommended by the breeding company), and two levels of VE (20 and 40 g/ton), as shown in Table 2. The digestible amino acid contents of corn and soybean meal samples were analyzed using NIR based on the precision nutrition evaluation database of Adisseo. A 62% premix of OH-Met was prepared using silica carrier (SIPERNAT®) before being added to the experimental diets. The actual contents of the OH-Met premix were analyzed before feed preparation. The dietary OH-Met was analyzed using the methods described by Agostini et al. (2016). Briefly, feed samples were grounded at 0.5 mm, and added OH-Met was extracted using water-methanol solution under stirring. The solution was treated with an alkaline solution to hydrolyze oligomers and then neutralized before HPLC injection using a reverse-phase column. The peak of OH-Met was detected using UV detection at 214 nm. The DL-Met and OH-Met premix were added to the basal diet at the expense of corn. The feed was prepared in mash form.

Table 2.

Experimental diet preparation.

Treatments	OH-Met1							DL-Met2
	T1	T2	T3	T4	T5	T6	T7		T8	T9	T10	T11	T12
dMet3level (%)	100	100	110	110	120	120	100		100	110	110	120	120
Met4level (%)	0.36	0.36	0.396	0.396	0.432	0.432	0.36		0.36	0.396	0.396	0.432	0.432
Added5level (%)	0.182	0.182	0.220	0.220	0.259	0.259	0.16		0.16	0.194	0.194	0.228	0.228
DSAA6level (%)	0.646	0.646	0.682	0.682	0.718	0.718	0.646		0.646	0.682	0.682	0.718	0.718
dTSAA: Lys7(%)	90	90	95	95	100	100	90		90	95	95	100	100
VE8(g/ton)	20	40	20	40	20	40	20		40	20	40	20	40

¹OH-Met, DL-2-hydroxy-4-(methylthio)-butanoic acid.

²DL-Met, DL-Methionine.

T1-T12, dietary treatments that consisted of DL-Met, OH-Met, 3 level of TSAA: Lys ratio, and 2 levels of VE; TSAA: Lys, total sulfur amino acids to lysine ratio.

³dMet: determined methionine.

⁴Met: Methionine

⁵Added: Inclusion of OH-Met product (liquid, 88% purity); OH-Met product was mixed with silica to make a premix at 62% concentration of Met-equivalent with the determined value of the premix.

⁶DSAA: determined sulfur amino acids.

⁷dTSAA: Lys, determined total sulfur amino acids to lysine ratio.

⁸VE: vitamin E.

The nutritional composition of the experimental diets demonstrated a strong correlation between the crude protein and amino acid levels with their calculated values, as shown in Table 3. Furthermore, the analyzed levels of DL-Met and OH-Met in the diets further support this observation.

Table 3.

Analyzed nutrient composition of experimental diet.

Nutrients %	OH-Met						DL-Met
	T1	T2	T3	T4	T5	T6	T7	T8	T9	T10	T11	T12
DM	90.22	89.27	90.11	90.15	88.99	90.12	89.32	90.15	88.78	89.99	90.61	90.47
Ash	11.73	11.88	11.86	11.79	11.58	11.06	11.85	11.50	10.98	11.11	11.53	11.78
Crude protein	14.30	14.38	14.42	14.31	14.44	14.39	14.11	14.38	14.30	14.28	14.38	14.35
Crude fat	3.86	3.89	3.93	3.79	3.85	3.91	3.78	3.85	3.88	3.92	3.86	3.94
Starch	42.11	41.23	42.85	42.28	42.13	42.87	41.98	42.29	41.84	41.91	43.02	42.87
Amino acid, %
Lys	0.77	0.78	0.80	0.78	0.79	0.78	0.75	0.78	0.79	0.78	0.77	0.76
Cys	0.32	0.31	0.33	0.33	0.32	0.32	0.32	0.31	0.33	0.33	0.32	0.33
Met + Cys	0.72	0.71	0.75	0.75	0.77	0.78	0.72	0.71	0.75	0.76	0.78	0.78
Thr	0.55	0.54	0.55	0.53	0.54	0.55	0.55	0.56	0.53	0.54	0.56	0.55
Val	0.73	0.71	0.72	0.71	0.72	0.72	0.73	0.71	0.73	0.72	0.72	0.71
Ile	0.67	0.67	0.66	0.65	0.66	0.65	0.65	0.66	0.65	0.66	0.67	0.65
Arg	1.12	1.11	1.10	1.12	1.11	1.12	1.10	1.09	1.10	1.11	1.13	1.09
Basal Met	0.24	0.24	0.24	0.24	0.24	0.24	0.24	0.24	0.24	0.24	0.24	0.24
Added OH-Met	0.16	0.16	0.18	0.18	0.21	0.22	-	-	-	-	-	-
Added DL-Met	-	-	-	-	-	-	0.15	0.16	0.18	0.19	0.22	0.22

Abbreviation: OH-Met, DL-2-hydroxy-4-(methylthio)-butanoic acid; DL-Met, DL-Methionine; T1-T12, dietary treatments that consisted of DL-Met, OH-Met, 3 levels of TSAA: Lys, and 2 levels of VE; DM, dry matter; Lys, lysine; Met + Cys, methionine and cysteine, sulfur-containing proteinogenic amino acids; Thr, threonine; TSAA: Lys, total sulfur amino acids to lysine ratio; Val, Valine; Ile, isoleucine; Arg, L-arginine.

Performance parameter measurement and analysis

Daily feed intake, egg mass, and average egg weight (AEW) were recorded weekly. Hen-day egg production, average daily feed intake (ADFI), and feed conversion ratio (FCR) were calculated, and the production performance data were then averaged over the entire experimental period (0-12 week). The health status of the birds was monitored regularly, and any clinical changes, including death, were recorded.

Egg quality parameters and analysis

Egg quality traits were evaluated at the end of the 12-week experimental period. Five eggs were randomly collected from each repeat for all the treatments (5 eggs × 6 repeats ×12 treatments). Eggshell thickness was measured at 3 locations on the surface of eggs (air cell, equator, and sharp end) using the Eggshell Thickness Gauge (ESTG-1, ORKA Technology Ltd, Ramat HaSharon, Israel). Eggshell breaking strength was measured using the Egg Force Reader (ORKA Technology Ltd, Ramat HaSharon, Israel). An Egg Analyzer (ORKA Food Technology Ltd, Ramat HaSharon, Israel) was used to measure the albumen height, Haugh unit, and yolk color. The determination of yolk color value was based on the “Roche yolk color fan” (15 grades) system, which consists of 15 color samples corresponding to values ranging from 1 to 15.

Blood and liver organ sample collection

At the end of 12-week of the experimental period, one bird with a body weight closer to the average weight of the replicate was selected from each repeat and euthanized by cervical dislocation. Blood samples were collected from the left jugular vein into sterile tubes, and then centrifuged at 3500 × g for 15 min at room temperature. The separated serum samples were stored at -20°C for subsequent analyses. Liver and organ collection was also performed, and samples were stored at -80°C for further analyses.

Biochemical analysis

The levels of dipeptidyl peptidase 4(DPP4), triglycerides (TG), total cholesterol (TC), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and very low-density lipoprotein (VLDL) in the serum were measured using an automatic biochemical analyzer (7600, Hitachi, Japan) following the manufacturer's instructions.

Liver index

The eviscerated livers were photographed and weighed, and the liver index was calculated using the following equation.

Liver index (%) = [liver weight (g) /live weight (g)] × 100.

Liver antioxidant indices

The fat contents in the liver were measured using the ether extraction method. The expression of TG, TC, superoxide dismutase (SOD), malonaldehyde (MDA), glutathione (GSH), oxidized glutathione (GSSG), and catalase (CAT) was measured using a commercial kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) following the manufacturer's instructions. The liver tissue samples were fixed in a 10% formalin solution. After washing, dehydration, and clarification, the samples were embedded in paraffin. Serial sections, each with a thickness of 5 μm, were placed on a glass slide for dewaxing, hydration, and staining. The histopathological changes in the liver were observed using the NIKON DS-U3 image processing and analyzing system (NIKON ECLIPE CI, Tokyo, Japan).

RNA extraction, reverse transcription, and real-time PCR analysis

Total RNA was extracted from liver tissue using Trizol reagent (Beyotime Biotechnology, Shanghai, China). The purity and concentration of the RNA were determined by Nano Drop spectrophotometer (Thermo Fisher Scientific, New York, USA). The total RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara Biomedical Technology, Japan). The primer design is shown in Table 4. Quantitative real-time PCR was performed using SYBR Green (Thermo Fisher Scientific, New York, USA) with the Light Cycler 96 real-time PCR system (Roche, Basel, Switzerland), following the manufacturer's instructions. Gene expression was analyzed using the relative PCR amplification analysis method (2^−ΔΔCT) (Livak and Schmittgen, 2001).

Table 4.

Primer séquences in fluorescence quantitative PCR.

Items	Genes	Primer sequences	GeneBank No.
	β-actin	F: TGCGTGACATCAAGGAGAAG	L08165
		R: TGCCAGGGTACATTGTGGTA
Lipid metabolism	PPARα	F: GCTTGTGAAGGTTGTAAGGGTT	NM_001001464.1
		R: GACATTCCAACTGAAAGGCAC
	FAS	F: ATTTGTTCGTCATCACCGTCTA	NM_001199487.1
		R: GCATATTAAGGTTTCGTAGGCTC
	ACC	F: AGACAACCAACGCCAAAGTG	NM_205505.1
		R:TGGTAGAAAAAGTTGGGTAGCAC
	LPL	F: TGGACAGATGGACAGCTTGG	NM_205282.1
		R: ATTTGAATCAGGTTCCCTCTTG
	CPT-1α	F: GCCACTTATGAATGATGAGGAG	NM_001012898.1
		R: ATTATTGGTCCACGCCCTC
Met metabolism	BHMT	F:GCCTGAAACAGGGCAAAAGG	XM_414685.7
		R:TCCCTGTGAAGCTGACGAAC
	CBS	F:ACGCATGCTAATCCGAGAGG	XM_040659743.2
		R:AGTTGGAAGCACAGTCAGGG
	MTR	F:GGCTCTTGGAGATCGACTGG	NM_001031104.2
		R:CGAGCTTCCACATGGTGAGT
Antioxidant related pathway (Cysteine metabolism+Antioxidant stress signaling pathwayNrf2/ARE)	CDO	F:TTCAGAGGTTAGATGCCTTTCC	XM_424964.3
		R:TTAGCACACTGAGAGTATCAGG
	GSS	F:CTCCAGGTGTGACACAAAGT	XM_425692.4
		R:CCTAATGCCTGTGTTCCTGAT
	Nrf2	F:GAGCCCATGGCCTTTCCTAT	NM_001007858.1
		R:CACAGAGGCCCTGACTCAAA
	GST	F:AGAGTCGAAGCCTGATGCAC	NM_001001777.1
		R:CACTCCGCTTATCAGCAAACA

Abbreviation: β-actin, beta-actin; PPARα, peroxisome proliferator-activated receptor alpha; FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase; LPL, lipoprotein lipase; CPT-1α, carnitine palmitoyltransferase-1 alpha; BHMT, Betaine-homocysteine methyltransferase; MTR, methionine synthase expression; CDO, Cysteine Dioxygenase; GSS, Glutathione Synthetase; Nrf2, nuclear factor erythroid 2-related factor 2; GST, Glutathione S-Transferase.

Statistical analysis

Data were organized and analyzed using a factorial arrangement. The statistical analyses were performed with SAS version 9.2. The Met sources, TSAA: Lys, and VE levels were considered as the main effects. The mean differences among the treatments were computed using the Post hoc procedure of Duncan's multiple-range tests. The normality of the data variance was checked using the Shapiro-Wilk test. Statistical significance was declared at P< 0.05.

Results

Production performance

The Met sources, TSAA: Lys, and VE levels and their interactions had no significant effects on the global production performance, including egg production, ADFI, FCR, and AEW, as shown in Table 5. However, in the Met sources, a higher TSAA: Lys ratio tended to decrease egg weight (P = 0.09), and a lower TSAA: Lys in combination with a higher level of VE tended to reduce FCR (P = 0.065).

Table 5.

Production performance of laying hens during 0-12 week of the experimental period.

Treatments		Egg production, %	ADFI, g/hen/d	FCR, feed(g)/egg(g)	AEW, g
Met source	DL-Met	78.28	114.85	2.353	62.55
	OH-Met	78.89	114.43	2.323	62.59
TSAA:Lys	0.90	77.76	113.86	2.326	63.09
	0.95	79.16	114.92	2.338	62.31
	1.00	78.84	115.16	2.350	62.32
VE level	20 IU	78.71	114.74	2.331	62.68
	40 IU	78.47	114.54	2.345	62.47
Pooled SEM		0.542	0.471	0.015	0.161
Probability (P value)
Met source		0.585	0.674	0.321	0.898
TSAA:Lys		0.566	0.529	0.804	0.090
VE level		0.830	0.840	0.651	0.523
Met source * TSAA:Lys		0.847	0.863	0.766	0.440
Met source * VE level		0.127	0.349	0.409	0.452
TSAA:Lys * VE level		0.371	0.869	0.065	0.440
Met source * TSAA: Lys * VE level		0.638	0.561	0.456	0.841

Abbreviation: ADFI, average daily feed intake (as-fed; gram/hen per day); FCR; feed conversion ratio (gram of feed/gram of egg); AEW, average egg weight; d, day; Met, methionine sources; DL-Met, DL-Methionine; OH-Met, DL-2-hydroxy-4-(methylthio)-butanoic acid; VE, vitamin E; TSAA: Lys, total sulfur amino acids to lysine ratio; IU, international unit; SEM, standard error of mean.

Egg quality

The egg quality traits were evaluated at the end of the 12-week experimental period, as shown in Table 6. We observed a tendency for better egg weight in the OH-Met group compared with the DL-Met group (P =0.060). Irrespective of the Met source, a higher TSAA: Lys ratio tended to decrease egg weight (P=0.061), while eggshell thickness tended to increase (P=0.044). The supplementation of VE at a higher level (40 IU) significantly decreased albumen height and Haugh unit (P < 0.05). The interaction between the DL-Met source and a higher level of VE (40 IU) significantly increased egg yolk color (P < 0.05). Additionally, OH-Met at 0.90 TSAA: Lys showed a tendency to increase yolk color (P=0.07).

Table 6.

Egg quality parameters at the end of 12 weeks of the experimental period.

Treatments		AEW, g	AH, mm	Yolk color	Haugh Unit	S. Strength, N	S. thickness, mm
Met source	DL-Met	65.83	6.28	8.18	75.39	37.42	0.455
	OH-Met	66.82	6.27	8.36	74.82	37.95	0.450
TSAA:Lys	0.90	67.21	6.13	8.34	73.64	36.89	0.446
	0.95	65.85	6.28	8.23	74.96	37.61	0.457
	1.00	65.91	6.42	8.25	76.73	38.56	0.454
VE level	20 IU	66.67	6.44	8.16	76.44	37.76	0.455
	40 IU	65.98	6.11	8.38	73.78	37.61	0.449
Pooled SEM		0.266	0.075	0.075	0.657	0.394	0.002
Probability (P value)
Met source		0.060	0.997	0.218	0.655	0.510	0.164
TSAA: Lys		0.061	0.268	0.783	0.147	0.247	0.044
VE level		0.187	0.030	0.125	0.041	0.861	0.153
Met source * TSAA:Lys		0.278	0.594	0.070	0.583	0.909	0.206
Met source * VE level		0.915	0.177	0.013	0.236	0.254	0.429
TSAA:Lys *VE level		0.601	0.622	0.888	0.655	0.551	0.519
Met source *TSAA:Lys*VE level		0.743	0.196	0.422	0.175	0.528	0.274

Abbreviation: AEW, average egg weight; g, gram; AH, albumen height; S, eggshell; N, Newton; mm, millimeter; Met, methionine; DL-Met, DL-Methionine.

OH-Met, DL-2-hydroxy-4-(methylthio)-butanoic acid; TSAA: Lys, levels of total sulfur amino acids to lysine ratio;VE, vitamin E; IU, international unit; SEM, standard error of mean.

Serum biochemical parameters

The DPP4 concentration was significantly lower in the OH-Met group compared with the DL-Met group (P < 0.05), while DPP4 was not influenced by TSAA: Lys, as shown in Table 7. Contrarily, the concentration of TC, LDL, and VLDL was reduced significantly in the DL-Met group (P < 0.05). The TG, TC, LDL, and VLDL concentration was significantly lower at the 0.95 TSAA: Lys compared with other TSAA: Lys ratios (P < 0.05). The study also demonstrated that TC concentration was decreased significantly at lower levels of VE (P < 0.05).

Table 7.

Blood biochemical parameters at the end of 12 weeks of the experimental period.

Treatments		DPP4, ng/ml	TG, mmol/L	TC, mmol/L	ALT, U/L	AST, U/L	LDL, mmol/L	VLDL, mmol/L
Met source	DL-Met	171.28	9.89	2.46	3.00	285.85	0.54	0.41
	OH-Met	162.99	10.13	2.77	3.47	278.93	0.65	0.44
TSAA:Lys	0.90	169.26	11.67	2.89	2.95	270.82	0.67	0.44
	0.95	163.34	7.66	2.28	3.31	282.78	0.49	0.39
	1.00	168.82	10.71	2.68	3.44	293.56	0.63	0.44
VE level	20 IU	164.96	8.85	2.46	3.28	275.67	0.57	0.41
	40 IU	169.32	11.18	2.77	3.19	289.11	0.62	0.43
Pooled SEM		2.985	0.776	0.089	0.300	8.167	0.033	0.009
Probability (P value)
Met source		0.028	0.844	0.034	0.206	0.594	0.035	0.024
TSAA:Lys		0.348	0.029	0.003	0.526	0.365	0.016	0.019
VE level		0.241	0.064	0.028	0.818	0.303	0.335	0.198
Met source * TSAA:Lys		0.385	0.071	0.309	0.200	<0.001	0.684	0.919
Met source *VE level		0.863	0.000	0.001	0.021	0.060	0.077	0.065
TSAA:Lys *VE level		0.171	0.030	0.087	0.119	0.107	0.362	0.349
Met source * TSAA:Lys * VE level		0.212	0.008	0.023	0.043	0.084	0.099	0.055

Abbreviation: DPP4, Dipeptidyl peptidase 4; TG, triglycerides; TC, total cholesterol; ALT, alanine aminotransferase; AST, aspartate aminotransferase, LDL, low-density lipoprotein; VLDL very low-density lipoprotein; ng/ml, nanogram per milliliter; mmol/L, millimole per litre; U/L, units per liter; Met, methionine sources (DL-Met and OH-Met); TSAA: Lys, levels of total sulfur amino acids to lysine ratio; VE, vitamin E; IU, international unit; SEM, standard error of mean.

DL-Met at 0.90 and OH-Met at 0.95 TSAA: Lys ratio significantly reduced AST activity compared with other levels of TSAA: Lys (P < 0.05). Regarding the interaction effects, VE supplementation at 40 IU level with the DL-Met source, and VE at 20 IU level with the OH-Met source significantly reduced TC, TG, and ALT contents (P < 0.05). Regardless of Met sources, a combination of TSAA: Lys at a ratio of 0.95 and VE at a 20 IU level resulted in the lowest TG content. Furthermore, the Met source, TSAA: Lys, and VE levels showed significant interaction effects on TG and TC concentrations. The interaction of DL-Met at 0.95 TSAA: Lys with VE at 20 IU level and OH-Met at 0.90 TSAA: Lys with VE at 20 IU level demonstrated reduced TG and TC activity. Conversely, the interaction of DL-Met at 1.00 TSAA: Lys with VE at 40 IU level and OH-Met at 0.90 TSAA: Lys with VE at 20 IU level resulted in reduced ALT concentration.

Liver indexes and hepatic lipid accumulation

The main effect of Met sources, TSAA: Lys, and VE level did not show significant impacts on liver index, as shown in Table 8. However, the interaction between the Met source and the TSAA: Lys had a significant effect on the liver index. The administration of DL-Met at a TSAA: Lys ratio of 0.90 resulted in a higher liver index (P < 0.05). The study also demonstrated that the interaction of DL-Met source with VE at a level of 20 IU significantly increased liver index (P < 0.05).

Table 8.

Liver indexes and lipids at the end of 12 weeks of the experimental period.

Treatments		Liver index, %	Fat, %	TG, mmol/gport	TC, mmol/gprot
Met source	DL-Met	1.98	23.49	0.24	0.063
	OH-Met	1.94	21.08	0.23	0.059
TSAA:Lys	0.90	2.03	23.43	0.25	0.062
	0.95	1.89	21.76	0.24	0.063
	1.00	1.96	21.67	0.21	0.058
VE level	20 IU	1.94	21.96	0.23	0.058
	40 IU	1.98	22.61	0.24	0.065
Pooled SEM		0.030	0.510	0.006	0.001
Probability (P value)
Met source		0.534	0.014	0.346	0.162
TSAA:Lys		0.138	0.231	0.039	0.297
VE level		0.423	0.495	0.649	0.011
Met source * TSAA:Lys		0.002	0.899	0.001	0.146
Met source * VE level		0.019	0.062	0.853	0.890
TSAA:Lys * VE level		0.948	0.260	0.853	0.979
Met source * TSAA:Lys * VE level		0.572	0.282	0.599	0.887

Abbreviation: TG, triglycerides; TC, total cholesterol; mmol/gport, millimole per gram of protein; Met, methionine sources (DL-Met and OH-Met); TSAA: Lys, levels of total sulfur amino acids to lysine ratio; VE, vitamin E; IU, international unit; SEM, standard error of mean.

The Met source, TSAA: Lys and VE level showed significant interaction effects on liver fat percentage, TG, and TC, respectively (P < 0.05). Birds in the OH-Met group had a lower fat percentage compared with those in the DL-Met group. The OH-Met at a TSAA: Lys ratio of 0.90 reduced TG concentrations in the liver. Regardless of the Met source, a TSAA: Lys ratio of 0.90 resulted in lower TG concentration compared with other TSAA: Lys ratios (P < 0.05). We also observed that the VE level at 20 IU significantly decreased TC concentrations in the liver (P < 0.05).

Liver antioxidant indices

Compared with the DL-Met source, the inclusion of the OH-Met resulted in a significant increase in both GSH and GSSG content, as well as a decrease in SOD activity (P < 0.05) (Table 9). Supplementation of TSAA: Lys at 0.95 showed significantly higher SOD and CAT activities compared with TSAA: Lys at 0.90 or 0.95 ratios (P < 0.05). Nevertheless, GSH content increased linearly with the increasing level of TSAA: Lys (P < 0.05). The SOD decreased as the level of the DL-Met source increased. In contrast, the group receiving OH-Met source at 0.95 TSAA: Lys showed increased SOD activity compared with other TSAA: Lys ratios within the OH-Met group. Both DL-Met at 0.95 TSAA: Lys and OH-Met at 0.90 TSAA: Lys levels demonstrated significantly reduced MDA content in the liver. Furthermore, DL-Met at 0.90 TSAA: Lys and OH-Met at 0.95 TSAA: Lys ratio showed a higher CAT activity compared with other TSAA: Lys ratios (P < 0.05).

Table 9.

Liver antioxidant indices at the end of 12 weeks of the experimental period.

Treatments		SOD, U/mgprot	MDA, nmol/mgprot	GSH, μmol/gprot	GSSG, μmol/gprot	CAT, U/mgprot
Met source	DL-Met	106.94	0.66	9.19	8.21	45.98
	OH-Met	100.90	0.69	10.75	9.20	46.71
TSAA:Lys	0.90	103.44	0.64	9.08	8.85	48.20
	0.95	110.81	0.67	10.00	8.09	48.59
	1.00	97.51	0.72	10.82	9.18	42.24
VE level	20 IU	103.01	0.66	10.34	8.32	44.88
	40 IU	104.83	0.70	9.59	9.09	47.81
Pooled SEM		1.659	0.015	0.220	0.209	0.935
Probability (P value)
Met source		0.041	0.333	<0.001	0.017	0.637
TSAA:Lys		0.002	0.120	0.003	0.089	0.002
VE level		0.531	0.275	0.068	0.057	0.062
Met source * TSAA:Lys		0.001	0.001	0.826	0.021	<0.001
Met source *VE level		0.528	0.957	0.654	0.793	0.428
TSAA:Lys * VE level		0.569	0.929	0.777	0.290	0.956
Met source *TSAA:Lys * VE level		0.301	0.970	0.966	0.697	0.715

Abbreviation: SOD, superoxide dismutase; MDA, malondialdehyde; GSH, Glutathione; GSSG, glutathione disulfide; CAT, catalase activities; U/mgprot, unit per milligram of protein; nmol/mgprot, nanomole per milligram of protein; μmol/gprot, micromole per gram of protein; Met, methionine sources (DL-Met and OH-Met); TSAA: Lys, levels of total sulfur amino acids to lysine ratio; VE, vitamin E; IU, international unit; SEM, standard error of mean.

Liver histopathological changes

As shown in Table 10, livers with varying levels of damage were counted in each treatment group. To visually represent the effects of dietary treatments, histopathological changes were categorized into three main degrees of liver damage; (1) no liver damage, (2) mild liver damage, and (3) severe liver damage, as illustrated in Fig. 1, Fig. 2, Fig. 3, respectively. A higher number of normal livers were observed in the OH-Met at 0.90 TSAA: Lys combined with VE at 20 IU levels compared to other treatment groups, as shown in Table 10. The normal liver slices exhibited no glaring pathological alterations; evident tissue capsule structure of the liver; the central vein was at the center of each lobule, and the liver cells and hepatic sinusoids that surrounded it were roughly distributed radially. The portal spaces between adjacent hepatic lobules were unremarkable, and the liver cells appeared spherical and plump, with no apparent extensions or extrusions, as illustrated in Fig. 1. A mild degree of liver damage is characterized by the replacement of hepatocyte cytoplasm with fat, the presence of various sizes of vacuoles in the cytoplasm (indicated by yellow arrows in Fig. 2), and focal infiltration of lymphocytes around blood vessels in the portal area (indicated by blue arrows in Fig. 2). A higher number of mild cases of liver damage were observed in the OH-Met groups at 0.90 TSAA: Lys level combined with a higher level of VE compared to other treatment groups. This study also identified several “severely damaged” livers exhibiting fatty degeneration of hepatocytes. In these cases, the cytoplasm of the hepatocytes was replaced by fat, resulting in vacuoles of varying sizes within the cytoplasm (indicated by the yellow arrow in Fig. 3). Additionally, a small amount of focal lymphocytic infiltration was observed around a few veins (indicated by the blue arrow in Fig. 3) at the lower level of VE (20 IU) combined with all levels of the DL-Met group, as well as a higher level of VE (40 IU) combined with a higher level of OH-Met treatment.

Table 10.

Number of livers with lesion in the 12 treatment groups.

Items	OH-Met						DL-Met
	T1	T2	T3	T4	T5	T6	T7	T8	T9	T10	T11	T12
TSAA:Lys	0.90	0.95	1.00	0.90	0.95	1.00	0.90	0.95	1.00	0.90	0.95	1.00
VE level	20 IU	20 IU	20 IU	40 IU	40 IU	40 IU	20 IU	20 IU	20 IU	40 IU	40 IU	40 IU
Normal, N	5	4	4	3	3	4	2	4	3	2	4	3
Mild, N	1	1	2	3	2	1	3	1	2	4	2	3
Severe, N	-	1	-	-	1	1	1	1	1	-	-	-

Abbreviations: OH-Met, DL-2-hydroxy-4-(methylthio)-butanoic acid; DL-Met, DL-Methionine; TSAA: Lys, levels of total sulfur amino acids to lysine ratio; VE, vitamin E; IU, international unit; N = number of liver with lesion, the number of livers in each treatment group categorized into normal (no lesion), mild lesion, and severe lesion); a total of 6 livers were assessed per each treatment group (N=6).

Fig. 1.

Absence of liver lesion: normal.

Fig. 2.

Mild liver lesion; blue arrows indicates focal infiltration of lymphocytes around blood vessels in the portal area; yellow arrows indicates the cytoplasm of the hepatocytes being replaced by fat observation, various size of vacuoles in the cytoplasm.

Fig. 3.

Severe liver lesion; yellow arrow in showed fatty degeneration of hepatocytes, the cytoplasm of hepatocytes was replaced by fat, vacuoles of different sizes in the cytoplasm; blue arrow indicates a small amount of focal infiltration of lymphocytes around a few veins.

Liver mRNA expressions

The fatty acid synthase (FAS) and carnitine palmitoyltransferase-1 alpha (CPT-1α) mRNA expression levels were significantly higher in the OH-Met group compared to the DL-Met group (P < 0.05) (Table 11). The TSAA: Lys ratio of 0.95 had an up regulatory effect on the expression of FAS, LPL, andCPT-1α (P < 0.05). The results also indicated that the expression of ACC and LPL were upregulated with VE supplementation at a level of 40 IU (P < 0.05). Additionally, there was a significant interaction between the Met sources and the VE levels for the expression of CPT-1α (P < 0.05). The combined supplementation of the OH-Met source with VE at a level of 20 IU resulted in a significant increase in CPT-1α expression compared to other combinations of Met source and VE levels (P < 0.05).

Table 11.

mRNA expression of lipid metabolism genes.

Treatments			PPARα, U/mgprot	FAS, U/mgprot	ACC, U/mgprot	LPL, U/mgprot	CPT-1α, U/mgprot
Met source	DL-Met		1.122	1.114	1.149	1.176	1.225
	OH-Met		1.188	1.219	1.137	1.123	1.389
TSAA:Lys	0.90		1.177	1.084	1.135	0.998	1.191
	0.95		1.211	1.210	1.169	1.338	1.379
	1.00		1.077	1.204	1.125	1.114	1.351
VE level	20 IU		1.104	1.190	1.055	1.106	1.329
	40 IU		1.206	1.142	1.231	1.193	1.285
Pooled SEM			0.026	0.022	0.028	0.027	0.032
Probability (P value)
Met source		0.207		0.012	0.838	0.210	0.006
TSAA:Lys		0.094		0.022	0.805	<0.001	0.020
VE level		0.051		0.250	0.003	0.040	0.438
Met source * TSAA:Lys		0.464		0.597	0.966	0.069	0.323
Met source * VE level		0.503		0.163	0.677	0.953	0.022
TSAA:Lys * VE level		0.790		0.969	0.787	0.864	0.218
Met source * TSAA:Lys *VE level		0.554		0.433	0.667	0.843	0.309

Abbreviation: PPARα, peroxisome proliferator-activated receptor alpha; FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase; LPL, lipoprotein lipase; CPT-1α, carnitine palmitoyltransferase-1 alpha; U/mgprot, unit per milligram of protein; Met, methionine sources (OH-Met, DL-2-hydroxy-4-(methylthio)-butanoic acid; DL-Met, DL-Methionine); TSAA: Lys, levels of total sulfur amino acids to lysine ratio;VE, vitamin E; IU, international unit; SEM, standard error of mean.

Although the expression of BHMT and CBS was not significantly influenced by the inclusion of both the DL-Met and the OH-Met sources, the expression of BHMT with the DL-Met supplemented diet and CBS with OH-Met supplemented diet tended to be higher, as shown in Table 12. The expression of CBS significantly increased at the 0.95 TSAA: Lys compared to other TSAA: Lys ratios (P < 0.05).

Table 12.

mRNA expression of the methionine metabolism genes.

Treatments		BHMT, U/mgprot	CBS, U/mgprot	MTR, U/mgprot
Met source	DL-Met	1.026	1.252	1.014
	OH-Met	0.950	1.339	1.000
TSAA:Lys	0.90	1.027	1.219	1.047
	0.95	0.935	1.361	0.955
	1.00	1.002	1.307	1.019
VElevel	20 IU	1.003	1.303	0.988
	40 IU	0.973	1.288	1.025
Pooled SEM		0.023	0.024	0.023
Probability (P value)
Met source		0.096	0.070	0.782
TSAA:Lys		0.234	0.049	0.283
VE level		0.512	0.754	0.443
Met source * TSAA:Lys		0.160	0.654	0.559
Met source *VE level		0.928	0.626	0.681
TSAA:Lys * VE level		0.705	0.718	0.649
Met source * TSAA:Lys * VE level		0.812	0.294	0.461

Abbreviation: BHMT, betaine-homocysteine methyltransferase; CBS, cystathionine beta-synthase; MTR, methionine synthase expression; U/mgprot, unit per milligram of protein; Met, methionine sources (OH-Met, DL-2-hydroxy-4-(methylthio)-butanoic acid; DL-Met, DL-Methionine); TSAA: Lys, total sulfur amino acids to lysine ratio; VE, vitamin E;IU, international unit; SEM, standard error of mean.

Table 13 present the mRNA expression levels of genes involved in the antioxidant-related pathway. The expression of GSS and Nrf2 in the OH-Met group was significantly higher than in the DL-Met group (P<0.05). As the TSAA: Lys ratio increased, the GSS expression exhibited a linear increase, while Nrf2 expression significantly increased at 0.95 TSAA: Lys (P < 0.05). GSS was higher in the diet supplemented with VE at a level of 20 IU compared to 40 IU level (P < 0.05). Moreover, there was a significant interaction between Met source and TSAA: Lys for GSS and Nrf2 expression (P < 0.05). Briefly, OH-Met at 0.95 and 1.00 TSAA: Lys showed significantly higher GSS and Nrf2 expression, respectively. Moreover, a significant interaction effect was observed between TSAA: Lys and VE level on Nrf2 (P < 0.05). Nrf2 expression was highest at a 0.95 TSAA: Lys ratio combined with a 20 IU level of VE. The result also indicated that the combination of OH-Met at 0.95 TSAA: Lys ratio and 40 IU level of VE resulted in significantly higher Nrf2 expression (P < 0.05).

Table 13.

mRNA expression of genes in the antioxidant-related pathway.

Treatments		CDO, U/mgprot	GSS, U/mgprot	Nrf2, U/mgprot	GST, U/mgprot
Met source	DL-Met	0.993	1.113	1.013	1.061
	OH-Met	1.068	1.463	1.127	1.038
TSAA:Lys	0.90	1.021	1.070	0.995	1.020
	0.95	1.048	1.325	1.272	1.046
	1.00	1.022	1.468	0.943	1.082
VE level	20 IU	1.043	1.344	1.050	1.036
	40 IU	1.018	1.231	1.090	1.063
Pooled SEM		0.027	0.040	0.036	0.030
Probability (P value)
Met source		0.166	<0.001	0.006	0.710
TSAA:Lys		0.897	<0.001	<0.001	0.708
VE level		0.658	0.048	0.311	0.655
Met source * TSAA:Lys		0.161	0.034	<0.001	0.089
Met source * VE level		0.859	0.512	0.747	0.679
TSAA:Lys * VE level		0.181	0.793	0.034	0.707
Met source * TSAA:Lys * VE level		0.538	0.842	0.011	0.489

Abbreviation: CDO, Cysteine Dioxygenase; GSS, Glutathione Synthetase; Nrf2, Nuclear Factor Erythroid 2-Related Factor 2, GST, Glutathione S-Transferase; U/mgprot, unit per milligram of protein; Met, methionine sources (OH-Met, DL-2-hydroxy-4-(methylthio)-butanoic acid; DL-Met, DL-Methionine); TSAA: Lys, levels of total sulfur amino acids to lysine ratio;VE, vitamin E; IU, international unit; SEM, standard error of mean.

Discussion

Aging is a normal physiological process that is typically accompanied by elevated levels of ROS and the diminishing ability of the intrinsic antioxidant system to neutralize free radicals and peroxides, which disturb the redox balance (Lee et al., 2004; Estevez, 2015). The performances of laying hens primarily decline due to age related digestive and reproductive changes (Peebles et al., 2006; Gu et al., 2021) that alter internal metabolic pathways (Wang et al., 2019) and gut microbiota (Wang et al., 2020). These changes can adversely affect the health and well-being of aged birds (Bernardi et al., 2018). Hence, dietary manipulations of amino acids and vitamins have been employed to alleviate stressors in aged laying hens (Abd El-Hack et al., 2020; Akinyemi and Adewole, 2021), thereby maintaining the health and improving the performance of aged chickens (Abdel-Moneim et al., 2021). In the present study, OH-Met tended to increase egg weight and yolk color compared to the DL-Met group, while higher TSAA: Lys and VE levels decreased egg weight, albumen height, and Haugh unit. Earlier studies indicated that VE supplementation at 200 mg/kg decreased the percentage of albumin but increased the percentage of yolk in laying hens (Ciftci et al., 2005; Jiang et al., 2013). Additionally, the TSAA: Lys ratio is an important consideration in the diets of laying hens. Novak et al. (2006) found no influence of using a high TSAA: lysine ratio on egg weight during the period of 20-43 and 44-63 week of age, respectively. Unlike their findings, higher TSAA: Lys levels tended to decrease egg weight in our study. The possible explanation for the difference in these results could be attributed to the older hens and the higher level of TSAA: lysine (1.00 vs 0.97) in our study compared to the study of Novak et al., (2006). The requirement for Lys would reduce in aged laying hens, but an increase in the requirement for TSAA is expected due to their role in maintenance (Novak et al., 2006). However, our results showed that there is a likelihood that TSAA requirements of older hens for egg weight may not change.

DPP4 is a membrane protein found in many tissues and is cleaved by a protease before being released into the bloodstream (Nargis and Chakrabarti, 2018). However, the liver is primarily responsible for the elevated plasma DPP4 levels observed in mice (Varin et al., 2019) and in laying hens with fatty livers (Tsai et al., 2017). In humans, elevated levels of DPP4 are usually found during obesity, type-2 diabetes, and non-alcoholic fatty liver disease (Nargis and Chakrabarti, 2018; Niu et al., 2019). It has also been implicated in impaired glucose homeostasis, hepatic lipid deposition, and insulin resistance (Xiao et al., 2014). In our study, the level of DPP4 expression and fat % in the liver was significantly lower in the OH-Met group, while the TC, LDL, and VLDL concentrations were significantly higher in this group. The study also showed the upregulated mRNA expression of FAS, and CPT-1α in the OH-Met group. These findings suggest a potentially positive effect of OH-Met supplementation on DPP4 activity and beneficial changes in lipid metabolism, mediated by the modulation effects of mRNA expression of lipid metabolism-related genes (Zeitz et al., 2020; Li et al., 2023), as validated by a lower fat % in liver of hens fed OH-Met diets. Previously, DL-Met supplementation significantly increased the expression of genes related to lipid catabolism and reduced lipid accumulation in the liver of broilers (Peng et al., 2018), while L-Met supplementation also decreased TC and LDL levels (Navik et al., 2022). Likewise, DL-Met significantly reduced VLDL levels in laying hens (Zhang et al., 2023). The current study also showed that TC concentration was significantly reduced at the low level of VE (20 IU). This reduction was not associated with significantly lower LPL and ACCgene expression at this level of VE inclusion, indicating impaired lipid utilization and preventing fat deposition (Li et al., 2023). In contrast, a higher level of VE was required to observe significant improvements in blood biochemical parameters, as Guo et al. (2020) reported 600 IU/kg, and Li et al. (2017) reported 200 IU/kg VE significantly reduced DPP4. Similarly, Zhang et al. (2019) found that supplementing 400 IU/kg of VE significantly decreased TC, LDL, and VLDL levels. Our results also demonstrated that the effective level of VE depends on the Met source to regulate TC, TG, and ALT contents in the serum. A lower level of VE was needed with the OH-Met Met source to significantly enhance these parameters, indicating a synergistic effect of OH-Met with VE.

Oxidative stress is exacerbated by certain structural changes in aging hepatocytes, such as reduced cell volume and accumulation of a highly oxidized cross-linked lipoprotein “lipofuscin” (Pinto et al., 2020). Therefore, aging can accelerate hepatic stress and lipid metabolic disorders (Xiong et al., 2014). Recently, Gu et al. (2021) observed a decline in several serum and liver tissue antioxidant enzymes in aged hens. Indeed, antioxidant enzymes such as SOD, CAT, and GSH-Px are vital components of the antioxidant defense system (Cadenas and Davies, 2000) that can help to mitigate oxidative stress. According to a previous report, approximately 20% of dietary Met intake is transsulfurated to cysteine via homocysteine. In turn, cysteine participates in GSH synthesis which is a potent cellular antioxidant (Bauchart-Thevret et al., 2009). Numerous studies on broilers also confirmed that higher supplementation of Met would invariably increase GSH concentration (Nemeth et al., 2004; Chen et al., 2013; Shen et al., 2015). In this study, apart from higher GSH, SOD, and CAT activities, the MDA content was also decreased with supplementation of both DL-Met and OH-Met sources. Nevertheless, supplementation of OH-Met significantly increased the levels of GSH, and GSSG compared to DL-Met source. This data was further supported by CβS gene expression that tended to increase with OH-Met group supplementation compared to the DL-Met group (P = 0.07) and higher expression of GSS in the OH-Met group potentially indicating higher transsulfuration of OH-Met into its downstream metabolites i.e. cysteine and GSH supporting the antioxidant defense system. Our results are consistent with earlier reports wherein OH-Met increased antioxidant potential compared to DL-Met (Swennen et al., 2011; Willemsen et al., 2011; Jankowski et al., 2017). We also found that GSH content linearly increased with the increase of TSAA: Lys up to 1.00. Clearly, TSAA: Lys at 0.95 showed higher SOD and CAT activities, particularly OH-Met at 0.95 of TSAA: Lys increased SOD activity. Previous work also reported that Met levels inhibited oxidative stress in broilers (Swennen et al., 2011; Chen et al., 2013) and in turkeys (Kubinska et al., 2016; Jankowski et al., 2016a). In addition, the hepatic level of GSH was improved in a quadratic manner with different Met levels in laying duck breeders (Ruan et al., 2018).

Nrf2-Keap1 system signal transduction pathway is one of the quickest responding systems to the changing environment, and it can upregulate the antioxidant defense networks (Kovac et al., 2015; Pomatto and Davies, 2018). The disruption of the Nrf2-Keap1 complex relocates Nrf2 to the nucleus (Sahin et al., 2013; Seymour et al., 2013) where it binds to antioxidant-responsive elements and induces transcription of multiple genes related to antioxidant and anti-inflammatory functions (Stefanson and Bakovic, 2014; Ahmed et al., 2017). In this regard, upregulated expression of Nrf2 by a complex interaction effect of a higher VE level with OH-Met group at 0.95 TSAA: Lys in this study indicated a better redox balance and maintenance of antioxidant defense networks.

Data availability

All datasets generated for this study are available within the article.

Disclosures

Tahir Mahmood and Yves Mercier are employees of Adisseo France SAS.

Conclusions

Taken together, our study showed that production performance was not influenced by Met sources, while OH-Met had beneficial effects on maintaining normal liver function in aged laying hens through improvements in the glutathione synthetase pathway and CPT-1α. In addition, the TSAA: Lys ratio at 0.95 combined with 20 IU of VE appears to be optimal for sustaining laying performance and improved liver health in aged laying hens by modifying lipid metabolism. This includes the regulation of fatty acid synthase and the enhancement of hepatic antioxidative functions, such as activation of Nrf2, catalase activity, and GSSG.

CRediT authorship contribution statement

Guangtian Ma: Data curation, Investigation, Formal analysis. Habtamu Ayalew: Writing – original draft. Tahir Mahmood: Conceptualization, Writing – review & editing. Yves Mercier: Conceptualization, Writing – review & editing. Jing Wang: Writing – review & editing. Jing Lin: Data curation, Investigation, Formal analysis. Shugeng Wu: Writing – review & editing. Kai Qiu: Writing – review & editing. Guanghai Qi: Writing – review & editing. Haijun Zhang: Conceptualization, Writing – review & editing.

Declaration of competing interest

The authors declare that there is no any a conflict interest in terms of financial or personal relationships that could have appeared to influence the publication of this work.