Abstract
Myocardial ischemia-reperfusion (I/R) injury caused by revascularization treatment is the leading cause of cardiac damage aggravation in ischemic heart disease. Increasing evidence has unraveled the crucial role of pyroptosis in myocardial I/R injury. Of note, lactylation has been validated to be participated in modulating pyroptosis. Hence, this study was aimed to elaborate the potential and mechanism of lactylation in myocardial I/R damage. We established the cell model of I/R through inducing hypoxia/reoxygenation (H/R) of H9c2 cells. It was uncovered that H/R stimulation drove cardiomyocyte pyroptosis and upregulated total lactylation level. Further, we demonstrated that promoting lactylation contributed to H/R-evoked pyroptosis, whereas silencing LDHA led to the opposite results. More than that, LDHA was confirmed to facilitate lactylation of NLRP3 at K245 site and increase its protein stability. Our findings indicated that activation of NLRP3 abolished the function of LDHA deficiency in H/R-treated H9c2 cells. In concert with the aforementioned outcomes, knockout of LDHA attenuated the infarct size and myocardial damage in I/R mice and upregulation of NLRP3 counteracted the effects of LDHA knockout on I/R-evoked injury in vivo. To summarize, the current research provided persuasive evidence that LDHA promoted myocardial I/R damage via enhancing NLRP3 lactylation to induce cardiomyocyte pyroptosis.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12872-024-04251-w.
Keywords: Myocardial ischemia-reperfusion, NLRP3, Lactylation, Pyroptosis
Introduction
Ischemic heart disease is one of the leading causes of death across the world, which evokes a serious menace to public health owing to its great incidence and mortality [1, 2]. Myocardial ischemia can trigger irreversible heart tissue injury and cardiomyocyte necrosis. Revascularization therapy is an effective method for the treatment of myocardial ischemia via timely restoration of blood supply [3]. Paradoxically, when hypoxic cardiomyocytes regain their oxygen supply, the sudden return of blood flow provokes secondary injury to ischemic cardiomyocytes and aggravates myocardial damage and dysfunction, which is known as myocardial ischemia/reperfusion (I/R) injury [4, 5]. It has been proven that myocardial I/R injury is clinically manifested as cardiac shock, absence of reflux, reperfusion arrhythmia and fatal myocardial damage [6]. IR injury is the main driving factor of heart failure after myocardial infarction, gravely threatening the prognosis and survival rate of patients with ischemic heart disease [7]. Therefore, it is necessary to develop therapeutics targeting the molecular mechanism underlying myocardial I/R.
It has been widely confirmed that myocardial I/R injury is implicated in a variety of physiological and pathological alternations, including pyroptosis, mitochondrial homeostasis, autophagy, calcium overload and necrosis, which finally exacerbates oxidative stress and inflammatory response [8–11]. In recent years, pyroptosis has been recognized as a classification of proinflammatory programmed cell death with the main trats of quick rupture of the plasma membrane, cell lysis and cytokine secretion, which is of enormous significance for innate immune response [12, 13]. Of particular interest is a close relationship between pyroptosis and I/R injury, especially in cardiovascular diseases [14]. A growing body of literatures have affirmed that targeting pyroptosis is a novel treatment strategy of myocardial I/R damage [15]. Whereupon, increasing drugs, genes and non-coding RNAs have been validated to act as key regulators in myocardial I/R injury via affecting cell pyroptosis process, for example, oridonin, metformin, KDM3A, lncRNA ROR and miR-424 [16–20]. Hence, the primary task of this study is to explore the action mode of pyroptosis in cardiac I/R.
Lactate is the primary final product of glycolysis, which was previously mistaken for waste [21]. With the deepening of its understanding, lactate has been newly discovered to possess biological properties, such as providing energy for cellular metabolism or acting as a signaling transduction molecule [22]. Strikingly, it has been justified that lactate-induced lactylation is a novel class of post-translational modifications (PTMs) involved in the initiation and development of numerous diseases, including malignancy and cardiovascular disease [23–25]. Moreover, emerging evidence has revealed the critical regulatory role of lactylation in pyroptosis [26]. Although the function of lactylation in myocardial I/R remains unknown, a recent study has demonstrated its involvement in hepatic I/R damage [27]. Considering these facts, our research is designed to identify the potential and mechanism of lactylation in pyroptosis evoked by myocardial I/R.
Methods
Cell culture and treatment
Rat myocardial cell line H9c2 was provided by ATCC (Manassas, USA) and cultivated with culture medium consisted of DMEM medium (Gibco, USA), 10% FBS (Gibco), 100 µg/mL streptomycin and 100 U/mL penicillin obeying the manufacturer’s guidelines. These cells were cultured at 37 °C in the presence of 5% CO2.
H9c2 cells were subjected to hypoxia/reoxygenation (H/R) to construct the cell model of I/R. For this purpose, H9c2 cells were maintained in the anoxic atmosphere of 94% N2, 5% CO2 and 1% O2 for 2 h and then reoxygenated under the environment of 95% air and 5% CO2 for additional 24 h. To upregulation of lactylation, cardiomyocytes were administered with 10 mM lactate for 6 d. In order to evaluate the protein stability of NLRP3, H9c2 cells were dealt with 100 µg/ml protein synthesis inhibitor cycloheximide (CHX, Sigma-Aldrich, USA). Besides, to activate NLRP3, the H9c2 cells were stimulated with the NLRP3 agonist, Nigericin (20 µM, Sigma-Aldrich), before H/R for 1 h.
Cell transfection
For silencing of LDHA, small interfering RNAs (siRNAs) specific for LDHA were acquired from RiboBio (Guangzhou, China). Non-specific siRNAs produced by RiboBio were employed as the negative control. Cell transfection was implemented by means of Lipofectamine® 2000 (Invitrogen, USA) abiding by the product protocols. H9c2 cells were collected at 24 h post transfection for H/R treatment. The used primers were listed below: siLDHA#1, 5’-CAAACTCCAAGCTGGTCATTA-3’, siLDHA2#, 5’-TGTTGATGTCATAGAAGATAA-3’, siNC, 5’-GAGATCCCGCTAACATCAAAT-3’.
CGTGTTATTGGAAGCGGTTG
Myocardial enzyme detection
To estimate the myocardial damage, the activity of myocardial enzymes was examined with colorimetric assay kits of lactate dehydrogenase (LDH) and creatine kinase-myocardial band (CK-MB), cardiac troponin I (cTnI) all obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). In line with instructions supplied by the vendor, cell or serum test samples were prepared and incubated with detection reagents. Absorbance was measured under a microplate reader (Varioskan LUX; Thermo Fisher Scientific, Waltham, MA, USA) the corresponding wavelength.
Enzyme-linked immunosorbent assay (ELISA)
Following the product manuals, the release of inflammatory cytokines interleukin (IL)-1β and IL-18 was determined by virtue of matched ELISA kits (R&D Systems, USA).
Flow cytometry
The pyroptosis of H9c2 cells was evaluated by flow cytometry analysis through the employment of a FAM-FLICA caspase-1 assay kit (ImmunoChemistry, USA). After different treatments, H9c2 cells were trypsinized, resuspended and treated with FAM-FLICA caspase-1 reagent for 1 h at 37 °C. Following rinsing thrice using washing buffer, cardiomyocytes were dyed by 100 µg/ml propidium iodide (PI) and then analyzed with a flow cytometer (Beckman Coulter, USA).
Western blot
H9c2 cells were treated with RIPA lysis buffer (Beyotime Biotechnology, China) to obtain total protein extracts. The BCA protein assay kit (Pierce, USA) was employed for quantification of protein concentration. Equivalent samples were detached by 10% SDS-PAGE and subsequently transferred onto PVDF membranes. After blockage with 5% defatted milk, membranes were immersed in primary antibodies at 4℃ throughout a night, followed by treatment with secondary antibodies (goat anti-rabbit; 1: 10,000, Abcam) at room temperature for 1–2 h and visualized by utilization of the chemiluminescence plus kit (Millipore, USA). The gray value of protein bands was analyzed with the ImageJ software. The following primary antibodies were adopted: anti-lysine lactylation (Kla) (1:1000, Micron Biotechnology Co., Ltd., China), anti-NLRP3 (1:1000, Abcam, UK), anti-ASC (1:1000, Abcam), anti-caspase-1 (1: 1000, Abcam), anti-cleaved caspase-1 (1:1000, Cell Signaling Technology, USA), anti-GSDMD-N (1: 1000, Biorbyt, UK), anti-LDHA (1:1000, Abcam), and anti-β-actin (1: 1000; Santa Cruz, USA). β-actin was used as the loading control.
Immunoprecipitation (IP)
The lactylation level of ASC, caspase-1, NLRP3, and GSDMD in H9c2 cells was assessed using an IP assay in combination with Western blot. In summary, cell lysates from H9c2 cells were collected and subjected to immunoprecipitation with ASC (1:30, Abcam), caspase-1 (1/50, Santa Cruz Biotechnology, Santa Cruz, CA, USA), NLRP3 (1:30, Abcam), and GSDMD (1:30, Abcam) and protein A/G agarose, followed by Western blot analysis targeting Kla.
Site mutation
To identify NLRP3 was lactylated at which site, we commissioned RiboBio Co. Ltd., to mutate lysine (K)245, K248, and K337 to arginine (K245R, K248R, and K337R). These mutated plasmids were then transfected into H9c2 cells.
Quantitative polymerase chain reaction (qPCR)
Total RNA from transfected H9c2 cells was extracted with Trizol reagent (Invitrogen). Following the directions of the First-Strand cDNA Synthesis Kit (Roche, Switzerland), reverse transcription was carried out. The SYBR qPCR Kit (Osaka, Japan) was applied to conduct the qPCR analysis of samples in the 7500 real-time PCR system (Applied Biosystems, USA). Relative gene expression was analyzed with the 2−ΔΔCT method and normalized to the endogenous reference β-actin. The sequences of primers were as follow: LDHA, 5’-CGTGTTATTGGAAGCGGTTG − 3’ (F) and 5’-TTCATTCCACTCCATACAGGC-3’ (R); β-actin, 5’-CTAAGGCCAACCGTGAAAAG-3’ (F) and 5’-ACCAGAGGCATACAGGGACA-3’ (R).
The mouse model of I/R
The procedures of animal experiments were performed under the permission of the Ethics Committee of MDKN Biotechnology Co., Lt. Twelve global LDHA knock-out (KO) C57BL/6J mice and 12 wild-type negative control of KO-LDHA mice were supplied by GemPharmatech (Nanjing, China). All mice were 6 weeks old and weighted 120 ± 10 g. The KO-NC mice were assigned to two group: the sham + KO-NC group and I/R + KO-NC group. Likewise, KO-LDHA mice were allocated into the I/R + KO-LDHA group and the I/R + KO-LDHA + nigericin group. To simulate myocardial I/R injury, mice were anesthetized by isoflurane via a rodent ventilator. The left anterior descending (LAD) coronary artery was exposed by incising the skin around the fourth intercostal space. Afterwards, LAD artery was subjected to 1 h of ligation followed by 1 h of reperfusion. Next, the wound was sewn up. The sham + KO-NC group mice underwent the same procedure, except for the absence of ligation. To determine the role of NLRP3 in myocardial I/R, the I/R + KO-LDHA + nigericin group mice were preoperatively administered with 5 mg/kg nigericin for a week. After plasma collection through retroorbital plexus hemorrhage, mice were euthanized.
2, 3, 5-triphenyltetrachloride (TTC) staining
TTC staining was implemented to assess the infarct area of cardiac tissues. After mice were sacrificed, 1% Evans Blue dye was infused into the aorta to determine the ischemic area. Subsequently, the heart tissues were preserved at -20℃ for 1.5 h, and then sliced into 2 mm Sect. 1% TTC solution was employed to stain tissue sections. The left ventricle (LV) was sectioned into five to seven transverse slices, and the analysis of the heart’s infarct size was conducted utilizing Image J software. Infarct area ratio = (sum of ischaemic area of each section)/ (sum of brain area of each section) × 100%.
Statistical analysis
GraphPad 5.0 software (San Diego, USA) was utilized for statistical analysis. Data were presented as the mean ± standard deviation (SD) from triplicate experiments. Comparison of two groups was completed with Student’s t-test. Differences between three or more groups were estimated by One-way ANOVA with Tukey’s post hoc analysis. Statistical significance was set as P < 0.05.
Results
H/R treatment contributed to the pyroptosis and lactylation of H9c2 cells
Firstly, cell model of ischemia-reperfusion was established by H/R induction. As displayed in Fig. 1A-C, we observed that H/R led to the elevation of LDH activity and the enhanced expression of IL-1β and IL-18. Additionally, flow cytometry assay revealed that the pyroptosis rate of H9c2 cells was overtly increased by H/R treatment (Fig. 1D). In concert with the above findings, western blot manifested that the expression of cleaved caspase-1 and GSDMD-N was prominently strengthened in H/R-induced cardiomyocytes compared with the control group (Fig. 1E). Of note, it was uncovered that H/R promoted the global lactylation modification in H9c2 cells (Fig. 1F). Taken together, these results indicated the pivotal function of lactylation in myocardial injury.
Fig. 1.
H/R treatment contributed to the pyroptosis and lactylation of H9c2 cells. (A) The LDH activity of two groups. (B-C) ELISA detect results of IL-1β and IL-18 expression in H9c2 cells treated or untreated with H/R. (D) Flow cytometry was carried out for estimation of cell pyroptosis rate. (E) Western blot analysis of the expression levels of pyroptosis biomarkers cleaved caspase-1 and GSDMD-N. (F) The role of H/R in lactylation was also determined by western blot. vs. the control group, ***P < 0.001, N = 3
Promoting lactylation facilitated cell pyroptosis in H/R damage
Next, we intended to ascertain the profile of lactylation. Accordingly, H9c2 cells were administered with lactate to heighten the lactylation of cardiomyocytes. Our detection data showed that lactate treatment aggravated H/R-induced LDH activity and the release of IL-1β and IL-18 (Fig. 2A-C). Likewise, we confirmed that the percent of pyroptotic H9c2 cells augmented by H/R was further elevated in response to administration of lactate (Fig. 2D). Moreover, the enhanced expression of cleaved caspase-1 and GSDMD-N caused by H/R was exacerbated due to lactate treatment (Fig. 2E). According to the aforementioned findings, we concluded that lactylation performed an inducing factor for H/R-evoked cardiomyocyte pyroptosis.
Fig. 2.
Promoting lactylation facilitated cell pyroptosis in H/R damage. (A-C) The concentrations of LDH, IL-1β and IL-18 were measured with matched kits. (D) The proportion of pyroptotic cardiomyocytes examined by flow cytometry. (E) Western blot detection of cleaved caspase-1 and GSDMD-N expression in different groups. vs. the control group, **P < 0.01, ***P < 0.001. vs. the H/R group, #P < 0.05, ##P < 0.01, ###P < 0.001, N = 3
Knockdown of LDHA reversed the H/R-induced pyroptosis in H9c2 cells
In order to investigate the impacts of lactylation inhibition on H/R injury, LDHA was silenced in H9c2 cells. The RT-qPCR analysis validated that LDHA level was downregulated in cardiomyocytes after transfection (Fig. 3A). As anticipated, LDH expression strengthened by H/R was recovered by silencing of LDHA (Fig. 3B). ELISA assay illustrated that the concentrations of IL-1β and IL-18 were elevated by H/R and then regained owing to suppression of LDHA (Fig. 3C-D). Besides, H/R-induced high cell pyroptosis rate was declined by depletion of LDHA (Fig. 3E). In addition, we justified that the increase of cleaved caspase-1 and GSDMD-N provoked by H/R was abolished because of LDHA knockdown (Fig. 3F). Overall, we certified that silencing LDHA was conducive to mitigating the pyroptosis of H/R-stimulated H9c2 cells.
Fig. 3.
Knockdown of LDHA reversed the H/R-induced pyroptosis in H9c2 cells. (A) The qPCR analysis of LDHA expression in different groups after transfection. vs. the siNC group. (B) The LDH colorimetric assay kit was applied to test LDH activity of cardiomyocytes subjected to different treatments. (C-D) ELISA assay was conducted to assess the release of IL-1β and IL-18. (E) Flow cytometry analysis of cell pyroptosis rate in different groups. (F) Cleaved caspase-1 and GSDMD-N levels measured by Western bot. vs. the siNC group, ***P < 0.001. vs. the siLDHA#1 group, ##P < 0.01, ###P < 0.001, N = 3
LDHA stabilized NLRP3 expression through lactylation
Considering the foregoing consequences, we strove to explore its latent molecular mechanism. Hence, H/R-treated H9c2 cells were subjected to administration of lactate and then we detected the lactylation levels of pyroptosis-related proteins, including ASC, caspase-1, NLRP3 and GSDMD. It was worth noting that H/R only resulted in the augmented lactylation of NLRP3, which was exacerbated by lactate treatment (Fig. 4A). On the contrary, downregulation of LDHA triggered the outstanding reduction of LDHA, NLRP3 lactylation level and its expression (Fig. 4B). Through browsing bioinformatics website, we found the three potential lactylation sites of NLRP3 (Fig. 4C). Western blot revealed that mutation of K245 site caused a significant decrease in the lactylation and expression of NLRP3 in contrast with the wild-type group, verifying that LDHA was responsible for NLRP3 lactylation at K245 site (Fig. 4D). More than that, knockdown of LDHA gave rise to the diminution of NLRP3 stability in the face of CHX (Fig. 4E). To sum up, LDHA drove K245 lactylation of NLRP3 to facilitate its expression.
Fig. 4.
LDHA stabilized NLRP3 expression through lactylation. (A-B) The function of LDHA in NLRP3 lactylation was evaluated with western blot assay. (C) Potential lactation sites of NLRP3 predicted by bioinformation website (http://lin-group.cn/server/DeepKla/Serve.html). (D) Western blot was employed to identify the NLRP3 lactation site. (E) The impacts of LDHA on NLRP3 stability was also analyzed by western blot. vs. the control or siNC group, **P < 0.01, ***P < 0.001. vs. the H/R group, ###P < 0.001, N = 3
Upregulation of NLRP3 eliminated the effects of LDHA knockdown on H/R damage
For the sake of proving the involvement of LDHA/NLRP3 axis in H/R-induced pyroptosis, H9c2 cells exposed to H/R were dealt with the NLRP3 agonist nigericin following transfection with si-LDHA vectors. Our observations unraveled that the concentrations of LDH, IL-1β and IL-18 decreased by repression of LDHA were elevated due to nigericin treatment (Fig. 5A-C). Flow cytometry assay disclosed that cell pyroptosis depressed by LDHA knockdown was renewed when H/R-treated H9c2 cells were administered with nigericin (Fig. 5D). Furthermore, the protein expression levels of cleaved caspase-1 and GSDMD-N were weakened by LDHA depletion and subsequently enforced by activation of NLRP3 (Fig. 5E). In general, NLRP3 acted as a downstream effector for LDHA accountable to regulating H/R injury.
Fig. 5.
Upregulation of NLRP3 eliminated the effects of LDHA knockdown on H/R damage. (A-C) The detection results of LDH activity and the expression of IL-1β and IL-18. (D) Flow cytometry assay was performed to verify the role of LDHA/NLRP3 axis in cell pyroptosis. (E) Western blot analysis of cleaved caspase-1 and GSDMD-N in H/R-induced cardiomyocytes following different treatment. vs. the siNC group, **P < 0.01, ***P < 0.001. vs. the siLDHA group, #P < 0.05, ##P < 0.01, ###P < 0.001, N = 3
NLRP3 mediated the promoting function of LDHA in myocardial injury in vivo
Eventually, animal experiment was implemented to consolidate our theory. Mice underwent LAD coronary artery ligation and reperfusion to construct the in vivo model. LDHA-KO mice were adopted to certify the role of LDHA in I/R damage. TTC staining showed that the infarct area of heart tissues was increased by I/R and knockout of LDHA relieved the I/R-evoked myocardial infarction (Fig. 6A-B). In addition, activation of NLRP3 abolished the function of LDHA knockout in I/R-induced infarction (Fig. 6A-B). In agreement with histological analysis, we demonstrated that I/R brought about the enhanced expression of myocardial enzymes LDH, CK-MB and cTnl, while LDHA deficiency impeded the increase of these indicators triggered by I/R (Fig. 6C-E). NLRP3 upregulation eliminated the effects of LDHA knockout on myocardial enzymes in I/R mice (Fig. 6C-E). Finally, LDHA knock out showed decreased LDHA protein level compared with the I/R + KO-NC group, and the result was reversed after activation of NLRP3 (Fig. 6F). Collectively, LDHA facilitated I/R-induced myocardial damage in mice via elevating NLRP3 expression.
Fig. 6.
NLRP3 mediated the promoting function of LDHA in myocardial injury in vivo. (A) The TTC staining images of heart tissue in each group. (B) The quantification of cardiac infarct area. (C-E) The expression of myocardial enzymes LDH, CK-MB and cTnl in mice receiving different interventions. vs. the sham + KO-NC group. (F) The protein expression of LDHA in each group was analyzed by Western blot. vs. the sham + KO-NC group, ***P < 0.001. vs. the I/R + KO-NC group, ###P < 0.001. vs. the I/R + KO-LDHA group, &P < 0.05, &&&P < 0.01, N = 6
Discussion
Myocardial I/R injury is an inevitable cardiac damage in patients with ischemic heart disease due to the restoration of blood flow in the coronary arteries, which is manifested by the dysfunction, structural impairment and electrophysiological disorder of the heart, thus contributing to an apparent growth in the death rate of myocardial infarction [28, 29]. In terms of the reported data, I/R damage can account for approximately 50% of total heart injury cases and lead to various grave consequences, including arrhythmia cordis, heart failure and sudden cardiac arrest [30, 31]. Given that myocardial I/R injury is a global problem threatening human health, how to reduce I/R during revascularization is critical to ischemic heart disease therapy [32]. As a result, elucidating its pathogenesis is the first prerequisite.
Accumulating investigations have elucidated that cardiomyocyte pyroptosis performs a core role in the progression of myocardial I/R [33, 34]. On the grounds of relevant researches, H/R-induced H9c2 cells are commonly used to establish the in vitro model of myocardial I/R injury [35–37]. Thus, we adopted this cell model and then assessed the pyroptosis of H/R-treated H9c2 cells. Our results manifested that the concentrations of LDH, IL-1β and IL-18, cell pyroptosis rate and the expression of cleaved caspase-1 and GSDMD-N were much higher in H/R-stimulated H9c2 cells than in untreated cardiomyocytes. We verified that H/R led to the aggravation of cardiomyocyte pyroptosis, which was in conformity with previous reports [38–40].
Protein lactylation is a kind of epigenetic modification and is participated in the progression of diverse diseases by regulating a wide range of biological processes, such as proliferation, osteogenic differentiation, endothelial-to-mesenchymal transition (EMT), inflammation, fibrosis and pyroptosis [41, 42]. Therefore, lactylation has attracted more attention and become a research hotspot in recent year. An increasing number of studies have certified that lactate-regulated lactylation exerts a promoting role in pyroptosis [26, 43, 44]. Further, abnormal lactylation level has been observed in cerebral I/R rats [45]. More importantly, it has been justified that lactate-driven lactylation exacerbates the damage of myocardial infarction by inducing EMT [46]. Nevertheless, the function of lactylation in myocardial I/R is largely to be clarified. Herein, we found that the expression of total lactylated protein was remarkably enhanced in H9c2 cells exposed to H/R. In addition, upregulation of lactylation facilitated the release of proinflammatory factors, increased the proportion of pyroptotic cells and strengthened the expression of LDH, cleaved caspase-1 and GSDMD-N in H/R-induced cardiomyocytes. Inversely, LDHA deficiency mitigated H/R-evoked myocardial injury through alleviating pyroptosis.
NLRP3 inflammasome is a mediator of pyroptosis, which is composed of NLRP3, ASC and caspase-1 [47]. Besides, GSDMD is a molecule essential for inducing pyroptosis in response to activation of the NLRP3 inflammasome [48]. Surging evidence has testified that NLRP3 inflammasome and GSDMD function as inducible factors for cardiomyocyte pyroptosis to drive myocardial I/R injury [49–51]. In view of the above, we detected the effect of lactate treatment on the lactylation levels of NLRP3, ASC, caspase-1 and GSDMD in H/R-stimulated H9c2 cells. Our findings validated that only NLRP3 lactylation was promoted by administration of lactate, while LDHA knockdown reduced the expression and lactylation of NLRP3. Thereafter, K245 was identified as the lactylation site of NLRP3, and silencing of LDHA decreased the protein stability of NLRP3. Furthermore, activation of NLRP3 abated the ameliorative potency of LDHA deficiency in H/R-evoked cardiomyocyte pyroptosis. Consistently, in vivo experiments indicated that knockout of LDHA diminished the infarct size of heart tissues and the expression of LDH, CK-MB and cTnl in I/R mice, while Nigericin treatment abrogated the impacts of LDHA knockout on I/R injury.
In summary, the novelty of our study was to shed light on the importance and mechanism of lactylation in myocardial I/R injury. We demonstrated that LDHA promoted pyroptosis to induce myocardial I/R injury via upregulation of NLRP3 lactylation, indicating NLRP3 as a promising target for the therapy of ischemic heart disease.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
Not applicable.
Author contributions
YW conceived the study; LF conducted the experiments; ZY, XQ and HF analyzed the data; LF was a major contributor in writing the manuscript. All authors read and approved the final manuscript.
Funding
Not applicable.
Data availability
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
The study was approved by the Ethics Committee of MDKN Biotechnology Co., Lt (MDKN-2023-307, 2023.11.02). All experiments were performed in accordance with relevant guidelines and regulations.
Consent for publication
Not applicable.
Clinical trial number
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Kaski J-C, et al. Reappraisal of Ischemic Heart Disease. Circulation. 2018;138(14):1463–80. [DOI] [PubMed] [Google Scholar]
- 2.Okwuosa IS, et al. Worldwide disparities in cardiovascular disease: challenges and solutions. Int J Cardiol. 2016;202:433–40. [DOI] [PubMed] [Google Scholar]
- 3.Patel MR, et al. ACC/AATS/AHA/ASE/ASNC/SCAI/SCCT/STS 2017 Appropriate Use Criteria for Coronary revascularization in patients with stable ischemic heart disease: a report of the American College of Cardiology Appropriate Use Criteria Task Force, American Association for Thoracic Surgery, American Heart Association, American Society of Echocardiography, American Society of Nuclear Cardiology, Society for Cardiovascular Angiography and interventions, Society of Cardiovascular Computed Tomography, and Society of thoracic surgeons. J Am Coll Cardiol. 2017;69(17):p2212–2241. [DOI] [PubMed] [Google Scholar]
- 4.Neri M, Riezzo I. Ischemia/Reperfusion Injury following Acute Myocardial Infarction: A Critical Issue for Clinicians and Forensic Pathologists. 2017;7018393. [DOI] [PMC free article] [PubMed]
- 5.Ibáñez B, et al. Evolving therapies for myocardial ischemia/reperfusion injury. J Am Coll Cardiol. 2015;65(14):1454–71. [DOI] [PubMed] [Google Scholar]
- 6.Yang CF. Clinical manifestations and basic mechanisms of myocardial ischemia/reperfusion injury. Ci Ji Yi Xue Za Zhi. 2018;30(4):209–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Abate SM, et al. Global burden of acute myocardial injury associated with COVID-19: a systematic review, meta-analysis, and meta-regression. Ann Med Surg (Lond). 2021;68:102594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Liu Y, Zhang J, Zhang D. Res Progress Role Pyroptosis Myocard Ischemia-Reperfusion Injury. 2022;11(20). [DOI] [PMC free article] [PubMed]
- 9.Zhou M, et al. Myocardial ischemia-reperfusion Injury: therapeutics from a Mitochondria-Centric Perspective. Cardiology. 2021;146(6):781–92. [DOI] [PubMed] [Google Scholar]
- 10.Popov SV, et al. Regulation of autophagy of the heart in ischemia and reperfusion. Apoptosis. 2023;28(1–2):55–80. [DOI] [PubMed] [Google Scholar]
- 11.Zou R, et al. Empagliflozin attenuates cardiac microvascular ischemia/reperfusion injury through improving mitochondrial homeostasis. Cardiovasc Diabetol. 2022;21(1):106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Broz P. Immunology: caspase target drives pyroptosis. Nature. 2015;526(7575):642–3. [DOI] [PubMed] [Google Scholar]
- 13.Ge X, et al. The pathological role of NLRs and AIM2 inflammasome-mediated pyroptosis in damaged blood-brain barrier after traumatic brain injury. Brain Res. 2018;1697:10–20. [DOI] [PubMed] [Google Scholar]
- 14.Zheng Y, Xu X. Pyroptosis: A Newly Discovered Therapeutic Target for Ischemia-Reperfusion Injury. Biomolecules. 2022;12(11):1625. [DOI] [PMC free article] [PubMed]
- 15.Popov SV, Maslov LN. Role Pyroptosis Ischemic Reperfusion Injury Heart. J Cardiovasc Pharmacol Ther. 2021;26(6):562–74. [DOI] [PubMed] [Google Scholar]
- 16.Sun J et al. LncRNA ROR modulates myocardial ischemia-reperfusion injury mediated by the miR-185-5p/CDK6 axis. Lab Invest. 2022;102(5):505-14. [DOI] [PubMed]
- 17.Zhang J, et al. Metformin protects against myocardial ischemia-reperfusion injury and cell pyroptosis via AMPK/NLRP3 inflammasome pathway. Aging. 2020;12(23):24270–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhang B, Liu G. KDM3A Attenuates Myocardial Ischemic and Reperfusion Injury by Ameliorating Cardiac Microvascular Endothelial Cell Pyroptosis. Oxid Med Cell Longev. 2022;4622520. [DOI] [PMC free article] [PubMed]
- 19.Lou Y, et al. miR-424 promotes cardiac ischemia/reperfusion injury by direct targeting of CRISPLD2 and regulating cardiomyocyte pyroptosis. Int J Clin Exp Pathol. 2018;11(7):3222–35. [PMC free article] [PubMed] [Google Scholar]
- 20.Lu C, Chen C. Oridonin Attenuates Myocardial Ischemia/Reperfusion Injury via Downregulating Oxidative Stress and NLRP3 Inflammasome Pathway in Mice. Evid Based Complement Alternat Med. 2020;7395187. [DOI] [PMC free article] [PubMed]
- 21.Yoshida GJ. Metabolic reprogramming: the emerging concept and associated therapeutic strategies. J Exp Clin Cancer Res. 2015;34:111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Certo M, Tsai CH, Pucino V. Lactate Modulation Immune Responses Inflamm versus Tumour Microenvironments. Nat Rev Immunol. 2021;21(3):151–61. [DOI] [PubMed] [Google Scholar]
- 23.Zhang D, et al. Metabolic regulation of gene expression by histone lactylation. Nature. 2019;574(7779):575–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Cheng X, Wang K. Research progress on post-translational modification of proteins and cardiovascular diseases. Cell Death Discov. 2023;9(1):275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lv X, Lv Y, Dai X. Lactate, histone lactylation and cancer hallmarks. Expert Rev Mol Med. 2023;25:e7. [DOI] [PubMed] [Google Scholar]
- 26.Li Q, et al. NEDD4 lactylation promotes APAP induced liver injury through Caspase11 dependent non-canonical pyroptosis. Int J Biol Sci. 2024;20(4):1413–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Du S, et al. Hepatocyte HSPA12A inhibits macrophage chemotaxis and activation to attenuate liver ischemia/reperfusion injury via suppressing glycolysis-mediated HMGB1 lactylation and secretion of hepatocytes. Theranostics. 2023;13(11):3856–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Mao ZJ et al. A Meta-Analysis of Resveratrol Protects against Myocardial Ischemia/Reperfusion Injury: Evidence from Small Animal Studies and Insight into Molecular Mechanisms. Oxid Med Cell Longev. 2019: p. 5793867. [DOI] [PMC free article] [PubMed]
- 29.Hausenloy DJ, Yellon DM. Myocardial ischemia-reperfusion injury: a neglected therapeutic target. J Clin Invest. 2013;123(1):92–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Chen Z, et al. Apelin/APJ system: a Novel Therapeutic Target for Myocardial Ischemia/Reperfusion Injury. DNA Cell Biol. 2016;35(12):766–75. [DOI] [PubMed] [Google Scholar]
- 31.Li Y et al. miR-190-5p Alleviates Myocardial Ischemia-Reperfusion Injury by Targeting PHLPP1. Dis Markers. 2021;2021:8709298. [DOI] [PMC free article] [PubMed]
- 32.Li T, et al. Resveratrol protects against myocardial ischemia-reperfusion injury via attenuating ferroptosis. Gene. 2022;808:145968. [DOI] [PubMed] [Google Scholar]
- 33.Li C, et al. LncRNA PVT1 Knockdown ameliorates myocardial ischemia reperfusion damage via suppressing gasdermin D-Mediated pyroptosis in Cardiomyocytes. Front Cardiovasc Med. 2021;8:747802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhang Y, Hailati J. Ubiquitin-specific protease 11 aggravates ischemia-reperfusion-induced Cardiomyocyte Pyroptosis and Injury by promoting TRAF3 deubiquitination. Balkan Med J. 2023;40(3):205-14. [DOI] [PMC free article] [PubMed]
- 35.Ma X, et al. Dexmedetomidine attenuates myocardial ischemia-reperfusion injury via inhibiting ferroptosis by the cAMP/PKA/CREB pathway. Mol Cell Probes. 2023;68:101899. [DOI] [PubMed] [Google Scholar]
- 36.Chen X et al. Trimetazidine affects pyroptosis by targeting GSDMD in myocardial ischemia/reperfusion injury. Inflamm Res. 2022;71(2):227-41. [DOI] [PubMed]
- 37.Ding S, et al. Inhibiting MicroRNA-29a protects myocardial ischemia-reperfusion Injury by Targeting SIRT1 and suppressing oxidative stress and NLRP3-Mediated pyroptosis pathway. J Pharmacol Exp Ther. 2020;372(1):128–35. [DOI] [PubMed] [Google Scholar]
- 38.Zhu Y, et al. High-dose remifentanil exacerbates myocardial ischemia-reperfusion injury through activation of calcium-sensing receptor-mediated pyroptosis. Int J Med Sci. 2023;20(12):1570–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.He W, Duan L. LOXL1-AS1 aggravates myocardial Ischemia/Reperfusion Injury through the miR-761/PTEN Axis. Korean Circ J. 2023;53(6):387-403. [DOI] [PMC free article] [PubMed]
- 40.An L, et al. Sevoflurane exerts protection against myocardial ischemia-reperfusion injury and pyroptosis through the circular RNA PAN3/microRNA-29b-3p/stromal cell-derived factor 4 axis. Int Immunopharmacol. 2023;120:110219. [DOI] [PubMed] [Google Scholar]
- 41.Gong H, et al. Post-translational protein lactylation modification in health and diseases: a double-edged sword. J Transl Med. 2024;22(1):41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Xie Y, et al. The role and mechanism of histone lactylation in health and diseases. Front Genet. 2022;13:949252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Yao X, Li C. Lactate dehydrogenase A mediated histone lactylation induced the pyroptosis through targeting HMGB1. Metab Brain Dis. 2023;38(5):1543–53. [DOI] [PubMed] [Google Scholar]
- 44.Xu X, et al. Sox10 escalates vascular inflammation by mediating vascular smooth muscle cell transdifferentiation and pyroptosis in neointimal hyperplasia. Cell Rep. 2023;42(8):112869. [DOI] [PubMed] [Google Scholar]
- 45.Yao Y, Bade R. Global-scale profiling of Differential expressed lysine-lactylated proteins in the cerebral endothelium of cerebral ischemia-reperfusion Injury rats. Cell Mol Neurobiol. . 2023;43(5):1989-2004. [DOI] [PMC free article] [PubMed]
- 46.Fan M, Yang K. Lactate promotes endothelial-to-mesenchymal transition via Snail1 lactylation after myocardial infarction. Sci Adv. 2023;9(5):eadc9465. [DOI] [PMC free article] [PubMed]
- 47.He F, et al. N-acetylcysteine alleviates post-resuscitation myocardial dysfunction and improves survival outcomes via partly inhibiting NLRP3 inflammasome induced-pyroptosis. J Inflamm (Lond). 2020;17:25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Shi J, et al. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature. 2015;526(7575):660–5. [DOI] [PubMed] [Google Scholar]
- 49.Luan F, et al. Cinnamic acid preserves against myocardial ischemia/reperfusion injury via suppression of NLRP3/Caspase-1/GSDMD signaling pathway. Phytomedicine. 2022;100:154047. [DOI] [PubMed] [Google Scholar]
- 50.Luan F, et al. Cardioprotective effect of cinnamaldehyde pretreatment on ischemia/ reperfusion injury via inhibiting NLRP3 inflammasome activation and gasdermin D mediated cardiomyocyte pyroptosis. Chem Biol Interact. 2022;368:110245. [DOI] [PubMed] [Google Scholar]
- 51.Lin J et al. Oridonin Protects against Myocardial Ischemia-Reperfusion Injury by Inhibiting GSDMD-Mediated Pyroptosis. Genes (Basel). 2022;13(11):2133. [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.






