Skip to main content
NCBI home page
Springer logoLink to Springer
. 2024 Oct 22;55(6):1259–1270. doi: 10.1007/s10735-024-10267-5

CLDN11 deficiency upregulates FOXM1 to facilitate breast tumor progression through hedgehog signaling pathway

Leyi Yang 1,#, Xiaoping Wang 1,#, Qinghai Lin 1,✉, Guoyi Shen 2, Hong Chen 3
PMCID: PMC11567981  PMID: 39438406

Abstract

Claudins (CLDNs) play a crucial role in regulating the permeability of epithelial barriers and can impact tumor behavior through alterations in their expression. However, the precise mechanisms underlying the involvement of CLDNs in breast cancer progression remain unclear. This study aimed to investigate the role of CLDN11 in breast cancer progression. Utilizing the TCGA database and clinical specimens from breast cancer patients, we observed reduced expression of CLDN11 in tumor tissues, which correlated with poor prognosis in breast cancer patients. In vitro, silencing of CLDN11 enhanced the proliferative and migratory characteristics of breast cancer cell lines MCF-7 and MDA-MB-231. Mechanistically, CLDN11 deficiency promoted the upregulation of Forkhead Box M1 (FOXM1) by activating the hedgehog signaling pathway, thereby sustaining tumor progression in breast cancer. In vivo, blockade of hedgehog signaling suppressed the tumor progression induced by CLDN11 silencing. Our study highlights the significance of the CLDN11/FOXM1 axis in breast cancer progression, suggesting CLDN11 as a potential diagnostic indicator and therapeutic target for clinical therapy.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10735-024-10267-5.

Keywords: CLDN11, FOXM1, Hedgehog signaling, Breast cancer

Introduction

Breast cancer is a prevalent malignancy that impacts women worldwide, with approximately 2.3 million new cases reported in 2020, comprising 11.7% of all new cancer cases (Sung et al. 2021). It is also a leading cause of cancer-related mortality, with an estimated 684,996 deaths attributed to breast cancer in 2020 (Sung et al. 2021). Presently, diverse treatment modalities are available for managing breast cancer, including surgery, chemotherapy, radiotherapy, endocrine therapy, and molecular-targeted therapy (Trayes and Cokenakes 2021a). With the help of modern prevention methods and various detection methods, early removal of breast tumors is better achieved (Radenkovic et al. 2014). New possibilities for tumor treatment are constantly being researched and new compounds are tested, which have been validated in various studies (Scherbakov et al. 2023). Despite the array of treatment options, the prognosis for breast cancer remains relatively unfavorable, partially attributed to tumor advancement and metastasis (Lu et al. 2009). Nevertheless, the exact molecular mechanisms propelling breast cancer advancement remain incompletely elucidated. Therefore, unraveling the mechanisms of tumor progression will hold promise for the early diagnosis and precise treatment of breast cancer.

Claudin-11 (CLDN11), a pivotal tight junction protein primarily involved in normal reproductive system functions, belongs to the claudin family (Lal-Nag and Morin 2009). Claudins (CLDNs), integral membrane proteins forming tight junction strands, act as barriers preventing free solute and water movement across epithelial or endothelial cell sheets, crucial for maintaining cell polarity and signaling transduction (Lal-Nag and Morin 2009; Tsukita et al. 2019). CLDNs include up to 27 members in mammals that exhibit a high degree of sequence homology (Mineta et al. 2011). The abnormal expression and functions of CLDNs in various cancers have garnered significant attention since their discovery. For instance, decreased CLDN7 expression has been observed in metastatic breast cancer, invasive ductal carcinomas, and head and neck cancer (Kominsky et al. 2003; Usami et al. 2006; Sauer et al. 2005). It has been suggested that decreased CLDN expression may promote tumor progression by affecting cell adhesion (Singh et al. 2010). Conversely, claudins such as CLDN3 and CLDN4 are frequently upregulated in cancers like breast cancer, prostate, uterine, ovarian, and pancreatic ductal adenocarcinoma (Michl et al. 2003; Rangel et al. 2003). The upregulated expression of claudin proteins may facilitate tumor progression by promoting cell migration, invasion, and metastasis (Agarwal et al. 2005; Zavala-Zendejas et al. 2011). Overall, CLDNs, including CLDN1, 3, 4, and 7, display diverse expression profiles in different cancers and play a significant role in tumorigenesis and metastasis. Besides the aforementioned CLDNs, CLDN11 has also been found to be involved in invasion and metastasis of bladder and gastric cancer (Awsare et al. 2011; Yang et al. 2017; Agarwal et al. 2009). However, reports on CLDN11 are relatively sparse, and its specific role in breast cancer remains unclear, necessitating further investigation.

Among the numerous pathways involved in tumorigenesis, the FOXM1 transcription factor and the Hedgehog signaling pathway play pivotal roles. FOXM1, a member of the Forkhead box family of transcription factors, is crucial for regulating cell cycle progression, DNA damage repair, and apoptosis (Sher et al. 2022). It is predominantly expressed during the G1/S and G2/M phases of the cell cycle, where it promotes the transcription of genes essential for DNA replication and mitosis, such as Cyclin B1, PLK1, and CDC25B. FOXM1 is often overexpressed in various cancers, including breast, prostate, liver, and lung cancers, with its overexpression correlating with poor prognosis, high tumor grade, and increased metastatic potential (Khan et al. 2023). Increasing evidence suggests that FOXM1 can modulate the Hedgehog signaling pathway by regulating the expression of its components, including Gli1 and PTCH1, creating a positive feedback loop that sustains pathway activation (Sigafoos et al. 2021). The Hedgehog signaling pathway is essential for embryonic development, regulating cell differentiation, tissue patterning, and stem cell maintenance. Aberrant activation of the Hedgehog signaling is implicated in the pathogenesis of several cancers, including basal cell carcinoma, medulloblastoma, and pancreatic cancer (Jiang 2022). However, the correlation between CLDNs and the FOXM1/Hedgehog signaling pathway remains poorly understood.

In this study, we identified low expression of CLDN11 in tumor tissues, which was associated with poor prognosis in patients. We further elucidated that CLDN11 deficiency activates the Hedgehog signaling pathway to promote the upregulation of FOXM1, thereby maintaining the molecular mechanism of tumor progression in breast cancer. Our research elucidates the CLDN11/Hedgehog/FOXM1 mechanism, enhancing breast cancer development understanding.

Materials and methods

Cell culture and reagents

The human breast cancer cell lines MCF-7 and MDA-MB-231 were obtained from the American Tissue Culture Collection (USA) and cultured according to their recommendations. Cells were maintained in Dulbecco’s Modified Eagle’s Medium (Invitrogen, USA) supplemented with 10% fetal calf serum. The FOXM1 inhibitor RCM-1 was sourced from Selleck (USA), while the Hedgehog signaling pathway inhibitor Hedgehog IN-3 was obtained from MedChemExpress (USA).

Patient information

Specimens were collected from 26 patients with histologically confirmed breast cancer diagnoses. According to the American Joint Committee on Cancer tumor node metastasis staging system, patients were categorized into two groups: lymphatic metastatic (n = 14) or non-lymphatic metastatic (n = 12). Clinical experiments adhered to the principles outlined in the Declaration of Helsinki and were approved by the Ethics Committee of Fujian Medical University (2022KYB149). Transcriptome profiles of normal tissues (n = 292) and tumor tissues from patients sourced from The Cancer Genome Atlas (TCGA) database (n = 1092), along with survival information, were obtained from Cbioportal and the Sanger database as descripted (Gao et al. 2013).

Cell proliferation assay

A total of 2000 cells treated with scramble or CLDN11 siRNAs were seeded into 96-well plates and cultured in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal calf serum for 48 h. The CCK-8 assay was performed following the manufacturer’s instructions (CCK-8 assay kit, Biyuntian, China). Each experiment was repeated at least three times.

Cell migration assay

MCF-7 and MDA-MB-231 cells treated with scramble or CLDN11 siRNAs were cultured to a 90% confluence monolayer and then maintained in fetal calf serum-free medium for 12 h. Matrigel (Corning, USA) was applied to the upper Boyden chamber (Corning, USA) in 24-well plates and incubated at 37 °C for 15 min. Subsequently, medium containing 10% fetal calf serum was added to the 24-well plate, and the cells were supplemented with Matrigel and cultured at 37 °C. After 12 h, migrating cells were stained with crystal violet and quantified.

RNA interference

The siRNA silencing experiments were conducted following previously established protocols (Ashikari et al. 2017). Non-silencing scramble siRNA (5’-GUAGGAGUAGUGAAAGGCC-3’) and siRNA pools targeting CLDN11 (5’-GACCACCAUCGUGAGCUUUUU-3’ and 5’-AAAGCUCACGAUGGUGGUCUU-3’) were procured from Sangon (China).

Quantitative polymerase chain reaction (qPCR)

MCF-7 and MDA-MB-231 cells were treated with scramble or CLDN11 siRNAs. Total RNA extraction and cDNA synthesis were performed as previously described (Bianchi et al. 2010). Amplification reactions were carried out using 1 µg of cDNA on an ABI-PRISM 7900HS Sequence Detection System (Applied Biosystems, USA). The normalized mRNA level was calculated as ΔCt = Ct (test gene) − Ct (mean for the reference gene). The resulting data were presented as the fold-difference between the test and control samples, defined as 2^ (ΔCt test − ΔCt control). Primer sequences are listed below:

Gene Forward primer (5’-3’) Reverse primer (5’-3’)
SMO GAAGTGCCCTTGGTTCGGA GCAGGGTAGCGATTCGAGTT
PTCH1 GAAGAAGGTGCTAATGTCCTGAC GTCCCAGACTGTAATTTCGCC
PTCH2 GCTTCGTGCTTACTTCCAGGG CATGCGGAGACCTAATGCCA
CLDN11 ACGGGGCTGTACCACTGCAA CAGGACCGAGGCAGCAATCATCAG
β-Actin CCTGAGGCACTCTTCCAGCCTT TGCGGATGTCCACGTCACACTTC
Open in a new tab

Western blotting

MCF-7 and MDA-MB-231 cells were treated with scramble or CLDN11 siRNAs, followed by harvesting and treatment with RIPA Lysis and Extraction Buffer (Thermo Fisher, USA). Western blotting was conducted using primary antibodies against CLDN11 (1:500, 36-4500, Thermo Fisher, USA), FOXM1 (1:1000, ab207298, Abcam, UK), Gli1 (1:1000, ab134906, Abcam, UK), and Gli2 (1:1000, PA5-79314, Thermo Fisher, USA). The antibody dilution buffer (abs954, Absin, China) was used to dilute primary antibodies (1:500 ~ 1000) and secondary antibody (1:1000). Samples were incubated with primary antibodies at 4 ℃ overnight, and secondary antibodies for two hours at room temperature. Each sample was loaded with 20 µg of proteins for western blotting. The procedure followed the protocol provided by Abcam and was visualized using ECL Western Blotting reagents (Thermo Fisher, USA) via chemiluminescence.

Immunostaining staining

Tissue samples obtained from breast cancer patients underwent deparaffinization and antigen retrieval by microwave heating as previously descripted (Radenkovic et al. 2019). Subsequently, the samples were treated with 0.3% H2O2 for blocking, followed by incubation in 10% bovine serum albumin for 40 min. Primary antibodies against CLD11 (1:200, 36-4500, Thermo Fisher, USA) and FOXM1 (1:200, ab207298, Abcam, UK), Ki-67 (1:500, ab15580, Abcam, UK) and N-cadherin (1:200, ab76011, Abcam, UK) were applied, with sequential overnight incubation at 4℃. Visualization of the antigen-antibody complexes was achieved using DAB or fluorescent chromogenic solution. Images were captured under a photon microscope (40 ×). Immunohistochemical assessment was conducted using Image J software version 6.0 (USA).

Animal protocols

MCF-7 cells were pre-treated with scramble or CLDN11 siRNAs before being injected into female NOD-SCID mice aged 6–8 weeks via subcutaneous injection (1 × 106 cells per mouse, with 6 mice per group). Additional subcutaneous injections of scramble or CLDN11 siRNAs were administered to the mice on days 7 and 14. For the analysis of hedgehog-IN3 anticancer effects, MCF-7-bearing mice treated with scramble or CLDN11 siRNAs were further treated with PBS or hedgehog-IN3 (5 mg/kg) on days 7 and 14 via subcutaneous injection. Tumor volume was recorded using the formula: tumor volume = length × width^2/2. The animal studies were conducted in compliance with the Public Health Service Policy and adhered to the WHO guidelines for the ethical use and care of animals (2024-0005).

Statistical analysis

Statistical differences between each group’s results and its corresponding control were assessed using one-way ANOVA with a Student’s t-test. A P-value < 0.05 was deemed statistically significant. Each experiment was repeated in three independent times. Statistical analyses were performed using GraphPad Prism 6.2 software (USA).

Results

CLDN11 deficiency facilitates breast cancer progression

To explore the potential association between CLDNs and breast cancer progression, we evaluated the impact of CLDN1 ~ 20 expression on the overall survival of breast cancer patients. Using data from the TCGA database, we categorized 1044 breast cancer patients into high and low expression CLDNs groups according to the median expression of CLDN11. Our analysis revealed that reduced expression of CLDN11 and CLDN19 was associated with a poor prognosis in breast cancer patients (Fig. 1A). Previous studies have indicated that CLDN19 loss amplifies malignant potential and correlates with a poorer prognosis in breast cancer (Xu et al. 2022). Consequently, we focused our attention on elucidating the role of CLDN11 in breast cancer progression. We further investigated the transcriptome expression of CLDN11 in normal tissues (n = 292) and breast tumor tissues from TCGA-derived patients (n = 1092). Notably, CLDN11, which was significantly downregulated in breast tumors compared to normal tissues, exhibited further reduction in patients with advanced clinical stage (Stage IV) (Fig. 1B and C). Additionally, elevated expression of CLDN11 was found in male breast cancer patients (Fig. S1A), and no obvious difference of CLDN11 expression was found in M0/M1 or N0/N1/N2/N3 breast cancer patients (Fig. S1B and C). Given the correlation between reduced CLDN11 expression and poor prognosis in breast cancer patients, we examined whether CLDN11 deficiency could promote the growth and aggressiveness of breast cancer cells. Accordingly, we silenced CLDN11 expression (at mRNA level) in breast cancer cell lines MCF-7 and MDA-MB-231 using siRNA interference (Fig. 1D) and subsequently analyzed cell proliferation and migration. As expected, CLDN11 silencing augmented proliferative and migratory phenotypes in MCF-7 and MDA-MB-231 cells (Fig. 1E and F). Elevated protein expression of proliferation marker (Ki-67) and migrative marker (N-cadherin) were found in MCF-7 and MDA-MB-231 cells treated CLDN11 siRNAs (Fig. S1D), highlighting the tumor suppressive role of CLDN11. To validate these findings, breast tumor specimens from clinical patients were divided into lymphatic metastatic (n = 14) and non-lymphatic metastatic (n = 12) groups, and CLDN11 expression was assessed via immunostaining. Consistently, reduced CLDN11 expression was detected in tumor tissues from the lymphatic metastatic group (Fig. 1G). Taken together, these results suggest that CLDN11 deficiency predicts a poor prognosis and promotes tumor development in breast cancer.

Fig. 1.

Fig. 1

Open in a new tab

CLDN11 deficiency facilitates breast cancer progression. A, Kaplan-Meier overall survival curve was shown according to high and low expression of CLDN11 or CLDN19 in breast cancer patients derived from TCGA data (n = 1044). B, mRNA expression of CLDN11 in normal tissues (n = 292) and tumor tissues from TCGA derived patients (n = 1092). C, mRNA expression of CLDN11 in breast cancer patients of stage I to IV deived from TCGA data (n = 1088). D, mRNA expression of CLDN11 in MCF-7/MDA-MB-231 cells treated with scramble or CLDN11 siRNAs. E, Cell proliferation of MCF-7/MDA-MB-231 cells treated with scramble or CLDN11 siRNAs (72 h). F, Cell migration of MCF-7/MDA-MB-231 cells treated with scramble or CLDN11 siRNAs (24 h). The scale bar was 50 μm. G, Immunohistochemical staining of CLDN11 in tumor tissues from breast cancer patients with lymph node metastasis (n = 14) or not (n = 12). *, p < 0.05; **, p < 0.01; ***, p < 0.001

CLDN11 deficiency upregulated FOXM1 to stimulate breast cancer development

In our quest to elucidate the molecular pathways through which CLDN11 influences breast cancer progression, we analyzed data from 817 breast cancer patients in the TCGA database, categorizing them into high and low CLDN11 expression groups and investigating differentially expressed genes. Notably, we identified the top 30 upregulated genes in patients with low CLDN11 expression compared to those with high expression (Fig. 2A). Among these genes, FOXM1 stood out as the most significantly upregulated gene. FOXM1, a member of the forkhead box transcription factor family, has garnered increasing recognition as a key contributor to cancer development and progression (Gartel 2017). Therefore, we posited that CLDN11 deficiency might lead to the upregulation of FOXM1, thereby fostering breast cancer progression. To validate this hypothesis, we initially assessed the impact of FOXM1 expression on the overall survival of breast cancer patients using data from the TCGA database. Our analysis revealed a correlation between increased FOXM1 expression and poor prognosis in breast cancer patients (Fig. 2B). Meanwhile, a poor prognosis was found in breast cancer patients with low CDLN11/high FOXM1 expression (Fig. S1E). We observed a significant elevation in FOXM1 expression in breast tumor tissues compared to normal tissues (Fig. 2C). Additionally, analysis of clinical specimens from breast cancer patients indicated higher FOXM1 expression in patients with lymphatic metastasis compared to those without metastasis (Fig. 2D), further supporting the association between increased FOXM1 expression and poor prognosis in breast cancer patients. To delve deeper into the role of FOXM1 in CLDN11-associated breast tumor progression, we examined FOXM1 expression in CLDN11-silenced MCF-7 and MDA-MB-231 cells. Strikingly, CLDN11 silencing significantly upregulated FOXM1 protein expression (Fig. 2E). Subsequently, we treated MCF-7 and MDA-MB-231 cells with RCM-1, a FOXM1 inhibitor, and assessed cell proliferation and migration. Remarkably, RCM-1 suppressed proliferative and migratory characteristics in CLDN11-silenced tumor cells, with minimal effect observed in the scramble group (Fig. 2F, G and S1F). Taken together, these findings suggest that CLDN11 deficiency upregulates FOXM1 expression, thereby promoting breast cancer development.

Fig. 2.

Fig. 2

Open in a new tab

CLDN11 deficiency upregulated FOXM1 to stimulate breast cancer development. A, The top 30 upregulated genes in CLDN11 low patients compared with CLDN11 high patients with breast cancer (n = 817 in total). B, Kaplan-Meier overall survival curve was shown according to high and low expression of FOXM1 in breast cancer patients derived from TCGA data (n = 1044). C, mRNA expression of FOXM1 in normal tissues (n = 292) and tumor tissues from TCGA derived patients (n = 1092). D, Immunohistochemical staining of FOXM1 in tumor tissues from breast cancer patients with lymph node metastasis (n = 14) or not (n = 12). E, Western blotting of CLDN11 and FOXM1 in MCF-7/MDA-MB-231 cells treated with scramble or CLDN11 siRNAs. F and G, MCF-7/MDA-MB-231 cells were treated with scramble or CLDN11 siRNAs. Then cells were treated with PBS or RCM-1 (80 nM, 48 h). Cell proliferation (F) and migration (G) were analyzed. *, p < 0.05; **, p < 0.01; ***, p < 0.001; n.s, no significant difference

CLDN11 deficiency upregulated FOXM1 through hedgehog signaling pathway

To investigate the mechanism by which CLDN11 deficiency affects FOXM1 expression in breast cancer, we conducted an analysis of differentially expressed genes between patients exhibiting high and low levels of CLDN11 expression. Subsequently, we performed Kyoto Encyclopedia of Genes and Genomes enrichment analysis. Interestingly, our investigation revealed a close association between CLDN11 expression and Hedgehog signaling pathway (Fig. 3A), a pathway known for its crucial roles in embryonic development and tumor progression (Bhateja et al. 2019). Following this observation, we assessed the expression levels of sonic hedgehog receptors (SMO, PT1, and PT2) as well as effectors (Gli1 and Gli2) in CLDN11-silenced MCF-7 and MDA-MB-231 cells. Our quantitative PCR analysis unveiled that CLDN11 silencing resulted in the upregulation of SMO, PT1, and PT2 (Fig. 3B). Subsequent Western blotting confirmed that CLDN11 silencing led to an increase in the protein expression of Gli1 and Gli2 (Fig. 3C), indicating that CLDN11 deficiency facilitated the activation of the Hedgehog signaling pathway. To verify the involvement of the Hedgehog signaling pathway, we treated MCF-7 and MDA-MB-231 cells with Hedgehog-IN3, an inhibitor targeting this pathway. Remarkably, the inhibition of the Hedgehog signaling pathway suppressed the upregulation of FOXM1 induced by CLDN11 siRNAs in these cells (Fig. 3D). These findings suggest that CLDN11 deficiency activates the Hedgehog signaling pathway, thereby leading to FOXM1 upregulation. Significantly, treatment with Hedgehog-IN3 also mitigated the proliferative and migratory phenotypes induced by CLDN11 silencing (Fig. 3E, F and S1G), underscoring the role of CLDN11 deficiency in promoting Hedgehog pathway activation, FOXM1 upregulation, and breast cancer development.

Fig. 3.

Fig. 3

Open in a new tab

CLDN11 deficiency upregulated FOXM1 through hedgehog signaling pathway. A, The differentially expressed genes were compared between CLDN11 low and high patients with breast cancer (n = 817 in total) from TCGA database. Kyoto encyclopedia of genes and genomes enrichment was then performed. B, mRNA expression of PT1, PT2 and SMO in MCF-7/MDA-MB-231 cells treated with scramble or CLDN11 siRNAs. C, Western blotting of CLDN11, Gli1 and Gli2 in MCF-7/MDA-MB-231 cells treated with scramble or CLDN11 siRNAs. D, Western blotting of CLDN11, Gli, Gli2 and FOXM1 in MCF-7/MDA-MB-231 cells treated with scramble or CLDN11 siRNAs (combined with 5 nM hedgehog-IN3 or not). E and F, MCF-7/MDA-MB-231 cells were treated with scramble or CLDN11 siRNAs. Then cells were treated with PBS or hedgehog-IN3 (5 nM, 48 h). Cell proliferation (E) and migration (F) were analyzed. *, p < 0.05; **, p < 0.01; n.s, no significant difference

CLDN11 modulated breast tumor growth in vivo

We next aimed to investigate the impact of CLDN11 on breast tumor growth in vivo. To achieve this, we subcutaneously injected either scramble or CLDN11-silenced MCF-7 cells into immunodeficient mice and assessed tumor growth over time. Consistent with our in vitro findings, CLDN11 silencing significantly enhanced tumor growth in MCF-7-bearing mice (Fig. 4A). Moreover, increased expression of the cell proliferative marker Ki-67 was observed in tumor tissues from mice treated with CLDN11 siRNAs (Fig. 4B). Additionally, we observed activation of the Hedgehog pathway and upregulation of FOXM1 at protein level in tumor tissues from CLDN11 siRNA-treated mice (Fig. 4C and D), indicating that CLDN11 deficiency promoted Hedgehog pathway/FOXM1 activation and breast tumor progression in vivo. Recognizing the critical role of CLDN11/Hedgehog pathway in breast cancer development, we treated tumor-bearing mice with Hedgehog-IN3. Remarkably, Hedgehog-IN3 suppressed tumor growth in the CLDN11-silenced group, with limited effects observed in the scramble group (Fig. 4E). These findings suggest that CLDN11 may serve as a potential diagnostic indicator for tumor response to Hedgehog signaling-targeted therapy in breast cancer.

Fig. 4.

Fig. 4

Open in a new tab

CLDN11 modulated breast tumor growth in vivo. A, The quantification of tumor volume in subcutaneous MCF-7 (scramble or CLDN11 siRNAs pre-treatment) bearing mice (n = 6 per group). B ~ D, Tumor tissues were isolated on day 25 in (A). The Ki-67 expression was analyzed by immunohistochemical staining (B). The expression of PT1, PT2, and SMO was analyzed by qPCR (C). The expression of CLDN11, Gli1, Gli2 and FOXM1 was analyzed by western blotting (D). E, Subcutaneous MCF-7 (scramble or CLDN11 siRNAs pre-treatment) bearing mice were treated with PBS or hedgehog-IN3. Tumor volume was quantified (n = 6 per group). *, p < 0.05; **, p < 0.01; n.s, no significant difference

Discussion

Breast cancer is a prevalent malignant tumor and metastasis significantly hinders treatment efficacy and plays a crucial role in cancer-related deaths (Trayes and Cokenakes 2021b). Therefore, gaining a deep understanding of the progression and metastasis mechanisms of breast cancer is essential for improving the prognosis of affected patients. In breast cancer, many factors can affect the survival prognosis of breast cancer patients, including changes in the immune microenvironment, and the expression of some cancer-suppressing and cancer-promoting genes. For instance, previous immunological analyzes have shown that with the progression of the tumor stage, there is a disorder of immunity in breast tumors, especially the population of NK cells that controls tumor growth (Konjević et al. 2001; Correia et al. 2021). Our study revealed reduced expression of CLDN11 in breast cancer, which correlates with unfavorable survival outcomes. Additionally, we discovered that CLDN11 deficiency promotes FOXM1 production by activating the hedgehog signaling pathway, thereby altering the invasive characteristics of breast cancer cells. Moreover, we observed a cessation of tumor growth in breast cancer mouse models when inhibiting the CLDN11 signaling pathway in combination with hedgehog inhibitors. These findings emphasize the critical role of CLDN11 in breast cancer progression, elucidate its molecular mechanisms, and pave the way for novel treatment approaches for this deadly disease.

Tight junctions (TJs) are significant intercellular adhesion complexes that maintain the polarity of normal epithelial and endothelial cells. They play a crucial role in metastasis, as the migration and dissemination of cancer cells rely on the “loosening” or removal of TJs from the cancer cells. The intravasation and extravasation of cancer cells across the endothelial barrier also depends on the reduced integrity of TJs within endothelial cells (Tabariès and Siegel 2017; Kyuno et al. 2021). Claudins (CLDNs), essential components of TJs, mediate interactions between adjacent cells and are crucial regulatory factors in tumorigenesis and metastasis, influencing tumor prognosis (Tabariès et al. 2012; Furuse et al. 1999; Hashimoto and Oshima 2022). Numerous recent studies have reported abnormal CLDNs expression in various cancers and its correlation with patient prognosis (Philip et al. 2015; Tabariès and Siegel 2017; Wang et al. 2023; Bhat et al. 2020). Our study identified a link between low CLDN11 expression and poor prognosis in breast cancer patients based on TCGA data. Then, transcriptome analysis revealed a significant downregulation of CLDN11 in breast tumors compared to normal tissue, with further reductions in advanced (stage IV) patients. In addition, IHC analysis of clinical samples indicated lower CLDN11 expression in tumor tissues of the lymphatic metastasis group compared to non-lymphatic metastasis tissues. These results suggest that low CLDN11 expression is associated with breast cancer progression and poor patient prognosis. Silencing CLDN11 expression in breast cancer cells MCF-7 and MDA-MB-231 demonstrated that CLDN11 deficiency promotes the proliferation and migration phenotype of breast cancer cells. Previous studies have also linked low expression of various claudin proteins like CLDN3, CLDN4, and CLDN7 to the aggressive behavior of breast cancer cells (Tabariès and Siegel 2017). The role of reduced CLDN11 expression in promoting tumor progression has also been found in bladder cancer (Awsare et al. 2011), gastric cancer (Yang et al. 2017; Agarwal et al. 2009), and nasopharyngeal carcinoma (Li et al. 2018). The role of reduced CLDN11 expression in promoting tumor progression has been observed in bladder cancer, gastric cancer, and nasopharyngeal carcinoma. The functional significance of CLDNs in cancer progression towards metastatic disease is well established; however, the mechanisms underlying claudin-mediated metastasis require further investigation. Therefore, we explored the molecular mechanisms of CLDN11 in regulating breast cancer progression. Our results demonstrated that CLDN11 defects can enhance breast cancer cell proliferation and migration by activating the hedgehog pathway to upregulate FOXM1 expression. The in vivo impact of CLDN11 deficiency on regulating breast cancer progression via the Hedgehog/FOXM1 pathway was confirmed using tumor-bearing mice.

Our study elucidated the role of CLDN11 deficiency in promoting Hedgehog pathway activation, FOXM1 upregulation, and breast cancer development. FOXM1, a transcription factor of the Forkhead family, is essential for normal cell proliferation (Gartel 2017; Kalathil et al. 2020). FOXM1 overexpression is common in various cancer types, and inhibiting FOXM1 expression in tumor cells reduces cell proliferation, growth, migration, invasion, and angiogenesis, highlighting FOXM1’s role in tumor initiation and progression (Laoukili et al. 2007; Pilarsky et al. 2004; Halasi and Gartel 2013; Khan et al. 2023). Furthermore, it has been shown that the FOXM1-regulatory network is a significant predictor of adverse outcomes in numerous cancer cases across different malignancies (Gentles et al. 2015; Sher et al. 2022). Our research revealed that high FOXM1 expression in breast cancer is linked to poor patient survival, consistent with previous studies (Katzenellenbogen et al. 2023). Notably, we found that upregulated FOXM1 in breast cancer is triggered by CLDN11 deficiency through hedgehog signaling activation. The hedgehog signaling pathway, a key regulator of embryonic development, is implicated in various birth defects, and its dysregulation is associated with various tumors (Bhateja et al. 2019; Rubin and de Sauvage 2006; Hahn et al. 1996; Jiang 2022). A growing body of literature substantiates the role of hedgehog signaling in breast cancer, including tumorigenesis, development, and treatment (Habib and O’Shaughnessy 2016; Ramaswamy et al. 2012; Giammona et al. 2023). Our study identified the crucial role of hedgehog signaling in CLDN11 deficiency, upregulating FOXM1 expression and regulating breast cancer progression. We provided evidence that the CLDN11/hedgehog pathway/FOXM1 axis contributes to breast cancer cell proliferation and migration, highlighting the roles of FOXM1 and hedgehog signaling in breast cancer development and suggesting the potential of FOXM1 inhibitors in clinical tumor therapy. However, there are still some limitations in our study. The mechanism determining the expression of CLDN11 remains unclear. The CLDN11 expression difference and prognosis in different breast cancer histology type and subtypes need to be further investigated.

Conclusion

In conclusion, our investigation has unveiled the underlying mechanism involving the CLDN11/hedgehog pathway/FOXM1 axis driving breast cancer development, offering novel insights for breast cancer treatment. Additionally, our findings have elucidated the association between CLDN11 deficiency and breast cancer progression, as well as unsatisfactory survival, indicating that CLDN11 may serve as a valuable prognostic indicator for breast cancer progression.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (1.1MB, docx)

Acknowledgements

None.

Author contributions

L.Y. X.W. and Q.L. were collectively responsible for the comprehensive research design. L.Y. and X.W. performed in vitro and in vivo experimental verification. G.S. and H.C. performed the bioinformatics analysis and data visualization. L.Y. and Q.L. were the major contributor in writing the manuscript. All authors confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval

For the use of patient samples, informed consent was obtained from each patient before specimen collection. Clinical experiments adhered to the principles outlined in the Declaration of Helsinki and were approved by the Ethics Committee of Fujian Medical University (2022KYB149). All animal experiments were performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Zhangzhou Hospital of Fujian Medical University (2024-0005).

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Leyi Yang and Xiaoping Wang contributed equally to this work.

References

  1. Agarwal R, D’Souza T, Morin PJ (2005) Claudin-3 and claudin-4 expression in ovarian epithelial cells enhances invasion and is associated with increased matrix metalloproteinase-2 activity. Cancer Res 65(16):7378–7385 [DOI] [PubMed] [Google Scholar]
  2. Agarwal R, Mori Y, Cheng Y, Jin Z, Olaru AV, Hamilton JP et al (2009) Silencing of claudin-11 is associated with increased invasiveness of gastric cancer cells. PLoS ONE 4(11):e8002. 10.1371/journal.pone.0008002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ashikari D, Takayama KI, Obinata D, Takahashi S, Inoue S (2017) CLDN8, an androgen-regulated gene, promotes prostate cancer cell proliferation and migration. Cancer Sci 108(7):1386–1393. 10.1111/cas.13269 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Awsare NS, Martin TA, Haynes MD, Matthews PN, Jiang WG (2011) Claudin-11 decreases the invasiveness of bladder cancer cells. Oncol Rep 25(6):1503–1509. 10.3892/or.2011.1244 [DOI] [PubMed] [Google Scholar]
  5. Bhat AA, Syed N, Therachiyil L, Nisar S, Hashem S, Macha MA et al (2020) Claudin-1, a double-edged Sword in Cancer. Int J Mol Sci 21(2). 10.3390/ijms21020569 [DOI] [PMC free article] [PubMed]
  6. Bhateja P, Cherian M, Majumder S, Ramaswamy B (2019) The hedgehog signaling pathway: a viable target in breast Cancer? Cancers (Basel) 11(8). 10.3390/cancers11081126 [DOI] [PMC free article] [PubMed]
  7. Bianchi A, Gervasi ME, Bakin A (2010) Role of β5-integrin in epithelial-mesenchymal transition in response to TGF-β. Cell Cycle 9(8):1647–1659. 10.4161/cc.9.8.11517 [DOI] [PubMed] [Google Scholar]
  8. Correia AL, Guimaraes JC, Auf der Maur P, De Silva D, Trefny MP, Okamoto R et al (2021) Hepatic stellate cells suppress NK cell-sustained breast cancer dormancy. Nature 594(7864):566–571. 10.1038/s41586-021-03614-z [DOI] [PubMed] [Google Scholar]
  9. Furuse M, Sasaki H, Tsukita S (1999) Manner of interaction of heterogeneous claudin species within and between tight junction strands. J Cell Biol 147(4):891–903. 10.1083/jcb.147.4.891 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO et al (2013) Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal 6(269):pl1. 10.1126/scisignal.2004088 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gartel AL (2017) FOXM1 in Cancer: interactions and vulnerabilities. Cancer Res 77(12):3135–3139. 10.1158/0008-5472.can-16-3566 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gentles AJ, Newman AM, Liu CL, Bratman SV, Feng W, Kim D et al (2015) The prognostic landscape of genes and infiltrating immune cells across human cancers. Nat Med 21(8):938–945. 10.1038/nm.3909 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Giammona A, Crivaro E, Stecca B (2023) Emerging roles of hedgehog signaling in Cancer Immunity. Int J Mol Sci 24(2). 10.3390/ijms24021321 [DOI] [PMC free article] [PubMed]
  14. Habib JG, O’Shaughnessy JA (2016) The hedgehog pathway in triple-negative breast cancer. Cancer Med 5(10):2989–3006. 10.1002/cam4.833 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hahn H, Wicking C, Zaphiropoulous PG, Gailani MR, Shanley S, Chidambaram A et al (1996) Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 85(6):841–851. 10.1016/s0092-8674(00)81268-4 [DOI] [PubMed] [Google Scholar]
  16. Halasi M, Gartel AL (2013) FOX(M1) news–it is cancer. Mol Cancer Ther 12(3):245–254. 10.1158/1535-7163.mct-12-0712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hashimoto I, Oshima T (2022) Claudins and gastric Cancer: an overview. Cancers (Basel) 14(2). 10.3390/cancers14020290 [DOI] [PMC free article] [PubMed]
  18. Jiang J (2022) Hedgehog signaling mechanism and role in cancer. Semin Cancer Biol 85:107–122. 10.1016/j.semcancer.2021.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kalathil D, John S, Nair AS (2020) FOXM1 and Cancer: Faulty Cellular Signaling derails Homeostasis. Front Oncol 10:626836. 10.3389/fonc.2020.626836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Katzenellenbogen BS, Guillen VS, Katzenellenbogen JA (2023) Targeting the oncogenic transcription factor FOXM1 to improve outcomes in all subtypes of breast cancer. Breast Cancer Res 25(1):76. 10.1186/s13058-023-01675-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Khan MA, Khan P, Ahmad A, Fatima M, Nasser MW (2023) FOXM1: a small fox that makes more tracks for cancer progression and metastasis. Semin Cancer Biol 92:1–15. 10.1016/j.semcancer.2023.03.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kominsky SL, Argani P, Korz D, Evron E, Raman V, Garrett E et al (2003) Loss of the tight junction protein claudin-7 correlates with histological grade in both ductal carcinoma in situ and invasive ductal carcinoma of the breast. Oncogene 22(13):2021–2033 [DOI] [PubMed] [Google Scholar]
  23. Konjević G, Jurisić V, Spuzić I (2001) Association of NK cell dysfunction with changes in LDH characteristics of peripheral blood lymphocytes (PBL) in breast cancer patients. Breast Cancer Res Treat 66(3):255–263. 10.1023/a:1010602822483 [DOI] [PubMed] [Google Scholar]
  24. Kyuno D, Takasawa A, Kikuchi S, Takemasa I, Osanai M, Kojima T (2021) Role of tight junctions in the epithelial-to-mesenchymal transition of cancer cells. Biochim Biophys Acta Biomembr 1863(3):183503. 10.1016/j.bbamem.2020.183503 [DOI] [PubMed] [Google Scholar]
  25. Lal-Nag M, Morin PJ (2009) The claudins. Genome Biol 10(8):235. 10.1186/gb-2009-10-8-235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Laoukili J, Stahl M, Medema RH (2007) FoxM1: at the crossroads of ageing and cancer. Biochim Biophys Acta 1775(1):92–102. 10.1016/j.bbcan.2006.08.006 [DOI] [PubMed] [Google Scholar]
  27. Li HP, Peng CC, Wu CC, Chen CH, Shih MJ, Huang MY et al (2018) Inactivation of the tight junction gene CLDN11 by aberrant hypermethylation modulates tubulins polymerization and promotes cell migration in nasopharyngeal carcinoma. J Exp Clin Cancer Res 37(1):102. 10.1186/s13046-018-0754-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lu J, Steeg PS, Price JE, Krishnamurthy S, Mani SA, Reuben J et al (2009) Breast cancer metastasis: challenges and opportunities. Cancer Res 69(12):4951–4953. 10.1158/0008-5472.can-09-0099 [DOI] [PubMed] [Google Scholar]
  29. Michl P, Barth C, Buchholz M, Lerch MM, Rolke M, Holzmann K-H et al (2003) Claudin-4 expression decreases invasiveness and metastatic potential of pancreatic cancer. Cancer Res 63(19):6265–6271 [PubMed] [Google Scholar]
  30. Mineta K, Yamamoto Y, Yamazaki Y, Tanaka H, Tada Y, Saito K et al (2011) Predicted expansion of the claudin multigene family. FEBS Lett 585(4):606–612. 10.1016/j.febslet.2011.01.028 [DOI] [PubMed] [Google Scholar]
  31. Philip R, Heiler S, Mu W, Büchler MW, Zöller M, Thuma F (2015) Claudin-7 promotes the epithelial-mesenchymal transition in human colorectal cancer. Oncotarget 6(4):2046–2063. 10.18632/oncotarget.2858 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pilarsky C, Wenzig M, Specht T, Saeger HD, Grützmann R (2004) Identification and validation of commonly overexpressed genes in solid tumors by comparison of microarray data. Neoplasia 6(6):744–750. 10.1593/neo.04277 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Radenkovic S, Konjevic G, Isakovic A, Stevanovic P, Gopcevic K, Jurisic V (2014) HER2-positive breast cancer patients: correlation between mammographic and pathological findings. Radiat Prot Dosimetry 162(1–2):125–128. 10.1093/rpd/ncu243 [DOI] [PubMed] [Google Scholar]
  34. Radenkovic S, Konjevic G, Gavrilovic D, Stojanovic-Rundic S, Plesinac-Karapandzic V, Stevanovic P et al (2019) pSTAT3 expression associated with survival and mammographic density of breast cancer patients. Pathol Res Pract 215(2):366–372. 10.1016/j.prp.2018.12.023 [DOI] [PubMed] [Google Scholar]
  35. Ramaswamy B, Lu Y, Teng KY, Nuovo G, Li X, Shapiro CL et al (2012) Hedgehog signaling is a novel therapeutic target in tamoxifen-resistant breast cancer aberrantly activated by PI3K/AKT pathway. Cancer Res 72(19):5048–5059. 10.1158/0008-5472.can-12-1248 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rangel LB, Agarwal R, D’Souza T, Pizer ES, Alo PL, Lancaster WD et al (2003) Tight junction proteins claudin-3 and claudin-4 are frequently overexpressed in ovarian cancer but not in ovarian cystadenomas. Clin Cancer Res 9(7):2567–2575 [PubMed] [Google Scholar]
  37. Rubin LL, de Sauvage FJ (2006) Targeting the hedgehog pathway in cancer. Nat Rev Drug Discov 5(12):1026–1033. 10.1038/nrd2086 [DOI] [PubMed] [Google Scholar]
  38. Sauer T, Pedersen M, Ebeltoft K, Naess O (2005) Reduced expression of Claudin-7 in fine needle aspirates from breast carcinomas correlate with grading and metastatic disease. Cytopathology 16(4):193–198 [DOI] [PubMed] [Google Scholar]
  39. Scherbakov AM, Vorontsova SK, Khamidullina AI, Mrdjanovic J, Andreeva OE, Bogdanov FB et al (2023) Novel pentacyclic derivatives and benzylidenes of the progesterone series cause anti-estrogenic and antiproliferative effects and induce apoptosis in breast cancer cells. Invest New Drugs 41(1):142–152. 10.1007/s10637-023-01332-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sher G, Masoodi T, Patil K, Akhtar S, Kuttikrishnan S, Ahmad A et al (2022) Dysregulated FOXM1 signaling in the regulation of cancer stem cells. Semin Cancer Biol 86(Pt 3):107–121. 10.1016/j.semcancer.2022.07.009 [DOI] [PubMed] [Google Scholar]
  41. Sigafoos AN, Paradise BD, Fernandez-Zapico ME (2021) Hedgehog/GLI signaling pathway: transduction, regulation, and implications for Disease. Cancers (Basel) 13(14). 10.3390/cancers13143410 [DOI] [PMC free article] [PubMed]
  42. Singh AB, Sharma A, Dhawan P (2010) Claudin family of proteins and cancer: an overview. Journal of oncology, 2010 [DOI] [PMC free article] [PubMed]
  43. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A et al (2021) Global Cancer statistics 2020: GLOBOCAN estimates of incidence and Mortality Worldwide for 36 cancers in 185 countries. CA Cancer J Clin 71(3):209–249. 10.3322/caac.21660 [DOI] [PubMed] [Google Scholar]
  44. Tabariès S, Siegel PM (2017) The role of claudins in cancer metastasis. Oncogene 36(9):1176–1190. 10.1038/onc.2016.289 [DOI] [PubMed] [Google Scholar]
  45. Tabariès S, Dupuy F, Dong Z, Monast A, Annis MG, Spicer J et al (2012) Claudin-2 promotes breast cancer liver metastasis by facilitating tumor cell interactions with hepatocytes. Mol Cell Biol 32(15):2979–2991. 10.1128/mcb.00299-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Trayes KP, Cokenakes SE (2021a) Breast cancer treatment. Am Family Phys 104(2):171–178 [PubMed] [Google Scholar]
  47. Trayes KP, Cokenakes SEH (2021b) Breast Cancer Treatment. Am Fam Physician 104(2):171–178 [PubMed] [Google Scholar]
  48. Tsukita S, Tanaka H, Tamura A (2019) The claudins: from tight junctions to Biological systems. Trends Biochem Sci 44(2):141–152. 10.1016/j.tibs.2018.09.008 [DOI] [PubMed] [Google Scholar]
  49. Usami Y, Chiba H, Nakayama F, Ueda J, Matsuda Y, Sawada N et al (2006) Reduced expression of claudin-7 correlates with invasion and metastasis in squamous cell carcinoma of the esophagus. Hum Pathol 37(5):569–577 [DOI] [PubMed] [Google Scholar]
  50. Wang C, Wu N, Pei B, Ma X, Yang W (2023) Claudin and pancreatic cancer. Front Oncol 13:1136227. 10.3389/fonc.2023.1136227 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Xu J, Chen M, Hu M, Wang H, Zuo Z, Wang J et al (2022) Claudin 19 inhibits the malignant potential of breast cancer cells by modulating extracellular matrix-associated UBE2C/Wnt signaling. Am J Cancer Res 12(12):5552–5563 [PMC free article] [PubMed] [Google Scholar]
  52. Yang P, Zhang M, Liu X, Pu H (2017) MicroRNA-421 promotes the proliferation and metastasis of gastric cancer cells by targeting claudin-11. Exp Ther Med 14(3):2625–2632. 10.3892/etm.2017.4798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zavala-Zendejas VE, Torres-Martinez AC, Salas-Morales B, Fortoul TI, Montaño LF, Rendon-Huerta EP (2011) Claudin-6, 7, or 9 overexpression in the human gastric adenocarcinoma cell line AGS increases its invasiveness, migration, and proliferation rate. Cancer Invest 29(1):1–11 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (1.1MB, docx)

Data Availability Statement

No datasets were generated or analysed during the current study.

Articles from Journal of Molecular Histology are provided here courtesy of Springer

RESOURCES