Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Nov 2;103(12):104499. doi: 10.1016/j.psj.2024.104499

Exploration of age-related changes in reproductive parameters of female Japanese quail (Coturnix japonica)

Maryam Taghipour-Shahbandi a, Mahdi Zhandi a,⁎, Zarbakht Ansari-Pirsaraei b, Ali Reza Yousefi c
PMCID: PMC11570721  PMID: 39500266

Abstract

The decline in reproductive efficiency during post-peak period of production in poultry species holds significant economic implications. This study aimed to investigate the productive and reproductive performance of Japanese quails across distinct production stages and the association between these parameters and some genes expression and histometric alterations within the reproductive system. A total of 180 quails from a commercial flock were selected at varying egg production stages, including young, mature, and old, with 45 female and 15 male quails allocated to each group. The quails were maintained for six weeks. During recording period, daily records of egg production and egg weight were recorded. Additionally, oviduct histometric and Follicle biometric measurements, along with mRNA transcript abundance assessments related to follicular selection and yolk accumulation, were conducted on the oviduct, ovary, and small yellow follicles at the end of the experimental period. The results revealed a decrease in egg production in the old group compared to the young and mature groups (P < 0.05); meanwhile, the old group had the highest egg weight, and F1 follicle weight (P < 0.05). Additionally, the number of prehierarchical follicles was lower in the mature and old groups compared to the young group (P < 0.05). The lowest oviduct length, primary and secondary fold height, and thickness of the isthmus and magnum were noted in the old group (P < 0.05). Fertility and hatchability were lower in the old group compared to the other groups (P < 0.05). The mRNA transcript abundance of anti-Mullerian hormone (AMH), was highest in the old group and lowest in the young group (P < 0.05), while the mRNA transcript abundance of bone morphogenetic protein 15 (BMP15) was higher in the mature group compared to the other groups (P < 0.05). Additionally, the young quails had the highest occludin (OCLN) mRNA transcript abundance compared to other groups (P < 0.05). Overall, the study findings indicate decreased production and reproductive performance, as well as reduced hatchling quality over the production period, attributed to a declining number of follicles, noncooperative gene expression related to follicle selection and yolk accumulation, and diminishing oviduct fold size.

Keywords: Aging, Egg production, Fertility, Follicle selection, Yolk accumulation

Introduction

Efficient reproduction is vital for poultry productivity and profitability. In quails, factors like age, diet, sex ratio, and environmental conditions significantly influence reproductive efficiency. Aging correlates with decreased egg production, fertility, and chick production, impacting various reproductive parameters (Lillpers and Wilhelmson, 1993; Farooq et al., 2012; Hao et al., 2021., He et al., 2023). Studies have highlighted the detrimental impact of aging on production and reproduction in poultry (Holmes et al., 2003; Liu et al., 2018; Ma et al., 2020).

Aged birds exhibit several significant changes, including reduced reproductive hormones (Buyuk et al., 2010), decreased yolk synthesis and accumulation (Zakaria et al., 1983), a lower number of ovarian follicles (Zakaria et al., 1983; Hao et al., 2021), and decreased oviduct weight and length (Gonzalez-Moran, 2016), all of which contribute to a poor fertility and hatchability (Santos et al., 2015; Hameed et al., 2016). It is widely acknowledged that changes in the dynamics and growth of ovarian follicles and yolk accumulation in follicles are the most critical factors associated with lower reproductive performance in post-peak production birds (Zakaria et al., 1983; Johnson et al., 1986; Hao et al., 2021).

The mechanism of follicular selection and yolk accumulation in birds is complex and involves various hormones and factors. Anti-Mullerian hormone (AMH), bone morphogenetic protein 15 (BMP15), occludin (OCLN), and the specific yolk receptor (LR8) are the most important genes in process of follicular development and yolk accumulation in birds (Schuster et al., 2004; Schneider, 2009; Stephens and Johnson, 2016; Francoeur et al., 2024).

While some roles of genes related to follicular selection and yolk accumulation have been elucidated, the intricate regulation of this network and its association with aging or the post-peak production period remains incompletely understood in quails. Additionally, it is important to note that oviduct is a site of egg formation and fertilization. Aging is associated with oviduct atrophy in birds (Kimaro et al., 2013; Saemi et al., 2018; Varga et al., 2019) and decreases the length of the oviduct, fold size, the tunica mucosal area, and the tubal glands (Gonzalez-Moran, 2016; Sukhadeve et al., 2021).

Changes in expression of genes related to follicular selection and yolk accumulation between different ages of quails have not been thoroughly investigated, therefore this study aimed to assess the expression of above-mentioned genes, as well as egg production, oviduct histometric parameters, and fertility in Japanese quails across different age groups.

Materials and methods

This study received approval from the Animal Care Committee and Animal Research Ethics Board within the Department of Animal Science at University of Tehran, Iran (Approval Number: 73131587.6.23). All procedures adhered to the guidelines set forth by the Animal Care and Use Committee of the Iranian Council for Animal Care.

Bird management and experimental groups

One hundred and eighty laying Japanese quails (Coturnix japonica) were randomly selected from a commercial flock at different age, including young (6 weeks of age), mature (21 weeks of age), and old (40 weeks of age) (n=45 female and 15 male quails/group). All the male quails in this study had a same age (6 weeks of age). The quails were maintained for six weeks (adaptation and recording period). During recording period daily records of egg production and egg weight were recorded (Hansen et al., 2003). Each group was subdivided into five replicates, each, consisting of 12 birds. Within each replicate, there were three male and nine female quails, maintaining a 1:3 male-to-female ratio (Hansen et al., 2003). The birds in each replicate were housed in cages measuring 80×80 cm and were subjected to a lighting schedule of 16 hours of light and 8 hours of darkness, with a brightness of 10 lux. The ambient temperature was maintained at 24±2 ºC, and ventilation was provided at a rate of 540 m3/h throughout the experimental period. The quails were fed a basal diet (Table 1) formulated to meet their nutritional requirements according to National Research Council guidelines (1994) and had ad libitum access to fresh water.

Table 1.

Ingredients and chemical composition of the diet.

Ingredient Amount (%)
Corn 54.25
Soybean meal, 44% CP 34.80
Dicalcium phosphate 1.45
CaCO3 5.25
Common salt 0.20
NaHCO3 0.17
Vegetable oil 3.23
DL-Met, 99% 0.15
Mineral premix1 0.25
Vitamin premix2 0.25
Total 100
Calculated nutrient content
AME (kcal/kg) 2900
CP (%) 20
Calcium (%) 2.5
Available phosphorus (%) 0.35
Sodium (%) 0.15
Lysine (%) 1.59
Methionine (%) 0.45
Met + cys (%) 0.77
Threonine (%) 0.77
1

mineral premix supplied the following per kg diet: choline, 300 mg; iron, 50 mg; manganese, 120 mg; Zn, 110 mg; copper, 10 mg; selenium, 0 mg; iodine, 2 mg.

2

Vitamin premix supplied the following per kg of diet: vitamin A, 11,000 IU; vitamin D3, 3500 IU; vitamin E acetate, 150 IU; vitamin K3, 5.0 mg; vitamin B1, 3.0 mg; vitamin B2, 12 mg; vitamin B3, 55 mg; vitamin B5, 15 mg; vitamin B6, 4 mg; vitamin B9, 2 mg; vitamin B8, 0.25 mg; and vitamin B12, 0.03 mg.

Egg weight and production

Throughout the experiment, the daily production of eggs and their respective weights [by a digital balance (0.01 g)] were recorded.

Necropsy

At the end of the experiment, ten females from each group (two birds per replicate) were randomly selected, weighed, and euthanized. The oviduct and ovary were then collected for subsequent histometric and biometric evaluations, respectively (Rafieian-Naeini et al., 2021). Additionally, samples of the walls of small yellow follicles (SYFs) were harvested (sun et al., 2022) and stored at -80 °C for relative gene expression analysis of follicular selection and yolk accumulation.

Ovarian follicle biometry

Following euthanasia, the ovaries were collected, and measurements were recorded for F1 follicle weight and diameter by digital balance (0.01 g) and digital caliper (0.01 mm), respectively, as well as the counts of small (SWF, 1-2 mm), large white (LWF, 2-4 mm), and small yellow follicles (SYF, 4-6 mm) (Hrabia et al., 2004).

Oviduct length and histometry

After oviduct collection, its length was measured, and small segments (approximately 2 cm) of the isthmus and magnum were excised for histometric analysis. These samples were fixed in 10% neutral buffered formalin, embedded in paraffin blocks, and sectioned using a rotary microtome (Rotary microtome, Didsabz company, model DS4055, Urmia, Iran) into 7-micron sections. Following staining with hematoxylin and eosin (H&E), optical microscopy equipped with a camera was employed for evaluation. At a magnification of 40X, images of the isthmus and magnum tissue were captured, and the length and width of the oviduct folds were measured (Rafieian-Naeini et al., 2021) utilizing ImageJ software (version 1.52a).

Reproductive performance and hatchling quality

All eggs collected during the experiment [young (n=201), mature (n=187), old (n=122)] were incubated. After 18 days, hatchability was determined ([number of chicks hatched/number of eggs set] × 100). Unhatched eggs were examined to assess infertility, calculate the fertility rate ([number of fertile eggs/total number of eggs set] × 100), and categorize embryonic mortality as early (1 to 6 days), mid (7 to 12 days), or late (13 to 18 days) embryonic mortality (Ainsworth et al., 2010; Parker et al., 2012). Additionally, hatchling quality and weight were evaluated (Tona et al., 2003).

RNA extraction, cDNA synthesis, and real-time PCR

Small yellow follicles (4-6 mm) were carefully dissected from the ovary, and the yolk was gently expelled into a petri dish. Subsequently, the follicular layers of all SYFs were rinsed with phosphate-buffered saline (PBS) to remove any adhering yolk and then stored at -80 °C until further evaluation of relative gene expression. Total RNA extraction from SYFs was performed using a commercial RNA extraction kit (RNX-Plus, SinaClon Co, Iran) following the manufacturer's instructions. Before adding RNX-Plus, tissues were homogenized with liquid nitrogen and then mixed with this reagent. Samples of RNA were stored at -80 °C. Before stored, RNA integrity was electrophoretically verified using ethidium bromide. The extracted RNA underwent DNase treatment (DNaseI, RNase-free, CinnaGen Co. Iran) to eliminate potential DNA contamination. Next, cDNA synthesis was carried out using a cDNA synthesis kit (AddScript cDNA Synthesis kit, Addbio Co. Korea) as per the manufacturer's protocol. Briefly, a mixture comprising of 3 μL of RNA, 10 μL of reaction buffer, 2 μL of dNTP mixture, 2 μL of oligo dT20, 1 μL of AddScript enzyme solution, and 2 μL of nuclease-free water was prepared to yield a final reaction volume of 20 μL. The cDNA synthesis was performed by incubating the mixture in a Thermal Cycler (Peqlab Biotechnologie GmbH, Primus 25 advanced, Erlangen, Germany) with a thermal program consisting of 10 min of priming at 25 °C, 60 min of reverse transcription at 50 °C, and 10 min of reverse transcriptase inactivation at 80 °C. The primers targeting the AMH, BMP-15, LR8, OCLN, and β-actin (housekeeping) genes are listed in Table 2.

Table 2.

Primer sequences used for real-time PCR.

Gene Direction Primer sequences (5′-3′) Product size (bp) Accession number
AMH Forward CCAATCCCTGCGAAACCT 136 XM_015886199.1
Reverse CACCTCCCCTGCGAAACAC
BMP15 Forward GCTGGAGGGGACAAAAgTGA 107 XM_015860035.2
Reverse TAGCGTGGGTTGTAGCGATG
LR8 Forward GCCTCCTGTAAAGTGTTCTACCA 189 XM_015848918.2
Reverse CACTGCCTAGTCCCATGGAT
OCLN Forward TGAGACCGACTACACCACG 187 NM_205128.1
Reverse CTGATTGAGGCGGTCGTTGA
β-actin Forward GACCTTCAACACCCCAGCCAT 118 NM_205518.2
Reverse GGGCACAGTGTGGGTAACACC

Abbreviations: AMH, anti-Mullerian hormone; BMP15, bone morphogenetic protein 15; LR8, specific yolk receptor or very low-density lipoprotein receptor (VLDLR); OCLN, occludin.

For the real-time PCR reaction, 1 μL of cDNA was combined with 14 μL of a solution containing 2 μL of forward and reverse primers, 7.5 μL of Green PCR Master Mix (QuantiNovaTM SYBR Green PCR kit), and 4.5 μL of RNase-free water. Real-time PCR was performed using a Rotor-Gene 3000 (Corbett Co. Australia) with a thermal program comprising 10 min of predenaturation at 95 °C, followed by 40 cycles consisting of 15 s of denaturation at 95 °C and 60 s of annealing and extension at 60 °C. The comparative Ct value method was employed to determine the target gene expression concentrations relative to the β-actin gene. The relative changes in gene expression derived from real-time qualitative PCR experiments were calculated using the 2-ΔΔCT method, as described by Livak and Schmittgen (2001).

Statistical analysis

Continuous data were analyzed using analysis of variance (ANOVA) in a completely randomized design, utilizing the Proc GLM function of SAS 9.4 software (SAS Institute Inc., 2013). Before analysis, the normal distribution of the data was assessed through Shapiro–Wilk and Kolmogorov–Smirnov tests using the UNIVARIATE SAS procedure. Binary distributed data, such as fertility and hatchability, were analyzed using the GENMOD procedure with a logit odds ratio link function. Tukey's range test was employed for multiple comparisons of means. Results are presented as mean ± SEM, with significance levels indicated as P < 0.05 for statistically significant differences and 0.05 ≤ P ≤ 0.10 for tendencies.

Results

Body weight, egg weight, and egg production

Table 3 presents the body weight (BW), egg weight, and egg production of laying Japanese quails at different ages. Body weight was not affected by production period (P > 0.05). However, egg weight was observed to be significantly higher in old group compared to other groups, while egg production was lowest in the old group (P < 0.05).

Table 3.

Body weight, egg weight, and egg production of the laying Japanese quail at the different ages (n=45 female quails per group).

Variable Experimental group1 SEM2 P Value
Young Mature Old
Body weight (gr) 260.80 271.00 269.40 3.55 0.46
Egg weight (gr) 11.66b 12.11b 13.16a 0.10 <0.01
Egg production (%) 70. 47a 64.44a 41.52b 2.61 <0.01

a– c: Within each row, means with different superscripts differ significantly (P < 0.05).

1

Quails at the different ages, including young, mature, and old.

2

Standard error of the mean.

Ovarian follicle biometry

Various follicle biometric measurements of laying Japanese quails at different ages are shown in Table 4. The F1 follicle weight and diameter were higher in old group compared to other groups (P < 0.05). Conversely, the number of SWFs was lowest in the old group and highest in the young group (P < 0.05). Moreover, the number of LWFs and SYFs was higher in the young group compared to other groups (P < 0.05).

Table 4.

Follicle biometric measurements of laying Japanese quail at the different ages (n=45 female quails per group).

Variable Experimental group 1 SEM2 P Value
Young Mature Old
F1 follicle weight (gr) 3.01b 3.36 b 3.95a 0.01 <0.01
F1 follicle diameter (mm) 17.50b 18.43ab 18.97a 0.17 <0.01
Number of SWF3 19.60a 13.10b 11.10c 2.23 <0.01
Number of LWF4 18.10a 16.40ab 13.60b 0.65 <0.05
Number of SYF5 2.40a 1.30b 0.70b 0.13 <0.01

a– c: Within each row, means with different superscripts differ significantly (P < 0.05).

1

Quails at the different ages, including young, mature, and old.

2

Standard error of the mean.

3

SWF: Small white follicle (1-2 mm) (Hrabia et al., 2004).

4

LWF: Large white follicle (2-4 mm) (Hrabia et al., 2004).

5

SYF: Small yellow follicle (4-6 mm) (Hrabia et al., 2004).

Oviduct length and histometry

Histometric evaluation of the isthmus and magnum in laying Japanese quails at different ages is presented in Table 5 and visually depicted in Fig. 1. The primary and secondary fold height and thickness of the isthmus were lower in the old group compared to other groups (P < 0.05). Similarly, the primary fold height and thickness in the magnum exhibited a similar trend, with the lowest values observed in old quails (P < 0.05). Although the secondary fold height of the magnum was not significantly affected by age, the old group showed thinner secondary folds compared to the young group (P < 0.05).

Table 5.

Comparison of the isthmus and magnum folds of the laying Japanese quail at the different ages (n=45 female quails per group).

Variable Experimental group 1 SEM2 P value
Young Mature Old
Oviduct length (cm) 33.20a 32.20a 17.50b 0.46 <0.01
Isthmus
Primary fold height (µm) 1280.19a 1262.73a 1032.52b 26.69 <0.01
Secondary fold height (µm) 690.02a 729.49a 485.58b 19.16 <0.01
Primary fold thickness (µm) 330.47a 354.38a 266.73b 7.58 <0.01
Secondary fold thickness (µm) 323.02a 343.95a 228.73b 8.35 <0.01
Magnum
Primary fold height (µm) 1096.53a 1082.66a 897.34b 29.20 <0.01
Secondary fold height (µm) 571.30 559.64 537.32 23.59 0.82
Primary fold thickness (µm) 510.23a 559.20a 370.81b 14.47 <0.01
Secondary fold thickness (µm) 385.75a 353.46ab 290.00b 12.79 <0.01

a– c: Within each row, means with different superscripts differ significantly (P < 0.05).

1

Quails at the different ages, including young, mature, and old.

2

Standard error of the mean.

Fig. 1.

Fig 1

Histological comparison of the isthmus and magnum folds of Japanese quails in different production period groups. The Isthmus and magnum sections were stained with hematoxylin and eosin. Photos show folds with 40X magnification (Scale bar = 500 mm). (a) Primary fold, (b) Secondary fold, (Fh) Fold height, (Ft) Fold thickness.

Reproductive performance and hatchling quality

Table 6 presents the reproductive performance and hatchling quality of laying Japanese quails at different ages. Fertility and hatchability were lower in the old group compared to other groups, with the highest values observed in the young group (P < 0.05). Early and middle embryonic mortality rates were highest in the old group; however, the different age groups did not have a significant effect on late embryonic mortality. Hatchling body weight was found to be higher in the old group, while hatchling quality was highest in the young group (P < 0.05).

Table 6.

Reproductive performance and hatchling quality of laying Japanese quail at the different ages (n=45 female quails per group).

Variable Experimental group 1 SEM2 P Value
Young Mature Old
Numbers of total egg set 201 187 122
Number of fertile eggs 198 174 94
Fertility 98.50%a 93.04% b 77.04%c 0.01 <0.01
Number of chicks hatched 147 120 61
Hatchability 73.13%a 64.17%b 50.00%c 0.02 <0.01
Early embryonic mortality 3 12.12%b 12.64%ab 12.76%a 0.01 <0.05
Middle embryonic mortality 4 3.03%b 6.32%ab 8.51%a 0.009 <0.05
Late embryonic mortality5 10.60% 12.06% 13.82% 0.01 0.07
Hatchling body weight (gr) 7.89c 8.27b 8.78a 0.37 <0.01
Hatchling quality 97.98a 96.21ab 95.38b 0.05 <0.05

a– c: Within each row, means with different superscripts differ significantly (P < 0.05).

1

Quails at the different ages, including young, mature, and old.

2

Standard error of the mean.

Relative mRNA abundance

The mRNA transcript abundance of genes related to follicle selection and yolk accumulation is illustrated in Fig. 2. The mRNA transcript abundance of AMH was higher in the old group compared to the young group, which exhibited the lowest values (P < 0.05). Furthermore, the mRNA transcript abundance of BMP15 was found to be higher in the mature group compared to other groups (P < 0.05). No significant difference was observed between different age groups regarding LR8 mRNA transcript abundance. However, the mature group demonstrated a lower OCLN mRNA transcript abundance compared to the young and old groups (P > 0.05).

Fig. 2.

Fig 2

Comparison of (a) AMH (Anti-Mullerian hormone), (b) BMP15 (Bone morphogenetic protein 15), (C) LR8 (Specific yolk receptor), and (d) OCLN (Occludin) transcript in small yellow follicles of the laying Japanese quail at the different ages. Within each experimental group, values with different superscripts (a, b) are significantly different (P < 0.05).

Discussion

Our results revealed a clear association between aging and reproductive parameters, representing a decline in the number of prehierarchical follicles, leading to reduced fertility and hatchability. Additionally, we observed notable alterations in the expression patterns of genes linked to follicle selection, yolk accumulation, oviduct histometry, and hatchling quality.

The relationship between BW and egg production in birds has been well documented in the literature (Lacin et al., 2008; Chen et al., 2006; Pan et al., 2014). In the current study, no significant variations were recorded among different ages in terms of BW, however egg production was affected by aging showing a lower egg production in the old group compared to other groups. This, aligns with findings from Santos et al. (2015) and Abd El-Azeem et al. (2018), who reported a stable BW in European and Japanese quail breeders throughout the production cycle. In contrast, studies by Lacin et al. (2008), Chen et al. (2006), and Pan et al. (2014) indicated an increase in post-peak production body weight in broiler breeders and a decline in body weight after 68 weeks in laying hens, suggesting that BW changes in laying birds may be influenced by species, production type, and recording duration.

Egg production is known to be significantly impacted by the age of birds (El-Wardany et al., 2016; Liu et al., 2018; Hao et al., 2021; He et al., 2023). The decrease in egg production through the reproductive aging is often linked to the alterations in ovarian follicle dynamics and growth. In the current study, the old group displayed characteristics such as a reduced number of prehierarchical follicles, shorter oviduct length, and diminished fold size, accompanied by disrupted gene expression related to follicular selection and yolk accumulation (AMH, BMP15, and OCLN). These observations provide insights into the decline in post-peak egg production.

Regarding ovarian follicle biometry, it was observed that the decline in quantity and quality of ovarian follicles was associated with ovarian aging, as supported by previous research (Lillpers and Wilhelmson, 1993; Bala et al., 2015; Yao et al., 2020; Hao et al., 2021). A decrease in number of follicles and mRNA transcript levels of OCLN was noted in the mature and old groups, while the mRNA transcript levels of AMH were highest in the old group. Elevated AMH mRNA levels in human granulosa cells have been linked to follicular aging, leading to decreased proliferation and growth of granulosa cells, as reported by Kedem et al. (2014). On the other hand, decreased OCLN mRNA levels in hen granulosa cells have been associated with increased yolk accumulation, as discussed by Stephens and Johnson (2017). Therefore, the alterations in mRNA transcript levels of these genes, along with the decline in follicle numbers in the mature and old groups, and increased ovulation interval is likely contributed to the enlargement of F1 follicles in the old group.

The oviduct plays a crucial role in fertilization and provides the pathway for sperm to reach the oocyte (Varga et al., 2019). In the current study, we observed significant reductions in the length of the oviduct, as well as in the height and thickness of the first and second folds in the magnum and isthmus regions in the old group compared to other groups. These findings are consistent with prior research indicating that oviduct length and fold height decrease in non-laying hens and quails after a certain duration, as demonstrated by Gonzalez-Moran (2016) and Sukhadeve et al. (2021). Although sex steroid hormones concentrations have not been assessed in the current study, the changes observed in the oviduct morphology could be attributed to alterations in sex steroid synthesis, and variations in progesterone receptor expression (Gonzalez-Moran, 2016). The diminished fertility observed in the old group may be partially linked to the decrease in fold height in the magnum and isthmus regions, potentially affecting the transport of sperm to the site of fertilization.

Fertility, hatchability, and early embryonic development significantly influence the production of one-day-old chicks. The impact of aging on quail fertility and hatchability has been documented by findings of Farooq et al. (2012), Othman et al. (2014), and Santos et al. (2015). In the current study, both fertility and hatchability were lower in the mature and old groups compared to the young group. This decrease in fertility in the mature and old groups may be attributed to the reduced number of follicles and dysregulation of genes involved in follicular selection and yolk accumulation. It has been shown that an increase in the expression of BMP15 at 20 weeks of age did not affect oocyte quality, ovulation, fertility, and embryo development in mice, but a decrease in the expression of this gene at 40 weeks of age resulted in a reduction in oocyte quality, ovulation, fertility, and embryo development (Park et al., 2020).

The mRNA transcript levels of BMP15 showed an increase in the mature group and a decrease in the old group, with a corresponding decrease in fertility observed in the latter group. While BMP15 may not directly impact fertility in quails, the decrease in fertility could be influenced by other factors or potential interactions of BMP15 regulation with other genes, leading to disruptions in gene regulation and ultimately resulting in reduced fertility. The effects of BMP15 on fertility may vary depending on factors such as species, age, production period, and other influencing variables.

Hatchability was lower and mortality rates during early and middle stages of incubation were higher in the old group compared to the other groups. Egg characteristics influenced by the age of the bird can impact hatchability, with albumen liquefaction playing a crucial role in embryonic development and mortality (Meuer and Baumann, 1988; Brake et al., 1997). Some studies have reported that liquefaction during the early stage of incubation is essential for the easy transfer of glucose, albumen, and ions to the blastoderm and the reduction of the gas diffusion barrier created by the eggshell (Meuer and Baumann, 1988; Brake et al., 1997). Moreover, the increased albumen height and Haugh unit in eggs of old quails may disrupt protein balance and alter albumen liquefaction, potentially contributing to increased embryonic mortality and decreased hatchability in this group (Taghipour-shahbandi et al., 2023).

Quantitative methods used to assess hatchling quality, including morphological measurements and hatchling weight, tend to increase with the age of the bird (Ulmer-Franco et al., 2010; Machado et al., 2020). The increase in hatchling weight can be linked to higher yolk and egg weights (Tona et al., 2004a, 2004b). The decrease in follicle numbers and changes in gene expression related to follicular selection and development may lead to alterations in yolk and egg weights. As maternal age increases, the quality of chick production typically declines due to factors such as oocyte aging, reduction in clutch length, and increased ovulation interval (Tona et al., 2004a, 2004b), all of which are associated with decreased egg production (Fasenko et al., 1992; Hao et al., 2021). However, further evaluation is needed to determine the specific impact of these factors on chick quality in the old group.

The current study demonstrated that AMH mRNA transcript abundance in the follicular wall of SYFs in old group was significantly higher compared to the young group. The increased AMH mRNA transcript abundance in human granulosa cells is a marker of follicular aging. This leads to a reduced response of the follicles to FSH, inhibiting the proliferation and growth of granulosa cells, preventing follicular development to the next stage, inhibiting ovulation, and helping maintain ovarian reserve (Kedem et al., 2014; Kotlyar and Seifer, 2021). In addition, concomitant with the increase in AMH mRNA transcript abundance in old group, there was a decrease in BMP15 mRNA transcript abundance. Previous study has demonstrated the effect of BMP15 on reducing follicular AMH and OCLN (Stephens and Johnson, 2017). It has also been reported that OCLN plays a role in yolk accumulation and follicular development (Stephens and Johnson, 2017).

No significant changes in LR8 mRNA transcript abundance were observed in different groups in the current study. Consistent with the present research, the expression of this gene did not show any changes in follicles of mature and immature hens (Recheis et al., 2005; Seol et al., 2007). finally, it seems that aging and ovarian senescence disrupt the regulation of genes associated with follicular selection and yolk accumulation, leading to a disturbance in follicular growth and development and consequently a decrease in egg production and fertility.

Conclusion

This study demonstrated that the decrease in follicle numbers and changes in mRNA transcript abundance related to follicular selection and yolk accumulation in the mature group indicate the onset of the aging process. These changes were accompanied by a decline in fertility and hatchability and altered structure of the oviduct. Consequently, there was a remarkable decrease in egg production, fertility, and hatchability in old Japanese quail. The findings provide the basis for future research on avian aging and post-peak production period.

Declaration of competing interest

There are neither conflicts of interest nor conflicts due to professional or financial affiliation for part of any of the authors. Mahdi Zhandi

References

  1. Abd El-Azeem N.A., Madkour M., Aboela O.M. Productive performance and histological responses of japanese quail breeder to age at mating and silver nanoparticles administration. EJNF. 2018;21:807–822. [Google Scholar]
  2. Ainsworth S.J., Stanley R.L., Evans J.R.D. Developmental stages of the Japanese quail. J. Anat. 2010;216:3–15. doi: 10.1111/j.1469-7580.2009.01173.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bala M., Gupta A., Bansal N., Uppal V. Age related gross morphological studies on ovarian follicles in Punjab white quail. India. J. Vet. Pathol. 2015;27:64–66. [Google Scholar]
  4. Brake J., Walsh T.J., Benton Jr C.E., Petitte J.N., Meijerhof R., Peñalva G. Egg handling and storage. Poult. Sci. 1997;76:144–151. doi: 10.1093/ps/76.1.144. [DOI] [PubMed] [Google Scholar]
  5. Buyuk E., Nejat E., Neal-Perry G. Determinants of female reproductive senescence: differential roles for the ovary and the neuroendocrine axis. Semin. Reprod. Med. 2010;28:370–379. doi: 10.1055/s-0030-1262896. [DOI] [PubMed] [Google Scholar]
  6. Chen S.E., McMurtry J.P., Walzem R.L. Overfeeding-induced ovarian dysfunction in broiler breeder hens is associated with lipotoxicity. Poult. Sci. 2006;85:70–81. doi: 10.1093/ps/85.1.70. [DOI] [PubMed] [Google Scholar]
  7. El-Wardany I., Shourrap M.I., Madkour M., El-Azeem A.N.A. Effect of age at mating and silver nanoparticles administration on progeny productive performance and some blood constituents in Japanese quail. Int. J. Chemtech. Res. 2016;9:21–34. [Google Scholar]
  8. Farooq U., Malecki I.A., Etherington A., Greeff J. Effect of age on fertility in the Japanese quail (Coturnix Japonica) Proc. Aust. Poult. Sci. Symp. 2012;23:194. [Google Scholar]
  9. Fasenko G.M., Hardin R.T., Robinson F.E., Wilson J.L. Relationshi<of hen age and egg sequence position with fertility, hatchability, viability, and preincubation embryonic development in broiler breeders. Poult. Sci. 1992;71:1374–1383. doi: 10.3382/ps.0711374. [DOI] [PubMed] [Google Scholar]
  10. Francoeur L., Scoville D.M., Johnson P.A. Investigations of the function of AMH in granulosa cells in hens. Gen. Comp. Endocrinol. 2024;349 doi: 10.1016/j.ygcen.2024.114454. [DOI] [PubMed] [Google Scholar]
  11. Gonzalez-Moran M.G. Changes in progesterone receptor isoforms expression and in the morphology of the oviduct magnum of mature laying and aged nonlaying hens. BBRC. 2016;478:999–1005. doi: 10.1016/j.bbrc.2016.08.071. [DOI] [PubMed] [Google Scholar]
  12. Hameed T., Mustafa M.Z., Taj M.K., Asadullah A., Bajwa M.A., Bukhar F.A., Tariq Kiani M.M., Ahmed A. Hatchability and fertility in broiler breeder stock. JCBPS. 2016;6:266–274. [Google Scholar]
  13. Hansen K.K., Kittok R.J., Sarath G., Toom C.F., Caceres N., Beck M.M.M. Estrogen receptor-alpha populations change with age in commercial laying hens. Poult. Sci. 2003;82:1624–1629. doi: 10.1093/ps/82.10.1624. [DOI] [PubMed] [Google Scholar]
  14. Hao E.-Y., Wang D.-H., Chen Y.-F., Zhou R.-Y., Chen H., Huang R.-L.u. The relationship between the mTOR signaling pathway and ovarian aging in peak-phase and late-phase laying hens. Poult. Sci. 2021;100:334–347. doi: 10.1016/j.psj.2020.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. He W., Wang H., Tang C., Zhao Q., Zhang J. Dietary supplementation with astaxanthin alleviates ovarian aging in aged laying hens by enhancing antioxidant capacity and increasing reproductive hormones. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Holmes D.J., Thomson S.L., Wu J., Ottinger M.A. Reproductive aging in female birds. Exp. Gerontol. 2003;38:751–756. doi: 10.1016/s0531-5565(03)00103-7. [DOI] [PubMed] [Google Scholar]
  17. Hrabia A., Ha Y., Shimada K. Expression of estrogen receptor alpha mRNA in theca and granulosa layers of the ovary in relation to follicular growth in quail. Folia biologica. 2004;52:191–195. doi: 10.3409/1734916044527458. [DOI] [PubMed] [Google Scholar]
  18. Johnson P.A., Dickerman R.W., Bahr J.M. Decreased granulosa cell luteinizing hormone sensitivity and altered thecal estradiol concentration in the aged hen, gallus domesticus. Biol. Reprod. 1986;35:641–646. doi: 10.1095/biolreprod35.3.641. [DOI] [PubMed] [Google Scholar]
  19. Kedem A., Yung Y., Yerushalmi G.M., Haas J., Maman E., Hanochi M., Hemi R., Orvieto R., Dor J., Hourvitz A. Anti Müllerian hormone (AMH) level and expression in mural and cumulus cells in relation to age. J. Ovarian Res. 2014;7:113. doi: 10.1186/s13048-014-0113-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kimaro W.H., Madekurozwa M.C., Groenewald H.B. Histomorphometrical and ultrastructural study of the effects of carbendazim on the magnum of the Japanese quail (Coturnix japonica) OJVR. 2013;80:1–17. doi: 10.4102/ojvr.v80i1.579. [DOI] [PubMed] [Google Scholar]
  21. Kotlyar A.M., Seifer D.B. Ethnicity/race and age-specific variations of serum AMH in women—a review. Front. Endocrinol. 2021;11:1–6. doi: 10.3389/fendo.2020.593216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lacin E., Yildiz A., Esenbuga N., Macit M. Effects of differences in the initial body weight of groups on laying performance and egg quality parameters of Lohmann laying hens. Czech J. Anim. Sci. 2008;11:466–471. [Google Scholar]
  23. Lillpers K., Wilhelmson M. Age-dependent changes in oviposition pattern and egg production traits in the domestic hen. Poult. Sci. 1993;72:2005–2011. doi: 10.3382/ps.0722005. [DOI] [PubMed] [Google Scholar]
  24. Liu X., Lin X., Mi Y., Zeng W., Zhang C. Age-related changes of yolk precursor formation in the liver of laying hens. JZUS-B. 2018;19:390–399. doi: 10.1631/jzus.B1700054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Livak J.K., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  26. Ma Y., Yao J., Zhou S., Mi Y., Tan X., Zhang C. Enhancing effect of FSH on follicular development through yolk formation and deposition in the low-yield laying chickens. Theriogenology. 2020;157:418–430. doi: 10.1016/j.theriogenology.2020.07.012. [DOI] [PubMed] [Google Scholar]
  27. Machado J.P., Mesquita M.A., Cafeʹ M.B., Assis S.D., Veríssimo S., Santos R.R., Leandro N.S.M., Araújo I.C.S. Effects of breeder age on embryonic development, hatching results, chick quality, and growing performance of the slow-growing genotype. Poult. Sci. 2020;99:6697–6704. doi: 10.1016/j.psj.2020.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Meuer H.J., Baumann R. Oxygen pressure in intra- and extraembryonic blood vessels of early chick embryo. Respir. Physiol. 1988;71:331–341. doi: 10.1016/0034-5687(88)90026-6. [DOI] [PubMed] [Google Scholar]
  29. National Research Council (NRC) Natl. Acad. Press; Washington, DC: 1994. Nutrient requirements of poultry. [Google Scholar]
  30. Othman R.A., Amin M.R., Rahman S. Effect of egg size, age of hen and storage period on fertility, hatchability, embryo mortality and chick malformations in eggs of japanese quail (Coturnix coturnix japonica) IOSR-JAVS. 2014;7:101–106. [Google Scholar]
  31. Pan Y.E., Liu Z.C., Chang C.J., Huang Y.F., Lai C.Y., Walzem R.L., Chen S.E. Feed restriction ameliorates metabolic dysregulation and improves reproductive performance of meat-type country chickens. Anim. Reprod. Sci. 2014;15:229–236. doi: 10.1016/j.anireprosci.2014.10.003. [DOI] [PubMed] [Google Scholar]
  32. Park M.J., Ahn J.-W., Kim K.H., Bang J., Ch. Kim S., Jeong J.Y., Choi Y.E., Kim C.-W., Joo B.S. Prediction of ovarian aging using ovarian expression of BMP15, GDF9, and C-KIT. EBM. 2020;245:711–719. doi: 10.1177/1535370220915826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Parker H.M., Kiess A.S., Robertson M.L., Wells J.B., McDaniel C.D. The relationship of parthenogenesis in virgin Chinese Painted quail (Coturnix chinensis) hens with embryonic mortality and hatchability following mating. Poult. Sci. 2012;91:1425–1431. doi: 10.3382/ps.2011-01692. [DOI] [PubMed] [Google Scholar]
  34. Rafieian-Naeini H.R., Zhandi M., Sadeghi M., Yousefi A.R., Benson A.P. Effects of coenzyme Q10 on reproductive performance of laying Japanese quail (Coturnix japonica) under cadmium challenge. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Recheis B., Rumpler H., Schneider W.J., Nimpf J. Receptor-mediated transport and deposition of complement component C3 into developing chicken oocytes. CMLS. 2005;62:1871–1880. doi: 10.1007/s00018-005-5193-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Saemi F., Shahneh A.Z., Zhandi M., Akhlaghi A., Khaksar Z., Dadpasand M. Long-term effects of thyroxine-induced hyperthyroidism on the histological attributes of the oviduct in broiler breeder hens. Comp. Clin. Path. 2018;27:605–609. [Google Scholar]
  37. Santos T.C., Murakami A.E., Oliveira C.A.L., Moraes G.V., Stefanello C., Carneiro T.V. Influence of european quail breeders age on egg quality, incubation, fertility and progeny performance. Braz. J. Poult. Sci. 2015;17:49–56. [Google Scholar]
  38. SAS Institute . SAS Institute, Inc.; Cary, NC. USA: 2013. SAS/STAT Software, Release 9.4. [Google Scholar]
  39. Schneider W.J. Receptor-mediated mechanisms in ovarian follicle and oocyte development. Gen. Comp. Endocrinol. 2009;163:18–23. doi: 10.1016/j.ygcen.2008.11.032. [DOI] [PubMed] [Google Scholar]
  40. Schuster M.K., Schmierer B., Shkumatava A., Kuchler K. Activin A and follicle-simulating hormone control tight junctions in avian granulosa cells by regulating occludin expression. Biol. Reprod. 2004;70:1493–1499. doi: 10.1095/biolreprod.103.024331. [DOI] [PubMed] [Google Scholar]
  41. Seol H.S., Sato K., Matsubara Y., Schneider W.J., Akiba Y. Modulation of sterol regulatory element binding protein-2 in response to rapid follicle development in chickens. Comp. Biochem. Physiol. B. 2007;147:698–703. doi: 10.1016/j.cbpb.2007.04.012. [DOI] [PubMed] [Google Scholar]
  42. Stephens C.S., Johnson P.A. Bone morphogenetic protein 15 may promote follicle selection in the hen. Gen. Comp. Endocrinol. 2016;235:170–176. doi: 10.1016/j.ygcen.2016.06.027. [DOI] [PubMed] [Google Scholar]
  43. Stephens C.S., Johnson P.A. Occludin expression and regulation in small follicles of the layer and broiler breeder hen. Gen. Comp. Endocrinol. 2017;248:106–113. doi: 10.1016/j.ygcen.2017.02.010. [DOI] [PubMed] [Google Scholar]
  44. Sukhadeve S.V., Bansal N., Pathak D. Histomorphochemical studies on the magnum of punnjab white quails. Hary. Veterinar. 2021;60:1–4. [Google Scholar]
  45. Sun T., Xiao C., Yang Z., Deng J., Yang X. Grade follicles transcriptional profiling analysis in different laying stages in chicken. BMC Genom. 2022;23:492. doi: 10.1186/s12864-022-08728-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Taghipour-Shahbandi M., Zhandi M., Pirsaraei Z.A., Yousefi A.R. Comparison of egg quality characteristics, blood parameters and liver histology of japanese quails in different age groups. Res. Anim. Product. 2023;14:52–60. [Google Scholar]
  47. Tona K., Bamelis F., De Ketelaere B., Bruggeman V., Moraes V.M., Buyse J., Onagbesan O., Decuypere E. Effects of egg storage time on spread of hatch, chick quality, and chick juvenile growth. Poult. Sci. 2003;82:736–741. doi: 10.1093/ps/82.5.736. [DOI] [PubMed] [Google Scholar]
  48. Tona K., Onagbesan O., de Ketelaere B., Decuypere E., Bruggeman V. Effects of age of broiler breeders and egg storage on egg quality, hatchability, chick quality, chick weight, and chick posthatch growth to forty-two days. JAPR. 2004;13:10–18. [Google Scholar]
  49. Tona K., Onagbesan O., Jego Y., Kamers B., Decuypere E., Bruggeman V. Comparison of embryo physiological parameters during incubation, chick quality and growth performance of three lines of broiler breeders differing in genetic composition and growth rate. Poult. Sci. 2004;83:507–513. doi: 10.1093/ps/83.3.507. [DOI] [PubMed] [Google Scholar]
  50. Ulmer-Franco A.M., Fasenko G.M., O'Dea Christopher E.E. Hatching egg characteristics, chick quality and broiler performance at 2 breeder flock ages and from 3 egg weights. Poult. Sci. 2010;89:2735–2742. doi: 10.3382/ps.2009-00403. [DOI] [PubMed] [Google Scholar]
  51. Varga I., Kachlíkb D., ˇZiˇskováa M., Mikoa M. Lymphatic lacunae of the mucosal folds of human uterine tubes - A rediscovery of forgotten structures and their possible role in reproduction. Ann. Anat. - Anatomischer Anzeiger. 2019;219:121–128. doi: 10.1016/j.aanat.2018.06.005. [DOI] [PubMed] [Google Scholar]
  52. Yao J., Ma Y., Zhou S., Bao T., Zhang C. Metformin prevents follicular atresia in aging laying chickens through activation of PI3K/AKT and calcium signaling pathways. Oxid. Med. Cell. Longev. 2020;3648040 doi: 10.1155/2020/3648040. 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zakaria A.H., Miyaki T., Imai K. The effect of aging on the ovarian follicular growth in laying hens. Poult. Sci. 1983;62:670–674. doi: 10.3382/ps.0620670. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES